ID: 1163791859

View in Genome Browser
Species Human (GRCh38)
Location 19:19311435-19311457
Sequence TTTGATGCCCAGGCTGGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1025
Summary {0: 1, 1: 1, 2: 6, 3: 89, 4: 928}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163791853_1163791859 24 Left 1163791853 19:19311388-19311410 CCTGTGATTCTTCCAGCAAGATT 0: 1
1: 0
2: 0
3: 17
4: 155
Right 1163791859 19:19311435-19311457 TTTGATGCCCAGGCTGGGCGCGG 0: 1
1: 1
2: 6
3: 89
4: 928
1163791852_1163791859 25 Left 1163791852 19:19311387-19311409 CCCTGTGATTCTTCCAGCAAGAT 0: 1
1: 0
2: 2
3: 12
4: 158
Right 1163791859 19:19311435-19311457 TTTGATGCCCAGGCTGGGCGCGG 0: 1
1: 1
2: 6
3: 89
4: 928
1163791855_1163791859 12 Left 1163791855 19:19311400-19311422 CCAGCAAGATTGCTTTGGCTGTT 0: 1
1: 0
2: 6
3: 32
4: 200
Right 1163791859 19:19311435-19311457 TTTGATGCCCAGGCTGGGCGCGG 0: 1
1: 1
2: 6
3: 89
4: 928

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163791859 Original CRISPR TTTGATGCCCAGGCTGGGCG CGG Intronic
900081319 1:860397-860419 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
900107797 1:992728-992750 TTTGTTGCCCAGGCTGGCCTTGG + Intergenic
900160914 1:1223434-1223456 TCTGCTGCCCAGGCTGGAAGCGG + Intronic
900236654 1:1594813-1594835 TTGGTGGCCCAGGCTGGGTGGGG - Intergenic
900303455 1:1989660-1989682 TATGATGACCAGGCTGGTCTTGG + Intronic
900647340 1:3714901-3714923 TGAGCTGCCCAGGCAGGGCGAGG - Intronic
901036432 1:6338814-6338836 TTTTATACCCAGGCTGGGGACGG - Intronic
901223196 1:7595831-7595853 TGTGATGCCCAGGTGGGGTGGGG - Intronic
901543367 1:9936719-9936741 TATGTTGCCCAGGCTGGTCTCGG + Intronic
901598219 1:10401723-10401745 AATGAAGCCCAGGCTGGGCGCGG + Intronic
901623746 1:10610955-10610977 TTTAATAACCAGGCTGGGTGCGG + Intronic
902095852 1:13945181-13945203 ATTTATGTGCAGGCTGGGCGTGG + Intergenic
902182904 1:14703203-14703225 TAGGTTGACCAGGCTGGGCGAGG + Intronic
902252359 1:15162450-15162472 TTTGATCCCCAGGCTGGATGCGG - Intronic
902355029 1:15891689-15891711 TATGTTGCCCAGGCTGGTCTAGG + Intronic
902384022 1:16066175-16066197 CTTGAATCTCAGGCTGGGCGTGG - Intronic
902465681 1:16616730-16616752 TATGCTGCCCAGGCTGGACTTGG + Intergenic
902587650 1:17450624-17450646 TTAGCTGGGCAGGCTGGGCGCGG + Intergenic
902890951 1:19443184-19443206 TATGTTGCCCAGGCTGGTCTCGG - Intronic
902967420 1:20017447-20017469 TATAATATCCAGGCTGGGCGTGG - Intergenic
903207357 1:21792679-21792701 ATTGCTGATCAGGCTGGGCGTGG - Intergenic
903571188 1:24306809-24306831 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
903611514 1:24618173-24618195 TAAGTTGCCCAGGCTGGTCGTGG - Intergenic
903863062 1:26377003-26377025 TCAGATGACCTGGCTGGGCGTGG + Intergenic
903920104 1:26793944-26793966 TATGTTGCCCAGGCTGGTCATGG + Intronic
904024671 1:27494963-27494985 TGTGTTGCCCAGGCTGGTCTAGG + Intergenic
904143544 1:28371802-28371824 TCTGTTGCCCAGGCTGGTCTTGG + Intronic
904283070 1:29434968-29434990 TTTGATCCCCAGGCTGGGTGTGG + Intergenic
904548342 1:31294647-31294669 TGTTATGTGCAGGCTGGGCGCGG + Intronic
904608045 1:31709384-31709406 TAAGATGCCCTGGCTGGGCCTGG - Intergenic
904634055 1:31865985-31866007 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
905097624 1:35487534-35487556 TGTAGTGGCCAGGCTGGGCGTGG - Intronic
905098020 1:35492223-35492245 TATCATGACCAAGCTGGGCGCGG + Intronic
905244367 1:36602456-36602478 TTGGCTGCCCAGGGTGGGAGTGG + Intergenic
906386693 1:45375686-45375708 TGTGTTGCCCAGGCTGGTCCTGG - Intronic
907036184 1:51218399-51218421 TTAGGTACGCAGGCTGGGCGTGG - Intergenic
907055770 1:51366356-51366378 TTTGATGCCTTGGCTGGGTTTGG - Intronic
907603931 1:55796828-55796850 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
907756385 1:57314714-57314736 TATGTTGCCCAGGCTGGCCTGGG - Intronic
908234431 1:62136320-62136342 TTTAATGATCGGGCTGGGCGTGG - Intronic
908695723 1:66839228-66839250 TTTGTTGCCAAGGCTGGTCTTGG - Intronic
908779445 1:67676318-67676340 TGTGTTGCCCAGGCTGGTCTTGG + Intergenic
908811615 1:67987232-67987254 TGTCATTCCCAGGCTGGGCGGGG - Intergenic
909255125 1:73410493-73410515 TGTGTTGCCCAGGCTGGTCTTGG - Intergenic
910211890 1:84801937-84801959 TGTGTTGCCCAGGCTGGTCGCGG + Intergenic
910807570 1:91204033-91204055 TGTAACGCCAAGGCTGGGCGTGG + Intergenic
911220546 1:95240878-95240900 TTTTATGCCTAGGCTAGGTGTGG + Intronic
911604398 1:99886272-99886294 TATGTTGCCCAGGCTGGTCTTGG - Intronic
912099582 1:106189419-106189441 TCTGTTGCCCAGGCTGGAGGGGG - Intergenic
912539199 1:110399827-110399849 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
912824280 1:112891281-112891303 TTTGTTTTCCAGGCCGGGCGCGG - Intergenic
912926122 1:113914796-113914818 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
913145335 1:115983856-115983878 TTTTATGCCCAGGTTGGGGCAGG - Intronic
913361896 1:117989868-117989890 TTTGATCCCCAGGCCCGGCCTGG - Intronic
915153971 1:153859159-153859181 TATGTTGCCCAGGCTGGTCTTGG - Intronic
915449953 1:155997877-155997899 CTGGGTGCCCAGGCTGGGCATGG - Intronic
915501940 1:156325273-156325295 CTTGTTGCCCAGGCTAGGCATGG + Intronic
915958762 1:160246104-160246126 CTTGTTGCCCAGGCTGGATGGGG - Intronic
916449424 1:164906130-164906152 TTTGATCTCAAGGCTGGGAGAGG + Intergenic
916901412 1:169228197-169228219 ATAGAAGCCCAGGCTGGGCATGG - Intronic
917747387 1:178023980-178024002 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
918341335 1:183570273-183570295 TTTTCTGCCCAAGCTGGGCTTGG - Intronic
918472135 1:184885463-184885485 GATTGTGCCCAGGCTGGGCGCGG - Intronic
