ID: 1163783633

View in Genome Browser
Species Human (GRCh38)
Location 19:19263148-19263170
Sequence GGGTAGTCATAGTGGAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163783629_1163783633 -10 Left 1163783629 19:19263135-19263157 CCACCTGTCCATTGGGTAGTCAT No data
Right 1163783633 19:19263148-19263170 GGGTAGTCATAGTGGAGTCCTGG No data
1163783626_1163783633 -2 Left 1163783626 19:19263127-19263149 CCTGCAGGCCACCTGTCCATTGG No data
Right 1163783633 19:19263148-19263170 GGGTAGTCATAGTGGAGTCCTGG No data
1163783623_1163783633 29 Left 1163783623 19:19263096-19263118 CCTGGGGGATCTGGTGAAAGAGA No data
Right 1163783633 19:19263148-19263170 GGGTAGTCATAGTGGAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163783633 Original CRISPR GGGTAGTCATAGTGGAGTCC TGG Intergenic
No off target data available for this crispr