ID: 1163783641

View in Genome Browser
Species Human (GRCh38)
Location 19:19263182-19263204
Sequence CCAAAGGCGCTCCCTGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163783632_1163783641 16 Left 1163783632 19:19263143-19263165 CCATTGGGTAGTCATAGTGGAGT No data
Right 1163783641 19:19263182-19263204 CCAAAGGCGCTCCCTGTGCAGGG No data
1163783630_1163783641 21 Left 1163783630 19:19263138-19263160 CCTGTCCATTGGGTAGTCATAGT No data
Right 1163783641 19:19263182-19263204 CCAAAGGCGCTCCCTGTGCAGGG No data
1163783634_1163783641 -7 Left 1163783634 19:19263166-19263188 CCTGGTCTCCAGCACCCCAAAGG No data
Right 1163783641 19:19263182-19263204 CCAAAGGCGCTCCCTGTGCAGGG No data
1163783629_1163783641 24 Left 1163783629 19:19263135-19263157 CCACCTGTCCATTGGGTAGTCAT No data
Right 1163783641 19:19263182-19263204 CCAAAGGCGCTCCCTGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163783641 Original CRISPR CCAAAGGCGCTCCCTGTGCA GGG Intergenic
No off target data available for this crispr