919690421 1:200523925-200523947 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
919693228 1:200546200-200546222 TTCGGTGCCCAGGCCGGGAGTGG - Intergenic
920629929 1:207642302-207642324 TTTGATGTTAGGGCTGGGCGCGG - Intergenic
920834678 1:209499021-209499043 TTTGTTGCCCAGGCTGGAGCTGG + Intergenic
920967870 1:210716141-210716163 CATGTTGCACAGGCTGGGCGTGG + Intronic
921714242 1:218401826-218401848 CTTGATGCCCAGTCGGGACGCGG - Intronic
922107923 1:222528314-222528336 TTAGATAACCAGGCCGGGCGCGG + Intronic
922510923 1:226166686-226166708 TATGTTGCCCAGGCTGGTCTCGG + Intronic
922753101 1:228080205-228080227 TTTGGGGGCCAGGCTGGGCAGGG - Intergenic
922753217 1:228080725-228080747 TATGTTGCCCAGGCTGGGGAAGG + Intergenic
922897400 1:229111103-229111125 TATGTTGCCCAGGCTGGTCCTGG - Intergenic
922962789 1:229662723-229662745 TATGTTGCCCAGGCTGGTCTGGG + Intergenic
923086305 1:230705869-230705891 TGTCCTGCCCAGGCTGGGGGCGG - Intronic
923168600 1:231391995-231392017 TATAAAGCACAGGCTGGGCGCGG + Intronic
923323117 1:232856291-232856313 TCTGTTGCCCAGGCTGGATGCGG - Intergenic
923516628 1:234703240-234703262 TATGTTGCCCAGGCTGGTCTCGG + Intergenic
923859226 1:237876404-237876426 TTTAATTGCCAGGCTGGGCCGGG + Intergenic
924209158 1:241746959-241746981 TATGTTGCCCAGGCTGGTCTCGG + Intronic
924844021 1:247747232-247747254 TTTGATGCCTAGGCTTGGAGTGG - Intergenic
1063535184 10:6876354-6876376 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1063777804 10:9283911-9283933 TATGTTGCCCAGGCTGGACTTGG + Intergenic
1063950086 10:11214080-11214102 TATGTTGCCCAGGCTGGTCTTGG - Intronic
1064223351 10:13460464-13460486 TATGTTGCCCAGGCTGGCCTTGG + Intronic
1064696165 10:17967591-17967613 TTTATTTCCCAGGCCGGGCGCGG + Intronic
1064915819 10:20456910-20456932 TATGTTGCCCAGGCTGGTCATGG + Intergenic
1065292761 10:24247504-24247526 ATTAATTTCCAGGCTGGGCGTGG + Intronic
1065632448 10:27694388-27694410 TTAAATCCCCAGGCTGGGCACGG + Intronic
1065729599 10:28698956-28698978 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
1065791112 10:29261869-29261891 TGTGTTGCCCAGGCTGGTCTCGG + Intergenic
1065804978 10:29385738-29385760 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1066144873 10:32547226-32547248 TATGTTGCCCAGGCTGGTCTTGG + Intronic
1066393653 10:34998634-34998656 TATGTTGCCCAGGCTGGTCTCGG - Intergenic
1066405771 10:35116674-35116696 TTAGATGCTCTGGCTGGGCATGG + Intergenic
1067022090 10:42809992-42810014 TGTGTTGCCCAGGCTGGTCTTGG + Intronic
1067126349 10:43519115-43519137 TGTGCTGCCCAGGCTGGTCCTGG + Intergenic
1067129182 10:43546283-43546305 AGTGAGGCCCTGGCTGGGCGTGG + Intergenic
1067162941 10:43842574-43842596 ATTGATGGCCAGGCTGGGGGCGG + Intergenic
1067341793 10:45411792-45411814 GTGGATGTCCAGGTTGGGCGTGG + Intronic
1068768991 10:60799051-60799073 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1068795619 10:61076393-61076415 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
1069018561 10:63460313-63460335 TTTGTTGCCCAGGCTGGTCTTGG - Intronic
1069265916 10:66457056-66457078 TTTGATGCCTAGGCTGGAGTGGG - Intronic
1069374394 10:67779331-67779353 TCTGTTGCTCAGGCTGAGCGCGG + Intergenic
1069501062 10:68953742-68953764 TTTGAGACCATGGCTGGGCGTGG + Intergenic
1069567064 10:69470683-69470705 TATGTTGCCCAGGCTGGTCTCGG - Intronic
1070053809 10:72914903-72914925 TTTGTTGCCCAGGCTGGCAATGG + Intronic
1070201755 10:74213311-74213333 TATGTTGCCCAGGCTGGTCTTGG + Intronic
1070599528 10:77856141-77856163 TTTTTTGCCCAGGCTGGTCTTGG - Intronic
1071772164 10:88741425-88741447 TTTGTTGCCTAGGCTGGTCTTGG + Intronic
1072073185 10:91940883-91940905 TTTGTTGGCCAGGCTCGGGGGGG + Intronic
1072432634 10:95386908-95386930 TATGTTGCCCAGGCTGGTCTTGG - Intronic
1072771596 10:98144502-98144524 ATTACTGCCCAGGCTGGGCACGG - Intronic
1072934992 10:99703750-99703772 TCTGTTGCCCAGGCTGAGTGTGG + Intronic
1073225402 10:101914196-101914218 TATGATACCCGAGCTGGGCGTGG + Intronic
1073239930 10:102050416-102050438 TCTGTTGCCCAGGCTGGGGCTGG - Intronic
1073251845 10:102124982-102125004 TGTGTTGCCCAGGCTGGACTCGG + Intergenic
1073408241 10:103317602-103317624 TTTGTTGCCCAGGCTTGGGGTGG - Intronic
1073561063 10:104497470-104497492 TATGTTGCCCAGGCTGGTCTCGG + Intergenic
1074002882 10:109390082-109390104 TTTGAGGTCCAGGCTGGACATGG + Intergenic
1074110028 10:110416471-110416493 TATGTTGCCCAGGCTGGTCCTGG - Intergenic
1074796749 10:116953917-116953939 ACTGATGCCTAGGCAGGGCGTGG - Intronic
1074908124 10:117882870-117882892 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1075022050 10:118959323-118959345 TTTGATGCCAAGGAGGGGTGGGG - Intergenic
1075095358 10:119467631-119467653 TTGGGAGCCCAGGCTGGGCGCGG - Intergenic
1075162959 10:120040824-120040846 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
1075596666 10:123735973-123735995 CTTGTTGGCCAGGCTGGGCTTGG + Intronic
1075604914 10:123797783-123797805 TTTGTGGCCCAGGCTGGTCTTGG + Intronic
1075765293 10:124888027-124888049 GTGGAGGTCCAGGCTGGGCGTGG + Intergenic
1076100931 10:127777623-127777645 TTTGTTGCCCAGGCTGGAGTGGG + Intergenic
1076742256 10:132492284-132492306 TATGTTGCCCAGGCTGGTCTCGG - Intergenic
1077067681 11:650552-650574 TTTGTTGGCCAGGCTGGCCCTGG + Intronic
1077376888 11:2209391-2209413 TTCCCAGCCCAGGCTGGGCGGGG + Intergenic
1077565156 11:3293529-3293551 TACCATACCCAGGCTGGGCGTGG + Intergenic
1077666383 11:4114261-4114283 TATGAAGGCCTGGCTGGGCGTGG + Intronic
1078001126 11:7496849-7496871 TTTGTTGCCCAGGCTGCTCTGGG - Intronic
