ID: 1163783632

View in Genome Browser
Species Human (GRCh38)
Location 19:19263143-19263165
Sequence ACTCCACTATGACTACCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163783632_1163783645 22 Left 1163783632 19:19263143-19263165 CCATTGGGTAGTCATAGTGGAGT No data
Right 1163783645 19:19263188-19263210 GCGCTCCCTGTGCAGGGTGGGGG No data
1163783632_1163783642 19 Left 1163783632 19:19263143-19263165 CCATTGGGTAGTCATAGTGGAGT No data
Right 1163783642 19:19263185-19263207 AAGGCGCTCCCTGTGCAGGGTGG No data
1163783632_1163783643 20 Left 1163783632 19:19263143-19263165 CCATTGGGTAGTCATAGTGGAGT No data
Right 1163783643 19:19263186-19263208 AGGCGCTCCCTGTGCAGGGTGGG No data
1163783632_1163783639 15 Left 1163783632 19:19263143-19263165 CCATTGGGTAGTCATAGTGGAGT No data
Right 1163783639 19:19263181-19263203 CCCAAAGGCGCTCCCTGTGCAGG No data
1163783632_1163783635 0 Left 1163783632 19:19263143-19263165 CCATTGGGTAGTCATAGTGGAGT No data
Right 1163783635 19:19263166-19263188 CCTGGTCTCCAGCACCCCAAAGG No data
1163783632_1163783641 16 Left 1163783632 19:19263143-19263165 CCATTGGGTAGTCATAGTGGAGT No data
Right 1163783641 19:19263182-19263204 CCAAAGGCGCTCCCTGTGCAGGG No data
1163783632_1163783644 21 Left 1163783632 19:19263143-19263165 CCATTGGGTAGTCATAGTGGAGT No data
Right 1163783644 19:19263187-19263209 GGCGCTCCCTGTGCAGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163783632 Original CRISPR ACTCCACTATGACTACCCAA TGG (reversed) Intergenic
No off target data available for this crispr