ID: 1163783735

View in Genome Browser
Species Human (GRCh38)
Location 19:19263758-19263780
Sequence ACTTGGGCCTGGAGTAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163783735_1163783737 -8 Left 1163783735 19:19263758-19263780 CCTGACTTACTCCAGGCCCAAGT No data
Right 1163783737 19:19263773-19263795 GCCCAAGTCGCCCCTAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163783735 Original CRISPR ACTTGGGCCTGGAGTAAGTC AGG (reversed) Intergenic
No off target data available for this crispr