1078055801 11:8008086-8008108 GTTGAAGTCCTGGCTGGGCGCGG - Intergenic
1078331359 11:10425113-10425135 TTTTATTCCCTTGCTGGGCGAGG + Intronic
1078773909 11:14376376-14376398 TTTTAAGACCAGGTTGGGCGCGG - Intergenic
1079031862 11:16992076-16992098 CTGCATGCCCAGGCTGGGGGGGG - Intronic
1079194969 11:18317544-18317566 TATCAGGCCCAGGCTGGGCGTGG - Intronic
1079377681 11:19908266-19908288 TTTGAGGTCCAGGGTGGGTGTGG + Intronic
1080022603 11:27578728-27578750 TATGTTGCCCAGGCTGGGATGGG + Intergenic
1080539201 11:33250457-33250479 TTGGATGTTCAGGCTGGGCGTGG + Intergenic
1080984830 11:37449910-37449932 GAGGATGCCCAGGCTGGGGGTGG + Intergenic
1081348683 11:42022054-42022076 TTTGATGTCTGGGCTGGGCCTGG - Intergenic
1081873729 11:46395049-46395071 TTTGTTGCCCAGGCTGGACTTGG + Intergenic
1082775055 11:57238185-57238207 CTTGTTGCCCAGGCTGGTCTAGG + Intergenic
1083203965 11:61136462-61136484 TGTGATGATCAGGCTGGGCGCGG - Intronic
1083275372 11:61594190-61594212 TGTGTTGCCCAGGCTGGTCTCGG + Intergenic
1083277860 11:61607274-61607296 TTTGAAGCTCAGTCTGGGCCAGG + Intergenic
1083338347 11:61941460-61941482 TATAAAGACCAGGCTGGGCGTGG + Intergenic
1083680592 11:64349987-64350009 TCTGATACCCAGGCTGTGTGCGG + Intronic
1083762825 11:64827911-64827933 TTTGATGTGGAGGCTGGGCCGGG - Intronic
1083797213 11:65024019-65024041 CTTGATTCCAAGGCCGGGCGTGG + Intronic
1083811656 11:65109923-65109945 GGTGCTGCCCAGGCTGGCCGGGG + Exonic
1083854667 11:65386814-65386836 CTGGATGCCCAGGCAGGGCAAGG - Intronic
1083931936 11:65850912-65850934 ATTGAGGCCCAGGCTGGGTGTGG + Intronic
1083983589 11:66194252-66194274 TCTGAAGTGCAGGCTGGGCGCGG - Intronic
1084037149 11:66518962-66518984 TTTGCTGCCCAAGCTGGTCTTGG + Intronic
1084501054 11:69535717-69535739 TATGATGCCCAGGCTGTTCTTGG + Intergenic
1084618009 11:70249369-70249391 TCTGTTGCCCAGGTTGGGTGCGG - Intergenic
1085429033 11:76430602-76430624 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
1085442415 11:76576902-76576924 TATGCAGTCCAGGCTGGGCGCGG - Intergenic
1085584477 11:77688722-77688744 TATGTTGCCCAGGCTGGTCTTGG - Intronic
1086474144 11:87152488-87152510 CTTGACGCCCAGGCTGGGCTTGG + Intronic
1086988045 11:93271336-93271358 TCTGTTGCCCAGGCTTGGAGTGG - Intergenic
1088116622 11:106319889-106319911 GTTGCTGTCTAGGCTGGGCGTGG + Intergenic
1088409963 11:109523227-109523249 TATGTTGCCCAGGCTGGACTTGG + Intergenic
1088593450 11:111422581-111422603 CTTGATGCCCAGGCTCGGTCTGG - Intronic
1088643217 11:111894127-111894149 TCTTCTGCACAGGCTGGGCGTGG + Intergenic
1089068663 11:115681661-115681683 TTTGAACCCAGGGCTGGGCGTGG + Intergenic
1089477548 11:118777536-118777558 TTGGATGCCAATGCTGGGCCAGG + Intronic
1089568378 11:119385298-119385320 TATGTTGCCCAGGCTGTGGGAGG - Intergenic
1089771927 11:120809179-120809201 TTAGAAGCCCAGGCTGGACAGGG - Intronic
1089965347 11:122650952-122650974 TGTGTTGCCCAGGCTGGTCTTGG - Intergenic
1090342061 11:126032804-126032826 TATGTTGCCCAGGCTGGTCTTGG - Intronic
1090713328 11:129407909-129407931 GTTGGAGCACAGGCTGGGCGCGG + Intronic
1090829935 11:130414323-130414345 TATGTTGCCCAGGCTGGTCTCGG + Intronic
1090840167 11:130480507-130480529 CTTGAAGCCTAGGCTGGGCTGGG + Intergenic
1090868828 11:130725267-130725289 TTTCCTGCCCAGGCAGGGTGGGG - Intergenic
1091282754 11:134391329-134391351 TGTGATGCCTGGGCTGGGCAGGG + Exonic
1091729977 12:2873509-2873531 TATGTTGCCCAGGCTGGTCTCGG - Intronic
1092249751 12:6886967-6886989 CGTGATGCCCAGGCTGGTCTTGG - Intronic
1092290373 12:7156759-7156781 TTTGATGCCCAGGCTCAGAGGGG - Intronic
1092461876 12:8694277-8694299 TGTGTTGCCCAGGCTGGTCTTGG + Intronic
1092490248 12:8938481-8938503 TATGTTGCCCAGGCTGGTCTTGG + Intronic
1092906925 12:13109296-13109318 ATCAATGCACAGGCTGGGCGTGG - Intronic
1093013671 12:14134745-14134767 TCTGTTGCCCAGGCTGGCCTTGG - Intergenic
1093025494 12:14241600-14241622 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1093919720 12:24845853-24845875 TGTGTTGCCCAGGCTGGTCTGGG - Intronic
1094193515 12:27721365-27721387 TTTGTGTCCCAGGCTGGGCATGG + Intronic
1095900306 12:47320989-47321011 TTTGTTGGCCAGGCTGGTCTCGG + Intergenic
1096061745 12:48707000-48707022 TATGTTGCCCAGGCTGGTCTCGG - Intronic
1096169046 12:49451597-49451619 TGTGTTGCCCAGGCTGGCCTTGG + Intronic
1096237932 12:49942498-49942520 TGGGATGCCCAGGCTGAGGGTGG - Intergenic
1096252934 12:50044921-50044943 TGTGTTGCCCAGGCTGGGGCTGG + Intergenic
1096644874 12:53027086-53027108 TCTGCTGCCCAGGCTGGTCTTGG - Intronic
1096724209 12:53548066-53548088 TGTGTTGCCCAGGCTGGTCTTGG + Intronic
1097976462 12:65691915-65691937 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
1098330226 12:69345094-69345116 TGTGTTGCCCAGGCTGGTCTTGG - Intergenic
1098431384 12:70423677-70423699 TATGTTGCCCAGGCTGGTCTTGG + Intronic
1099619431 12:84982476-84982498 TATGTTGCCCAGGCTGGTCTGGG + Intergenic
1100081350 12:90855238-90855260 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
1100623566 12:96305921-96305943 TATGTTGCCCAGGCTGGTCTTGG + Intronic
1101340579 12:103839449-103839471 TTTGTTGCCCAGGCTGGTCCTGG + Intronic
1101909684 12:108852004-108852026 TGTGTTGCCCAGGCTGGTCTTGG - Intronic
1101986562 12:109451740-109451762 TATGAGGCCCAGGATGGCCGGGG - Exonic
1102098281 12:110257727-110257749 CTGAATGTCCAGGCTGGGCGAGG - Intergenic
1102131058 12:110529181-110529203 CTTGTTGCCCAGGCTGGCAGTGG + Intronic
1102424106 12:112827217-112827239 GTGGTTGCCCAGGCTGGGGGAGG - Intronic
1102917748 12:116767418-116767440 TGTGTTGCCCAGGCTGGGCTCGG + Intronic
