ID: 1163786715

View in Genome Browser
Species Human (GRCh38)
Location 19:19278602-19278624
Sequence AGGCTACTTTGGGCACCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 158}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163786710_1163786715 1 Left 1163786710 19:19278578-19278600 CCTGCTGTGATCGAGAGGGTAGC 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1163786715 19:19278602-19278624 AGGCTACTTTGGGCACCTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 158
1163786706_1163786715 23 Left 1163786706 19:19278556-19278578 CCTGCAGCGAAAAGGCCTGGCTC 0: 1
1: 0
2: 0
3: 12
4: 125
Right 1163786715 19:19278602-19278624 AGGCTACTTTGGGCACCTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 158
1163786704_1163786715 26 Left 1163786704 19:19278553-19278575 CCTCCTGCAGCGAAAAGGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 144
Right 1163786715 19:19278602-19278624 AGGCTACTTTGGGCACCTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 158
1163786707_1163786715 8 Left 1163786707 19:19278571-19278593 CCTGGCTCCTGCTGTGATCGAGA 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1163786715 19:19278602-19278624 AGGCTACTTTGGGCACCTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163786715 Original CRISPR AGGCTACTTTGGGCACCTGC AGG Intronic
900518010 1:3092307-3092329 AGGCTACTGTGTGCTCCTGAGGG + Intronic
901082646 1:6592317-6592339 AGGCTACTTTGGGTACTTTGAGG + Exonic
904481666 1:30797835-30797857 AGGCTGCATGGGACACCTGCTGG - Intergenic
905023457 1:34834003-34834025 AGGATAGATTGGGCAACTGCAGG - Intronic
907222211 1:52915209-52915231 ACACTCCTCTGGGCACCTGCTGG - Intronic
907433837 1:54431135-54431157 AGGTTCCTTTGGGAACCTGCTGG - Intergenic
910145192 1:84071821-84071843 AGGCTTCAGTGGGCCCCTGCTGG + Intergenic
911453833 1:98098388-98098410 AGTCGAGTTTGGGAACCTGCTGG + Intergenic
912279828 1:108301265-108301287 AGGCTTTTTTGGGCAGCTGGGGG + Intergenic
912288398 1:108393092-108393114 AGGCTTTTTTGGGCAGCTGGGGG - Intronic
913369133 1:118077489-118077511 AGGCAACTTTTGCCACCTGGTGG - Intronic
915366250 1:155318317-155318339 AGGCTACCATGGGCACCCTCTGG - Intronic
921725705 1:218521202-218521224 AGGCTACTTTGGGAAGTTGTGGG + Intergenic
1063462599 10:6224052-6224074 AAGCTACTGTGGCCACCTTCAGG - Intronic
1065881498 10:30041130-30041152 AAGCTACATGGGGCACATGCAGG + Intronic
1067426847 10:46217167-46217189 GGGCCACTTTGGGCCACTGCAGG + Intergenic
1070592640 10:77811676-77811698 TGGCTACCATGGGCCCCTGCTGG + Intronic
1070678291 10:78430669-78430691 AGGCAATGTTTGGCACCTGCTGG - Intergenic
1075085823 10:119413834-119413856 AGGCTGCTGTGGGCGCCTGAGGG - Intronic
1075117232 10:119637202-119637224 AAGCAACTTTGTGCACCTTCTGG + Intergenic
1075594898 10:123721841-123721863 AGGCTCCTGTGGGGACCAGCTGG + Intronic
1077229737 11:1453437-1453459 AGGCTGCTTTGTGCACTTCCTGG + Intronic
1077244134 11:1527844-1527866 AGGAAGCCTTGGGCACCTGCTGG - Intergenic
1080478078 11:32616877-32616899 AGGTTACTATGGGCACATGCAGG + Intronic
1080645145 11:34182657-34182679 AGGCTCCTATGGGGACCTGAAGG - Intronic
1082807008 11:57458097-57458119 AGTCTTCAGTGGGCACCTGCTGG + Intergenic
1083209003 11:61170999-61171021 AGGCTGCTTTGGGAGCCTCCAGG - Intergenic
1083297852 11:61724864-61724886 TTGCTACTCTGGGGACCTGCTGG - Intronic
