ID: 1163783634

View in Genome Browser
Species Human (GRCh38)
Location 19:19263166-19263188
Sequence CCTTTGGGGTGCTGGAGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163783634_1163783641 -7 Left 1163783634 19:19263166-19263188 CCTGGTCTCCAGCACCCCAAAGG No data
Right 1163783641 19:19263182-19263204 CCAAAGGCGCTCCCTGTGCAGGG No data
1163783634_1163783645 -1 Left 1163783634 19:19263166-19263188 CCTGGTCTCCAGCACCCCAAAGG No data
Right 1163783645 19:19263188-19263210 GCGCTCCCTGTGCAGGGTGGGGG No data
1163783634_1163783639 -8 Left 1163783634 19:19263166-19263188 CCTGGTCTCCAGCACCCCAAAGG No data
Right 1163783639 19:19263181-19263203 CCCAAAGGCGCTCCCTGTGCAGG No data
1163783634_1163783642 -4 Left 1163783634 19:19263166-19263188 CCTGGTCTCCAGCACCCCAAAGG No data
Right 1163783642 19:19263185-19263207 AAGGCGCTCCCTGTGCAGGGTGG No data
1163783634_1163783644 -2 Left 1163783634 19:19263166-19263188 CCTGGTCTCCAGCACCCCAAAGG No data
Right 1163783644 19:19263187-19263209 GGCGCTCCCTGTGCAGGGTGGGG No data
1163783634_1163783649 26 Left 1163783634 19:19263166-19263188 CCTGGTCTCCAGCACCCCAAAGG No data
Right 1163783649 19:19263215-19263237 ACGATAGTCACACTCTGCTGTGG No data
1163783634_1163783643 -3 Left 1163783634 19:19263166-19263188 CCTGGTCTCCAGCACCCCAAAGG No data
Right 1163783643 19:19263186-19263208 AGGCGCTCCCTGTGCAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163783634 Original CRISPR CCTTTGGGGTGCTGGAGACC AGG (reversed) Intergenic
No off target data available for this crispr