1103059363 12:117846502-117846524 TATGTTGCCCAGGCTGGTCTTGG + Intronic
1103067843 12:117914735-117914757 TATGTTGCCCAGGCTGGTCTTGG + Intronic
1103266295 12:119633377-119633399 TATGTTGCCCAGGCTGGTCAAGG - Intronic
1103444278 12:120983834-120983856 TAAGAGGCCAAGGCTGGGCGTGG - Intronic
1103580829 12:121914094-121914116 GTTGAAGACCAGGCTGGGCATGG - Intronic
1103628923 12:122243438-122243460 TGTGTTGCCCAGGCTGGTCTAGG + Intronic
1103658902 12:122497716-122497738 TTAGGTGCCTAGGCTGGGCATGG + Intronic
1103668279 12:122589671-122589693 TGTGTTGCCCAGGCTGGTCTTGG + Intronic
1103691936 12:122782131-122782153 TATGTTGCCCAGGCTGGACTTGG - Intronic
1103730346 12:123023091-123023113 TTCGAAGCACAGGCTGGGCTGGG + Intronic
1103744985 12:123116446-123116468 TATGTTGCCCAGGCTGGTCTTGG - Intronic
1103793949 12:123490637-123490659 TTTGTTGCCCAGGCTGGTTTCGG + Intronic
1103833953 12:123804091-123804113 TATGTTGCCCAGGCTGGTCTTGG + Intronic
1103980087 12:124731507-124731529 TTTATTGCTCAGGCTGGGTGCGG - Intergenic
1104178208 12:126352916-126352938 TTTGTGTGCCAGGCTGGGCGTGG + Intergenic
1104357779 12:128103030-128103052 TCTGTTGCCCAGGCTGAGTGCGG - Intergenic
1104891105 12:132140598-132140620 GGTGAGGCCCCGGCTGGGCGGGG - Exonic
1105329721 13:19404279-19404301 ATTAATTCCCAGGCTGGGCATGG - Intergenic
1105458537 13:20563178-20563200 TATGCTGCCCAGGCTGGTCTTGG + Intergenic
1105574145 13:21634395-21634417 TATGATGTGCTGGCTGGGCGTGG - Intergenic
1105642763 13:22283113-22283135 TGTGTTGCCCAGGCTGGTCTGGG + Intergenic
1105647327 13:22336002-22336024 TTAATTGACCAGGCTGGGCGTGG + Intergenic
1105906902 13:24820724-24820746 CTTGGAGGCCAGGCTGGGCGTGG - Intronic
1106304930 13:28501017-28501039 TGTGTTGCCCAGGCTGGTCTTGG - Intergenic
1108194255 13:47975954-47975976 AGTGATACCCAGGCTGGGTGTGG + Intronic
1108318681 13:49264514-49264536 TATGTTGCCCAGGCTGGTCTTGG - Intronic
1108343703 13:49523051-49523073 AATCATGCCCTGGCTGGGCGCGG - Intronic
1109286893 13:60420650-60420672 TCTGTTGACCAGGCTGGGCGTGG + Intronic
1110222429 13:73087884-73087906 TATGTTGCCCAGGCTGGTCTCGG - Intergenic
1110877907 13:80533460-80533482 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
1110997006 13:82122884-82122906 GATGATATCCAGGCTGGGCGCGG - Intergenic
1111140650 13:84113701-84113723 TTTAATGACAAGGCCGGGCGCGG - Intergenic
1111396321 13:87672712-87672734 TCTCAAGCCCAGGCAGGGCGAGG - Exonic
1111794278 13:92897658-92897680 TATGTTGCCCAGGCTGGTCATGG - Intergenic
1112408063 13:99138260-99138282 TTTGGTCTCCAGGCCGGGCGCGG - Intergenic
1112434877 13:99384726-99384748 TGTGATGCCAGGGCTGAGCGTGG + Intronic
1112434883 13:99384764-99384786 TGTGATGCCAGGGCTGAGCGTGG + Intronic
1112776818 13:102852878-102852900 TGTGTTGCCCAGGCTGGACTTGG - Intronic
1113414165 13:110115121-110115143 TGTGATGTCCAGGCTGTGGGAGG + Intergenic
1114532568 14:23404896-23404918 TCTGATGGCCAGGCTGGGAAGGG - Intronic
1114588081 14:23833093-23833115 TTCCATGGTCAGGCTGGGCGTGG - Intergenic
1114708100 14:24747961-24747983 ATTGATTTACAGGCTGGGCGTGG + Intergenic
1115571631 14:34672104-34672126 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
1115612937 14:35066267-35066289 TATGTTGCCCAGGCTGGTCTTGG + Intronic
1115900642 14:38143666-38143688 TTAGCTGACCAGCCTGGGCGGGG + Intergenic
1116345025 14:43782682-43782704 TTACATTCCCAGGCTGGGCACGG + Intergenic
1116748395 14:48850536-48850558 TTTGATGCCAGGGCTGGGCGCGG + Intergenic
1117431061 14:55662104-55662126 TCTGTTGCCCAGGCTGGAGGTGG + Intronic
1118022802 14:61736265-61736287 TCAGATATCCAGGCTGGGCGTGG - Intronic
1118608735 14:67523032-67523054 TGAGGAGCCCAGGCTGGGCGCGG + Intronic
1118692660 14:68354665-68354687 TTTGTTGCCCAGGCTGGTCTTGG - Intronic
1118994774 14:70825848-70825870 ACTGAGGTCCAGGCTGGGCGAGG - Intergenic
1119039375 14:71258849-71258871 TATGTTGCCCAGGCTGGTCTGGG - Intergenic
1119396815 14:74332392-74332414 GTTGTTGCCCAGGCTGGAAGTGG + Intronic
1119568527 14:75649248-75649270 TGTGATGCCCTGGCCGGGTGTGG - Intronic
1119602759 14:75988173-75988195 TGTGCTGCCCAGGCTGGACAAGG - Intronic
1119671375 14:76521319-76521341 TTTAATACCCAGGCTGGGCGTGG - Intergenic
1119785898 14:77313997-77314019 TCTGGAGCCCAGGCTGGGTGCGG - Intronic
1120548907 14:85845082-85845104 TATAATGCCCAGGCTGGTCTAGG - Intergenic
1120883841 14:89436129-89436151 TTTGATCTACAGGCCGGGCGCGG - Intronic
1121011550 14:90522996-90523018 TGTGGTGCCCATGCGGGGCGTGG - Intergenic
1121351623 14:93177861-93177883 ATTGAAGTTCAGGCTGGGCGTGG - Intergenic
1121355613 14:93211649-93211671 TATGATGCCCAGGCTGGTCTGGG - Intronic
1122073335 14:99219517-99219539 TTTGCTTCCTTGGCTGGGCGGGG - Intronic
1122215206 14:100199002-100199024 TTTGTTGCCCAGGCTGGTCTCGG - Intergenic
1122223850 14:100260995-100261017 TTTATTGCCCAGGCTGGTCTAGG + Intronic
1122396044 14:101432483-101432505 TGTGTTGCCCAGGCTGGTCTTGG + Intergenic
1122489988 14:102108299-102108321 TCTGTTGCCCAGGCTGGACTTGG + Intronic
1122537788 14:102478248-102478270 TATGTTGCCCAGGCTGGTCTTGG + Intronic
1123758195 15:23413279-23413301 TGTGTTGCCCAGGCTGGTCAGGG - Intergenic
1123898395 15:24851117-24851139 TTTGTTGCCCAGGCTGGTGGGGG + Intronic
1124482003 15:30087077-30087099 CTTCATCCCCAGGCTGGGAGTGG - Intronic
1124488461 15:30139177-30139199 CTTCATCCCCAGGCTGGGAGTGG - Intronic
1124543548 15:30608149-30608171 CTTCATCCCCAGGCTGGGAGTGG - Intronic
1124705795 15:31963110-31963132 TTTAATGCAGAGGCTGGGCATGG - Intergenic
1124755068 15:32399145-32399167 CTTCATCCCCAGGCTGGGAGTGG + Intronic