1083629440 11:64088163-64088185 TGGCTGCTTTGGGTCCCTGCGGG - Intronic
1084296305 11:68214824-68214846 GCGCTTCCTTGGGCACCTGCCGG - Intergenic
1085283124 11:75343741-75343763 GGCCTCCTCTGGGCACCTGCAGG - Intronic
1086325278 11:85692463-85692485 AGGTTATTTTGGGGACTTGCAGG - Intergenic
1088574485 11:111257114-111257136 AGGCATCTGTTGGCACCTGCTGG + Intronic
1092021094 12:5202781-5202803 ATGCTACTTTGGGGACTGGCAGG - Intergenic
1092419780 12:8321426-8321448 CGGCTACTTTCGGGAGCTGCCGG + Intergenic
1096919826 12:55072110-55072132 CAGCTGCTTTGGGCACCAGCAGG + Intergenic
1103599624 12:122046226-122046248 GGGCAACTCTGGGCACCTGGAGG + Intronic
1103669656 12:122602665-122602687 AGTCTAGTTTGGGCAGCTGATGG - Exonic
1104789564 12:131473151-131473173 GGGCCACTTTGGGAACCAGCCGG + Intergenic
1104842000 12:131829893-131829915 AAGCCACTGTGGGGACCTGCAGG - Intronic
1104967355 12:132514269-132514291 GGTCTCCCTTGGGCACCTGCGGG - Intronic
1107710827 13:43149009-43149031 ACTCTCCTTTGGGCATCTGCTGG + Intergenic
1108905493 13:55466464-55466486 AGGCTACTTTTGGCAACCCCAGG + Intergenic
1110275441 13:73637136-73637158 AGTCTATTTTTGTCACCTGCTGG + Intergenic
1111607933 13:90564358-90564380 TGGCCACTTAGGGCACCAGCTGG - Intergenic
1114216666 14:20662357-20662379 AGTAAACTTTGGGCTCCTGCTGG - Intergenic
1114908702 14:27164356-27164378 TGGCTGCTTTGGGTGCCTGCAGG - Intergenic
1117566491 14:56999183-56999205 AGGCTCCTTTGGGCAAAAGCAGG + Intergenic
1119295060 14:73526309-73526331 AGGCCACTTTGGTCAGCTGGTGG - Intronic
1124405021 15:29384597-29384619 AGGCCACTCTGGGCACCTCCAGG + Intronic
1126645898 15:50874605-50874627 AGGCTTCAATGGGCTCCTGCTGG + Intergenic
1128876082 15:71202487-71202509 AGGCCACTTTGGGCTTCTGCAGG - Intronic
1133732364 16:8588830-8588852 AGGCTAATTTAGGTCCCTGCAGG + Intronic
1134419127 16:14070276-14070298 AGGCTACTTTCTCCACCTCCAGG + Intergenic
1137408832 16:48210941-48210963 AGGCTACCTTGGACACCACCAGG + Exonic
1139751039 16:69108964-69108986 AGGCAGCTCTGGGCACCTGAGGG - Intronic
1140550160 16:75856619-75856641 TGGCTGTTTTGGGCACCAGCAGG - Intergenic
1142222037 16:88860239-88860261 TGGGTACCTGGGGCACCTGCAGG + Intronic
1142595791 17:1029314-1029336 AGGATCCTTTGGGTACCAGCGGG - Intronic
1142667563 17:1471399-1471421 AGCTTTCTCTGGGCACCTGCTGG + Intronic
1143201795 17:5118402-5118424 TGGCTGCTCTGGGCAGCTGCAGG + Intronic
1147740405 17:42668132-42668154 TGGCTGCTTGGGGCAGCTGCAGG - Exonic
1148940594 17:51206985-51207007 AGGCACCTATGGGGACCTGCTGG - Exonic
1151147775 17:72057298-72057320 AGTCTATTCTGGCCACCTGCTGG - Intergenic
1153726745 18:7964548-7964570 AGAGTACTTTGGTCACCTGGTGG + Intronic
1154132972 18:11751907-11751929 GGGCGACGATGGGCACCTGCCGG - Intronic
1160028880 18:75241500-75241522 AGGCTTCCTTGCCCACCTGCAGG - Intronic
1160413209 18:78688649-78688671 AGGCTACTCAGGCCTCCTGCTGG + Intergenic
1160508197 18:79438820-79438842 AGGCCACTGTGGGCACCAGCGGG - Intronic
1160917321 19:1503472-1503494 AGGCTACTGTCGGTGCCTGCCGG - Intergenic
1163786715 19:19278602-19278624 AGGCTACTTTGGGCACCTGCAGG + Intronic
1164733727 19:30525339-30525361 AAGCTACTTTGAGCAGCTGGTGG - Intronic
1168271310 19:55251272-55251294 AGGTTACCATGGGCACCTGAGGG + Intronic
926188442 2:10709432-10709454 AGGATGCTGTGGGCAACTGCAGG - Intergenic
929916579 2:46141921-46141943 TGCCTACTTTGGGGTCCTGCTGG - Intronic
