ID: 1163783639

View in Genome Browser
Species Human (GRCh38)
Location 19:19263181-19263203
Sequence CCCAAAGGCGCTCCCTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163783630_1163783639 20 Left 1163783630 19:19263138-19263160 CCTGTCCATTGGGTAGTCATAGT No data
Right 1163783639 19:19263181-19263203 CCCAAAGGCGCTCCCTGTGCAGG No data
1163783634_1163783639 -8 Left 1163783634 19:19263166-19263188 CCTGGTCTCCAGCACCCCAAAGG No data
Right 1163783639 19:19263181-19263203 CCCAAAGGCGCTCCCTGTGCAGG No data
1163783632_1163783639 15 Left 1163783632 19:19263143-19263165 CCATTGGGTAGTCATAGTGGAGT No data
Right 1163783639 19:19263181-19263203 CCCAAAGGCGCTCCCTGTGCAGG No data
1163783629_1163783639 23 Left 1163783629 19:19263135-19263157 CCACCTGTCCATTGGGTAGTCAT No data
Right 1163783639 19:19263181-19263203 CCCAAAGGCGCTCCCTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163783639 Original CRISPR CCCAAAGGCGCTCCCTGTGC AGG Intergenic
No off target data available for this crispr