1125564373 15:40664882-40664904 TATGTTGCCCAGGCTGGTCTCGG + Intergenic
1125643589 15:41251842-41251864 TATGTTGCCCAGGCTGGTCTCGG + Intronic
1125815249 15:42578390-42578412 ATTGAGGGTCAGGCTGGGCGTGG - Intronic
1126054680 15:44719066-44719088 TTTGTTGTTCAGGCTGGGCGAGG + Intergenic
1126054694 15:44719155-44719177 TATGTTGCCCAGGCTGGTCTCGG - Intergenic
1126120057 15:45243358-45243380 TATGTTGCCCAGGCTGGACTCGG - Intergenic
1126151244 15:45525566-45525588 TATGTTGCCCAGGCTGGTCTGGG + Intergenic
1126585554 15:50282355-50282377 TATGTTGCCCAGGCTGGTCTTGG - Intronic
1126775489 15:52096769-52096791 AGTAATGCCCAGGCTGGGTGTGG + Intergenic
1126952363 15:53895071-53895093 TTTTTTGTCGAGGCTGGGCGTGG + Intergenic
1127085047 15:55416666-55416688 TTTGCTCCATAGGCTGGGCGCGG + Intronic
1127135907 15:55923355-55923377 TTAGATGGCCAGGCTGGGCATGG + Intronic
1127258966 15:57313993-57314015 TTTGTGGCCCAGGCTGGTCTTGG + Intergenic
1127715977 15:61649848-61649870 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1127777086 15:62272732-62272754 TATGCTGCCCAGGCTGGTCTCGG - Intergenic
1128027417 15:64450096-64450118 TTAGAAGCCCAGGGTGGGCTGGG + Intronic
1128105132 15:65038614-65038636 TTTGTTGCCCAGGTTGGTCTCGG + Intergenic
1128298064 15:66542158-66542180 TTTGTAGCCCAGGCCGGGCACGG + Intronic
1128492814 15:68167026-68167048 TATGTTGCCCAGGCTGGTCATGG + Intronic
1128593107 15:68920180-68920202 TGTGTTGCCCAGGCTGGTCTTGG + Intronic
1128899583 15:71408432-71408454 TATGTTGCCCAGGCTGGTCTTGG + Intronic
1128979690 15:72177069-72177091 TCTGTTGCCCAGGCTGGTCCTGG + Intronic
1129173045 15:73819571-73819593 TTTGTTGCCCAGGCTGGTCTTGG + Intergenic
1129234373 15:74214957-74214979 TTGTGTGCCCACGCTGGGCGAGG - Intergenic
1129349499 15:74946883-74946905 TCTGTTGCCCAGGCTGGACTGGG + Intergenic
1129786780 15:78314916-78314938 TGTGTTGCCCAGGCTGGTCTTGG + Intergenic
1130347852 15:83066088-83066110 TATGTTGCCCAGGCTGGTCTCGG - Intronic
1130910927 15:88270315-88270337 CTTCATTCCCAGGCTGGGAGTGG - Intergenic
1130963814 15:88682382-88682404 TTTGATGATCAGGCTGGTGGGGG - Intergenic
1131095889 15:89654297-89654319 TTTGAATCCCAGGCCGGGCACGG - Intronic
1131466510 15:92659701-92659723 TATGTTGCCCAGGCTGGTCTTGG + Intronic
1131796908 15:96028471-96028493 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1131938625 15:97535686-97535708 AATTATGACCAGGCTGGGCGCGG - Intergenic
1132226271 15:100144259-100144281 TGTGATTCCGTGGCTGGGCGTGG + Intronic
1132948377 16:2545839-2545861 TTTGTTGCCCAGGCTGGTCTTGG + Intronic
1133017194 16:2949486-2949508 TTTGCTGCCCAGGATGGACCTGG - Exonic
1133381187 16:5331838-5331860 GTTGGTGCCCAGGGTGGGCATGG - Intergenic
1133954036 16:10424169-10424191 TTTTCTGCCCTGGGTGGGCGAGG + Intronic
1134179522 16:12036288-12036310 TATGTTGCCCAGGCTGGTCTTGG + Intronic
1134184841 16:12076590-12076612 TGTTATGACCAGGCTGGGCGTGG - Intronic
1134327054 16:13216912-13216934 GTTGTTTCCAAGGCTGGGCGTGG - Intronic
1134398933 16:13890835-13890857 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1134452188 16:14370340-14370362 GCTGCTGACCAGGCTGGGCGTGG + Intergenic
1134690745 16:16189706-16189728 TTTGATACGTAGGCTGGGTGTGG - Intronic
1134860668 16:17557493-17557515 TCTGAGGTCCAGGCTGGGCGCGG - Intergenic
1135122872 16:19781696-19781718 TGTGATGCCTCGGCAGGGCGTGG + Intronic
1135255790 16:20940631-20940653 TTTGTTGCCCAGGCTGGTCTTGG + Intronic
1135306260 16:21370078-21370100 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
1135502937 16:23012881-23012903 TATGATGCCCAAGCTGGTCAGGG - Intergenic
1135706580 16:24680216-24680238 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1135768779 16:25200279-25200301 TATGTTGCCCAGGCTGGTCATGG - Intergenic
1135779552 16:25288385-25288407 ATCTATGCCCGGGCTGGGCGTGG + Intergenic
1136089833 16:27910810-27910832 TATGCTGCCCAGGCTGGTCTTGG - Intronic
1136303002 16:29349215-29349237 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
1136360997 16:29779647-29779669 TTTGAATTCCTGGCTGGGCGCGG + Intronic
1136424822 16:30162760-30162782 TTTCAGGCCCAGGCTGGGCACGG + Intergenic
1136594755 16:31240286-31240308 TATGTTGCCCAGGCTGGTCAGGG + Intergenic
1136626268 16:31464087-31464109 TATGTTGCCCAGGCTGGTCTCGG - Intronic
1137402184 16:48162868-48162890 TCTTATCCCCAGGCTGGGAGCGG - Intergenic
1137824046 16:51474542-51474564 TATGTTGCCCAGGCTGGTCCTGG + Intergenic
1137968278 16:52958487-52958509 TATGTTGCCCAGGCTGGTCCTGG - Intergenic
1137986591 16:53113907-53113929 TTTGTTGCACAGGCTGGTCTTGG + Intronic
1137995115 16:53202061-53202083 TATGTTGCCCAGGCTGGCCTTGG + Intronic
1138159513 16:54740289-54740311 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1138964853 16:62071768-62071790 TGTGATGAGCAGGCTGGGCGTGG - Intergenic
1139426434 16:66883029-66883051 TATGTTGCCCAGGCTGGTCTTGG + Intronic
1139533125 16:67553510-67553532 TATGTTGCCCAGGCTGGGAAGGG - Intergenic
1139554697 16:67699772-67699794 TTTGCTATCCAGGCTGGGCGCGG - Intronic
1139612920 16:68071838-68071860 TATGTTGCCCAGGCTGGGAATGG + Intronic
1139626130 16:68189860-68189882 TGTGTTGCCCAGGCTGGTCTCGG - Intronic
1140170686 16:72600709-72600731 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1140214698 16:72997877-72997899 TGTGTTGCCCAGGCTGGTCTTGG - Intronic
1140446479 16:75032811-75032833 TGTGTTGCCCAGGCTGGTCTGGG - Intronic
1140471304 16:75216696-75216718 TTTGTTGCCCAGGCTGGTGTTGG + Intergenic
1140526054 16:75623836-75623858 TTTGTCGCCCAGGCTGGAAGCGG + Intergenic