929917258 2:46146521-46146543 AGGCTTCTTGGAGCACCTGGTGG + Intronic
930829066 2:55724066-55724088 GGGCTACATTGGGGACTTGCAGG - Intergenic
946119146 2:217493938-217493960 AGGCTGCTTTGGACATCTGGGGG - Intronic
947066908 2:226237253-226237275 AGGCTACTATGGACTCCAGCCGG - Intergenic
1169299660 20:4431058-4431080 TGTTGACTTTGGGCACCTGCTGG + Intergenic
1169970547 20:11265409-11265431 AGGTAACTTTGGGAACCTGGTGG - Intergenic
1172937909 20:38633787-38633809 AGGCCACCTTGGGAATCTGCAGG - Intronic
1173593236 20:44241558-44241580 AGGCCACTTAGGCCACCTGCAGG - Intergenic
1173958845 20:47055812-47055834 GGGCTACTCTGAGCACATGCTGG - Intronic
1176140418 20:63542491-63542513 AGGCTACTTTGGGGAGGTGTGGG - Exonic
1176347009 21:5757764-5757786 AGGCAACTCTCGCCACCTGCAGG - Intergenic
1176353823 21:5878348-5878370 AGGCAACTCTCGCCACCTGCAGG - Intergenic
1176497818 21:7566691-7566713 AGGCAACTCTCGCCACCTGCAGG + Intergenic
1176541330 21:8155834-8155856 AGGCAACTCTCGCCACCTGCAGG - Intergenic
1176560281 21:8338879-8338901 AGGCAACTCTCGCCACCTGCAGG - Intergenic
1180000196 21:44992134-44992156 AGGCCACAGCGGGCACCTGCAGG + Intergenic
1203246271 22_KI270733v1_random:72253-72275 AGGCAACTCTCGCCACCTGCAGG - Intergenic
949699313 3:6737760-6737782 AGGGGACTGTGGGAACCTGCAGG + Intergenic
953041808 3:39262176-39262198 TGGCATCTTGGGGCACCTGCTGG + Intergenic
953277003 3:41511495-41511517 AGGCTACTATGAGCACCTTTTGG + Intronic
956334554 3:68148661-68148683 AGGCTGCTTTGGAAAGCTGCCGG - Intronic
956537513 3:70293995-70294017 AGTGTACTTTGGGCAACAGCTGG + Intergenic
969304420 4:6317671-6317693 AGGGTTCTCTGGGCTCCTGCAGG + Intergenic
969540744 4:7787583-7787605 AGGTTTCTGTGGGCACCAGCTGG - Intronic
970324564 4:14910080-14910102 AACCTATTTTGAGCACCTGCTGG + Intergenic
972352718 4:38251830-38251852 AGCCTACTTTGGGGAACTGCAGG - Intergenic
973980790 4:56306653-56306675 AGGGGACTTTGGGCAACTTCTGG + Intronic
979178515 4:117695543-117695565 AGGCTACTATGAGCATCTGTAGG + Intergenic
982366471 4:154584785-154584807 ATGCCACTTTGGGTACCTGAAGG + Exonic
991776338 5:70089393-70089415 AGGCCCCTTTGAGCCCCTGCTGG - Intergenic
991855625 5:70964840-70964862 AGGCCCCTTTGAGCCCCTGCTGG - Intergenic
991869637 5:71097618-71097640 AGGCCCCTTTGAGCCCCTGCTGG - Intergenic
994119873 5:96101842-96101864 CAGCTGCTTTGGGCACCAGCAGG + Intergenic
994119888 5:96101927-96101949 TGGCTGCTTTGGGCACTGGCAGG + Intergenic
994170111 5:96650358-96650380 AAGCTGCTTTGGGGAGCTGCTGG + Intronic
995836530 5:116405372-116405394 AGGCTGCTTCAGGCTCCTGCGGG + Intronic
997418901 5:133750637-133750659 GGGCTCCTTTGGGCCCCTGGAGG - Intergenic
997641303 5:135450583-135450605 TGGTTACTATGGGCACTTGCTGG + Intronic
999471196 5:151856971-151856993 CAGCTGCTTTGGGGACCTGCAGG + Intronic
999926636 5:156385869-156385891 AGGGTAGTTTGGGCAACTGTAGG - Intronic
1005671216 6:28108024-28108046 AGGCTCATTTGGGCATCTGAAGG - Intergenic
1007581159 6:42960941-42960963 AGGCTACGTCGAGCACCCGCTGG - Exonic
1011170194 6:84497011-84497033 AAGCTCTGTTGGGCACCTGCAGG - Intergenic
1013216483 6:108032281-108032303 TGGCCACTTTGGGCACTGGCGGG + Intergenic
1014687771 6:124524682-124524704 AGTCTACTTTTGTCACCAGCTGG - Intronic
1017688845 6:156942944-156942966 ATGCTACTATGAGCTCCTGCTGG - Intronic
1018028495 6:159823526-159823548 AGGATACTGAGGGCCCCTGCAGG - Intergenic
1021034071 7:15774941-15774963 TGACTGCTTTGGGCACCTGTAGG - Intergenic
1021891809 7:25193841-25193863 AGGCTGTTCTGGGCACCTGGAGG - Intergenic
1022488554 7:30799352-30799374 AGGCTCCTCTGAGCACCTGTGGG + Intronic
1023107621 7:36778109-36778131 AGCCTGCTTTGGAAACCTGCAGG - Intergenic
1026739424 7:72969501-72969523 AGGGCACATTGGGCACTTGCAGG - Intergenic
1027104307 7:75395572-75395594 AGGGCACATTGGGCACTTGCAGG + Intronic
1027517201 7:79156910-79156932 AGGCTTCAATGGGCCCCTGCTGG - Intronic
1028993146 7:97071944-97071966 AGGCTACTATGAGCACCTTTAGG - Intergenic
1031666027 7:124482840-124482862 AGGCTACTTAACGCACCTCCAGG - Intergenic
1034959870 7:155358465-155358487 AGCCTGCTGTGGGGACCTGCTGG + Exonic
1035299193 7:157886175-157886197 AGGCTCCCTAGGGAACCTGCAGG + Intronic
1035453409 7:158993758-158993780 CGTCTGCTTTGCGCACCTGCTGG + Intergenic
1036368471 8:8141796-8141818 AGGCTATTTTCGGGAGCTGCCGG - Intergenic
1036577392 8:10040774-10040796 AGGCTGATTTGGGGACCTGTGGG - Intergenic
1036882416 8:12523846-12523868 AGGCTATTTTCGGGAGCTGCCGG + Intergenic
1038386783 8:27156047-27156069 ATGCTTCTTTGTGCACCTGGTGG - Intergenic
1039654104 8:39379464-39379486 AGGCTGCTTTGGGGTCCTGAAGG + Intergenic
1043438901 8:80259867-80259889 TGGCCACCTTGGGCACCTGCAGG + Intergenic
1046779736 8:118202391-118202413 AGGCCACTTTGGGCACACTCTGG + Intronic
1047210677 8:122837504-122837526 AGGTTACTGTGGTCACCTACTGG + Intronic
1047595226 8:126371342-126371364 AGACAACTTTTGTCACCTGCAGG + Intergenic
1047601416 8:126429542-126429564 AGGCAACAGTGGGCACCTGAGGG + Intergenic
1048212413 8:132466412-132466434 AGGCTACTTTTGGCAGGGGCTGG - Intronic
1048473275 8:134722017-134722039 AGCACACTTTGGGCACCTGGTGG - Intergenic
1048928261 8:139290291-139290313 AGGCCAATATGTGCACCTGCAGG + Intergenic
1048972935 8:139655354-139655376 AGGCTATTTTGGGAACAAGCCGG - Intronic
1049598600 8:143496716-143496738 AGGTTACTTTGGGCAATTGTTGG - Intronic
1056956208 9:91083489-91083511 AAGTTACTTTGGTCACCCGCTGG + Intergenic
1057084539 9:92196863-92196885 AGGCTACTTTAGTCAGCTGGTGG - Intergenic
1057817775 9:98308248-98308270 GGGCTACTCTGGGGACCTGGTGG + Intronic
1058830741 9:108814185-108814207 CAGCTACTGTGGGCACCAGCAGG - Intergenic
1061046267 9:128166758-128166780 GGGCCACTTTGAGAACCTGCAGG - Exonic
1061543205 9:131289435-131289457 AGGCCTCTTTGGGCACCAGATGG - Intergenic
1203462604 Un_GL000220v1:55325-55347 AGGCAACTCTCGCCACCTGCAGG - Intergenic
1186788571 X:12975289-12975311 AGGCTACTTTGGGGAGCTGGGGG + Exonic
1189681517 X:43521117-43521139 AGGCTACTTTTGGCTACTTCTGG + Intergenic
1191659789 X:63637411-63637433 AGGTTATTTGGGGCAACTGCAGG + Exonic
1192077959 X:68018995-68019017 CGGCTAGTTTTGCCACCTGCTGG + Intergenic
1192084980 X:68087163-68087185 ACTCTACTTTGGCCACCTTCTGG - Intronic
1193335616 X:80285228-80285250 AGGCTACTTTTGTCAGCTGTTGG - Intergenic
1194516447 X:94861396-94861418 AGGCTACTGTGAGTAACTGCAGG + Intergenic
1196016715 X:110947304-110947326 AGGGTACTTTGGGCACATAAAGG + Intronic
1197876256 X:131110999-131111021 TGGCTACTTTGAGCAACTACAGG - Intergenic
1200040215 X:153359705-153359727 AGTCTGCTTTGGGCACCAGAGGG - Intronic
1200208596 X:154335188-154335210 AGGGTGCTCAGGGCACCTGCTGG + Intergenic
1202082912 Y:21103302-21103324 ATGCTATTTTGGGCAGCTACAGG + Intergenic