1140616368 16:76669124-76669146 TTGTGTGCCCAGGCTGGGGGTGG - Intergenic
1141050425 16:80757336-80757358 TATGTTGCCCAGGCTGGTCTCGG - Intronic
1141089899 16:81123056-81123078 CATGATGCCCAGGCTGGTCTTGG + Intergenic
1141252917 16:82375097-82375119 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
1141262052 16:82463038-82463060 TCTGTTGCCCAGGCTGGACTCGG - Intergenic
1141622336 16:85243012-85243034 TGTGTTGCCCAGGCTGGTCACGG + Intergenic
1141640246 16:85336755-85336777 TGTGAGGGCAAGGCTGGGCGTGG - Intergenic
1141681836 16:85549376-85549398 TGTGTTGCCCAGGCTGGTCTTGG + Intergenic
1141691590 16:85599858-85599880 TCTGTTGCCCAGGCTGGCAGTGG - Intergenic
1141730632 16:85820740-85820762 TCCCATTCCCAGGCTGGGCGTGG + Intergenic
1142065818 16:88061947-88061969 TGAGGTGCTCAGGCTGGGCGTGG - Intronic
1142073405 16:88103649-88103671 TGGGATGCCGAGGCTGGGTGGGG + Intronic
1142258121 16:89025420-89025442 AATAATGTCCAGGCTGGGCGCGG + Intergenic
1142383962 16:89750585-89750607 TTTGTTGGCCAGGCTGGTCTTGG - Intronic
1142630005 17:1219332-1219354 TGTGAGGCCATGGCTGGGCGTGG - Intronic
1142673666 17:1499982-1500004 TGTGTTGCCCAGGCTGAGTGCGG + Intronic
1143086304 17:4418661-4418683 TATGTTGCCCAGGCTGGTCTCGG + Intergenic
1143169713 17:4921469-4921491 TCTGTTGCCCAGGCTGGTCTGGG + Intergenic
1143396712 17:6605044-6605066 TATGTTGCCCAGGCTGGTCTTGG - Intronic
1143565721 17:7719417-7719439 GATGATGGCCAGGCTGGGTGCGG - Intronic
1143578550 17:7809901-7809923 TGTGTTGCCCAGGCTGGTCTTGG + Intronic
1143654634 17:8286768-8286790 TGTGTTGCCCAGGCTGGTCTCGG - Intergenic
1143696695 17:8625769-8625791 TCTGAGGCTCAGGCTGGACGCGG - Intronic
1143911231 17:10251506-10251528 TCTGATGCCCAAGCTCGGAGTGG - Intergenic
1143941993 17:10551902-10551924 ATTGAAGATCAGGCTGGGCGCGG - Intergenic
1143959558 17:10704140-10704162 TATGTTGCCCAGGCTGGTCGTGG - Intronic
1143969711 17:10786650-10786672 TGTGGTGCCTCGGCTGGGCGTGG + Intergenic
1144190531 17:12841395-12841417 TATGTTGCCCAGGCTGGTCTCGG - Intronic
1144239334 17:13294777-13294799 TATGATGTTCAGGCTGGGTGCGG - Intergenic
1144689556 17:17251579-17251601 TTAGTTGGACAGGCTGGGCGTGG - Intronic
1145861845 17:28217706-28217728 TCTGTTGCCCAGGCTGGGTGCGG + Intergenic
1146017940 17:29248718-29248740 ACTGAGGCTCAGGCTGGGCGCGG + Intronic
1146101975 17:29991590-29991612 TTTTCTGCCCAGGGTGGGCCAGG + Intronic
1146381975 17:32337257-32337279 TTTGTTGCCCAGGCTGGTCTAGG - Intronic
1147141841 17:38464762-38464784 TCTGCTGCCCAGGCTGGGGTGGG + Intronic
1147177200 17:38663379-38663401 CTTAAAGCCCAGGCTGGGAGAGG + Intergenic
1147417601 17:40304723-40304745 TGTGAGGTCCAGGCTGGGGGTGG + Intergenic
1147607110 17:41780193-41780215 TATGTTGCCCAGGCTGGTCTTGG - Intronic
1147647420 17:42042168-42042190 TATGTTGCCCAGGCTGGTCTTGG - Intronic
1147719653 17:42531168-42531190 CTTGTTGCCCAGGCTGGTCTTGG + Intergenic
1147973128 17:44230643-44230665 TGTGATTCTCAGGCTGGGCGTGG + Intergenic
1148227862 17:45911557-45911579 TATGTTGCCCAGGCTGGTCTCGG - Intronic
1148642305 17:49197256-49197278 TTCCATCTCCAGGCTGGGCGCGG - Intergenic
1148707564 17:49649045-49649067 TTTTACACCCAGGCTGGGCGCGG - Intronic
1148926483 17:51090468-51090490 TCTGTTGCCCAGGCTGGACTCGG - Intronic
1148926908 17:51095003-51095025 AGTGGTGGCCAGGCTGGGCGCGG + Intronic
1149443774 17:56697991-56698013 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
1149449214 17:56736827-56736849 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1149589880 17:57821010-57821032 TTTGCTGTCCAGTCTGGGCACGG + Intergenic
1150380957 17:64719117-64719139 CTGGAGGGCCAGGCTGGGCGCGG + Intergenic
1150448983 17:65249940-65249962 TTACATTCCAAGGCTGGGCGCGG - Intergenic
1150535496 17:66035128-66035150 TTTCAAGTTCAGGCTGGGCGTGG - Intronic
1150773115 17:68058463-68058485 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
1150775552 17:68078988-68079010 TTGGAGGGCCAGGCCGGGCGCGG - Intergenic
1151463007 17:74266451-74266473 TATGTTGCCCAGGCTGGTCTCGG - Intergenic
1151476901 17:74349280-74349302 ATTGATGAGCAGACTGGGCGGGG + Exonic
1151482481 17:74378619-74378641 TGTGCTGCTCAGGCCGGGCGCGG - Intergenic
1151582774 17:74989468-74989490 TTTACTGCCCAGGATGGGAGAGG - Intronic
1151770693 17:76158629-76158651 TATGTTTCCCAGGCTGGGCTGGG + Intronic
1152251113 17:79213145-79213167 ATTCATGTCCAGGCTGGGCGTGG - Intronic
1152289025 17:79428376-79428398 CTGGATGCGAAGGCTGGGCGGGG - Intronic
1152309234 17:79539148-79539170 TATGTTGCCCAGGCTGGTCTCGG - Intergenic
1152419623 17:80185251-80185273 TATGTTGCCCAGGCTGGTCTCGG + Intronic
1152465427 17:80463703-80463725 TATGTTGCCCAGGCTGGTCTCGG + Intergenic
1152788886 17:82267448-82267470 TTTGGGGCCCAGGCTGGAAGTGG - Intronic
1152813121 17:82391609-82391631 ACTGATGGTCAGGCTGGGCGCGG - Intronic
1155584431 18:27348479-27348501 ATGGAAGCCTAGGCTGGGCGTGG - Intergenic
1156244463 18:35284397-35284419 TATGGTGCCCAGGCTGTTCGTGG + Intronic
1156319773 18:36008374-36008396 TGTGTTGCCCAGGCTGGTCTTGG - Intronic
1156332749 18:36140043-36140065 TATGTTGCCCAGGCTGGTCTTGG + Intronic
1156472329 18:37385054-37385076 TGTGATCACTAGGCTGGGCGTGG + Intronic
1157199090 18:45643725-45643747 TTTGTTGCCAAGGCTGGTCTGGG + Intronic
1157203065 18:45675748-45675770 TATGTTTCCCAGGCTGGTCGTGG + Intronic
1157364372 18:47050077-47050099 TCTGTTGCCCAGGCTGGTCTGGG + Intronic
1159565436 18:70042663-70042685 TCTGAAGCCTTGGCTGGGCGCGG - Intronic
1159598485 18:70406068-70406090 TTTGACCCTAAGGCTGGGCGCGG - Intergenic
1160065589 18:75571055-75571077 TTTGTTGCCCAGGCTGGAGTGGG - Intergenic
1160878665 19:1309725-1309747 ATTAATGCTCAGGCTGGGAGGGG - Intergenic
1160886052 19:1348714-1348736 ATTGAGGCAGAGGCTGGGCGCGG - Intergenic
1161340852 19:3741289-3741311 TTTGATGTAGAGGCCGGGCGTGG - Intronic
1161350338 19:3787585-3787607 TTTGTTGCCCAGGCTGGTCTTGG + Intronic
1161419015 19:4165374-4165396 TATGTTGCCCAGGCTGGGCTGGG + Intronic
1161510102 19:4665529-4665551 ATAGATGTCCAGGCCGGGCGCGG + Intronic
1161722403 19:5910410-5910432 AGTGAGGCCCAGGCCGGGCGCGG + Exonic
1161793019 19:6372199-6372221 TTTGATTCCTCGGCCGGGCGTGG - Intergenic
1161809458 19:6463817-6463839 TGTGTTGCCCAGGCTGGTCTCGG + Intronic
1161846826 19:6716435-6716457 TGTGTTGCCCAGGCTGGTCTTGG + Intronic
1162033117 19:7925808-7925830 TGTGCGGCCCAGGCCGGGCGCGG - Intronic
1162390246 19:10385478-10385500 TATGTTGCCCAGGCTGGTCTGGG - Intergenic
1162478209 19:10913502-10913524 TCTGTTGCCCAGGCTGGAGGTGG - Intronic
1162516440 19:11150871-11150893 TTAAATGCCCAGGCCAGGCGCGG + Intronic
1162591253 19:11593391-11593413 TATGTTGCCCAGGCTGGTCTAGG - Intronic
1162631492 19:11930708-11930730 ATAGATGCCCAGACTGGGTGTGG + Intronic
1162669814 19:12246822-12246844 CATGTTGCCCAGGCTGGCCGCGG - Intronic
1162729502 19:12709818-12709840 TATGTTGCCCAGGCTGGTCTCGG + Intronic
1162854363 19:13457046-13457068 TTTGTTGCCTAGGCTGGTCTCGG - Intronic
1162885434 19:13693594-13693616 CTTGTTGCCCAGGCTGGTCTTGG + Intergenic
1162997629 19:14346303-14346325 TATGTTGCCCAGGCTGGCCTTGG - Intergenic
1163001473 19:14370540-14370562 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1163167745 19:15509249-15509271 TTGCATACCCAGGCTGGGCCAGG - Intronic
1163253715 19:16142224-16142246 TATATTGCCCAGGCTGGGGGAGG - Intronic
1163270525 19:16250564-16250586 AGTGCTACCCAGGCTGGGCGCGG + Intergenic
1163306084 19:16479912-16479934 TTGCATGTCCTGGCTGGGCGCGG + Intronic
1163343270 19:16723733-16723755 TCTGTTGCCAAGGCTGGGTGTGG + Intronic
1163413505 19:17171659-17171681 TCTGCAGCCCTGGCTGGGCGCGG + Intronic
1163555150 19:17987793-17987815 TATGTTGCCCAGGCTGGTCTCGG - Intronic
1163674637 19:18649377-18649399 CTGCATGCCCAGGCTGGCCGAGG + Intronic
1163699604 19:18780728-18780750 TGTGTTGCCCAGGCTGGTCTCGG + Exonic
1163738516 19:18996450-18996472 TATGTTGCCCAGGCTGGTCTCGG + Intronic
1163791859 19:19311435-19311457 TTTGATGCCCAGGCTGGGCGCGG + Intronic
1163837825 19:19586210-19586232 TGTGTTGCCCAGGCTGGTCTGGG - Intronic
1164630720 19:29760000-29760022 TCTGTTGCCCAGGCTGGGGTGGG - Intergenic
1165068984 19:33244628-33244650 TATGTTGCCCAGGCTGGACTCGG + Intergenic
1165086404 19:33351074-33351096 TATGTTGCCCAGGCTGGCCTTGG - Intergenic
1165233981 19:34405608-34405630 GTTGGAGACCAGGCTGGGCGCGG + Intronic
1165495318 19:36149354-36149376 AATGAGGCACAGGCTGGGCGTGG - Intronic
1165686719 19:37828277-37828299 ATCAATGCACAGGCTGGGCGTGG - Intergenic
1165777743 19:38414811-38414833 TTGGAAGCCCAGCCTGGGCGGGG + Intronic
1165791508 19:38495546-38495568 TATGTTGCCCAGGCTGGTCTTGG + Intronic
1165833124 19:38738928-38738950 TATGTTGCCCAGGCTGGTCTTGG - Intronic
1165913295 19:39243024-39243046 TATGTTGCCCAGGCTGGTCTGGG + Intergenic
1165947241 19:39451449-39451471 GGTCATGCTCAGGCTGGGCGCGG - Intronic
1165997409 19:39854117-39854139 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1166008057 19:39920629-39920651 AGAGATGCCCAGGCTGGGTGCGG - Intronic
1166129362 19:40736864-40736886 TGTGTTGCCCAGGCTGGTCTTGG + Intronic
1166214438 19:41326041-41326063 ATTTATACCGAGGCTGGGCGTGG + Intronic
1166761372 19:45226398-45226420 TATGTTGCCCAGGCTGGTCTCGG - Intronic
1166777415 19:45321658-45321680 TATGTTGCCCAGGCTGGTCTGGG + Intronic
1166829085 19:45627769-45627791 AGTGAGGCTCAGGCTGGGCGTGG + Intronic
1167131315 19:47587919-47587941 GTAGAAGCCCAGGCCGGGCGTGG - Intergenic
1167200571 19:48062318-48062340 GTTGAAGCCCTGGCTGGGTGCGG + Intronic
1167427265 19:49435857-49435879 TATGTTGCCCAGGCTGGTCTCGG - Intronic
1167500113 19:49841487-49841509 AAGGAGGCCCAGGCTGGGCGCGG + Intergenic
1168107443 19:54173312-54173334 TTTGGTTCCTGGGCTGGGCGGGG + Intergenic
1168152096 19:54454783-54454805 TGTGATCGCCAGGCTGGGGGTGG + Intronic
1168328165 19:55549143-55549165 TTAAATGCCTTGGCTGGGCGCGG + Intergenic
1168331948 19:55575589-55575611 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1168421923 19:56210064-56210086 TTTGTTGCCCAGGCTGGTGTGGG + Intergenic
1168460939 19:56557337-56557359 TTTGTTGCCCAGGCTGGTCTTGG + Intergenic
1168534469 19:57157619-57157641 TATGAGGTCCAGGCTGGGTGCGG - Intronic
1168548596 19:57274739-57274761 TTTGATTTCCAAGCTGGGCATGG + Intergenic
1168630767 19:57954409-57954431 TGAGGTGCCCAGGCTGGGCATGG - Intergenic
1168699029 19:58424763-58424785 TATGTTGCCCAGGCTGGACTTGG - Intergenic
925578052 2:5380975-5380997 CTTGTTGCCCAGGCTGGACACGG - Intergenic
926183192 2:10664375-10664397 TTTGTTTCCCAGGCTGGACTCGG - Intronic
927765238 2:25801128-25801150 TATGTTGCCCAGGCTGGTCCTGG + Intronic
927898224 2:26799359-26799381 CTTGTCGCCCAGGCTGGGTGGGG + Intronic
927941835 2:27108978-27109000 TTTGTTGCCCAGGCTGGTCTTGG + Intronic
928121490 2:28586948-28586970 TATGTTGCCCAGGCTGGTCTTGG + Intronic
928147432 2:28791993-28792015 TGTGTTGCCCAGGCTGGTCATGG - Intronic
928445281 2:31328681-31328703 TATGTTGCCCAGGCTGTGCTGGG + Intergenic
928535983 2:32242072-32242094 TATGTTGCCCAGGCTGGTCTCGG + Intronic
928536207 2:32244046-32244068 TATGTTGCCCAGGCTGGTCTTGG - Intronic
928558863 2:32456964-32456986 TATGTTGCCCAGGCTGGTCTTGG + Intronic
928573373 2:32629727-32629749 TTTGCCTCCTAGGCTGGGCGCGG - Intronic
929066316 2:37978622-37978644 TATGTTGCCCAGGCTGGTCTCGG - Intronic
929578739 2:43068681-43068703 TATGTCTCCCAGGCTGGGCGTGG - Intergenic
929627349 2:43422920-43422942 TATGTTGCCCAGGCTGGTCCAGG + Intronic
929699057 2:44146253-44146275 TATGATAACAAGGCTGGGCGCGG - Intergenic
930067294 2:47337371-47337393 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
930545059 2:52756922-52756944 TATGTTGCCCAGGCTGGTCTCGG - Intergenic
930938866 2:56989003-56989025 TTTCTTTCCCAGGCCGGGCGCGG - Intergenic
931388400 2:61817763-61817785 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
931392677 2:61857819-61857841 TATGTTGCCCAGGCTGGTCTCGG + Intergenic
931512454 2:63015546-63015568 TATGTTGCCCAGGCTGGACTGGG + Intronic
931751141 2:65331115-65331137 AATGCTGTCCAGGCTGGGCGTGG + Intronic
932392202 2:71404513-71404535 TTTGTTGCCCAGGCTGGTCTTGG - Intronic
933540085 2:83628968-83628990 TTTTATGCTCTGGCTGGGCGCGG - Intergenic
933634096 2:84688201-84688223 TCTGTTGCCCAGGCTGGGTGGGG - Intronic
933707055 2:85299257-85299279 ACTGATGCAGAGGCTGGGCGTGG + Intronic
933739587 2:85522978-85523000 TAAAGTGCCCAGGCTGGGCGTGG - Intergenic
933803363 2:85980582-85980604 TGAGATGACTAGGCTGGGCGTGG - Intergenic
934276712 2:91578953-91578975 TATGTTGCCCAGGCTGGCAGGGG + Intergenic
934601690 2:95663077-95663099 TCTGATGCCCAGACAGGGAGAGG - Intergenic
935172749 2:100623425-100623447 TTTGAGGCCCAGCCTGGTCATGG + Intergenic
935221582 2:101019776-101019798 TTAGATGAAGAGGCTGGGCGCGG + Intronic
935245873 2:101218618-101218640 CTTGGTGACTAGGCTGGGCGCGG - Intronic
935571792 2:104669767-104669789 TAGGATGCCCCGGCTGGGCGCGG - Intergenic
936086675 2:109474083-109474105 TTTGATGCACAGTCTGGGCCGGG + Intronic
936376652 2:111946982-111947004 TTGTTTGCCAAGGCTGGGCGCGG + Intronic
936446036 2:112596003-112596025 ATGCATGCCCAGGCTGGGCGCGG - Intergenic
936535049 2:113305243-113305265 TCTGATGCCCAGACAGGGAGAGG - Intergenic
936977110 2:118231493-118231515 CCTGATGCCCAGGGTGGGTGGGG - Intergenic
937109439 2:119351722-119351744 TCTGTTGCCCAGGCTGGGGCTGG - Intronic
937154495 2:119709472-119709494 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
937217508 2:120321963-120321985 TTGGATGCGCAGGGTGGGCCAGG + Intergenic
937251621 2:120527602-120527624 TCTGATGTGCAGGCTGGGGGTGG + Intergenic
937902085 2:127027697-127027719 TGTGTTGCCCAGGCTGGCCCAGG + Intergenic
937999770 2:127723553-127723575 TATGTTGCCCAGGCTGGTCTTGG - Intronic
938297945 2:130190127-130190149 TTTGCTGACCAGGCTAGGTGTGG + Intronic
938458821 2:131484538-131484560 TTTGCTGACCAGGCTAGGTGTGG - Intronic
938799157 2:134744751-134744773 ATGGTTGCCTAGGCTGGGCGTGG + Intergenic
938910905 2:135885235-135885257 TGTGATTCCCAGGCTGGGCGCGG - Intergenic
939763844 2:146220560-146220582 TCTGTTGCCCAGGCTGAGTGCGG - Intergenic
940665260 2:156601285-156601307 TATGTTGCCCAGGCTGGTCTTGG + Intronic
940876054 2:158898127-158898149 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
940894390 2:159066205-159066227 TATGTTGCCCAGGCTGGTCCTGG - Intronic
941693160 2:168522748-168522770 TTTGTTGCCCAGGCTGGGCTCGG + Intronic
941780587 2:169440390-169440412 TCTGATGACTAGGCTGGGCACGG + Intergenic
941948238 2:171123604-171123626 TATGTTGCCCAGGCTGGTCTCGG - Intronic
942175469 2:173329354-173329376 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
943309591 2:186309873-186309895 CTTGCTGCCAAGGCTGGGAGAGG - Intergenic
944577155 2:201100695-201100717 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
944718268 2:202397085-202397107 TTTCTTGCTCAGGCTGGGCACGG - Intronic
944792207 2:203142444-203142466 ACTGATGCCCAGGCTGGGCATGG - Intronic
945234056 2:207618143-207618165 TTTGATGCCCAGCCAAGGCTGGG - Intronic
945539495 2:211066979-211067001 ATTGTTTACCAGGCTGGGCGTGG - Intergenic
945834858 2:214827456-214827478 TTTGTTGCCCAGGCTGGTCATGG - Intergenic
946013579 2:216586310-216586332 TTTGTTGCCTAGGCTGGTCTTGG - Intergenic
946311321 2:218883879-218883901 ATTCATGCCCCGGCTGGGCCGGG + Intronic
946431743 2:219630024-219630046 TTTGCTGCCCAGGAGGGGCCTGG + Intronic
947585335 2:231352835-231352857 TTACATTCCCAGGCCGGGCGCGG + Intronic
947609942 2:231518500-231518522 TTTAATGAGTAGGCTGGGCGCGG - Intergenic
947640315 2:231704035-231704057 TGTGTTACTCAGGCTGGGCGGGG + Intergenic
947648622 2:231765057-231765079 TGTGTTGCCCAGGCTGGTCTTGG - Intronic
947684239 2:232068368-232068390 TTTGCTGCCTAGGCTGGTCTTGG - Intronic
947760886 2:232603044-232603066 TTTGTTGCCCAGGCTGGTCTGGG + Intergenic
948999529 2:241604757-241604779 TGTGTTGCCCAGGCTGGTCTTGG + Intronic
1169416494 20:5421258-5421280 TAGCATGTCCAGGCTGGGCGCGG - Intergenic
1169442742 20:5646495-5646517 CTTGTTGCCCAGGCTGGGGCTGG - Intergenic
1169485506 20:6027703-6027725 TTCAATTTCCAGGCTGGGCGGGG - Intronic
1169882370 20:10361241-10361263 TCTGTTGCCCAGGCTGGCAGTGG + Intergenic
1170206009 20:13799406-13799428 ACTGATGCCTCGGCTGGGCGTGG + Intronic
1170337946 20:15292075-15292097 TTTGCTGCCCAGGCTGAACTCGG + Intronic
1171041645 20:21769557-21769579 TTTGTTGCCCAGGCTGGTCTTGG + Intergenic
1171868929 20:30511105-30511127 TCTGATGCCCAGGCTGGAGCTGG - Intergenic
1171974336 20:31584669-31584691 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1172261260 20:33567872-33567894 TTTAATTTACAGGCTGGGCGTGG - Intronic
1172267591 20:33630147-33630169 TGTGTTGCCCAGGCTGGCCTTGG + Intronic
1172372053 20:34401093-34401115 TGTGTTGCCCAGGCTGGTCTTGG + Intronic
1172400302 20:34645150-34645172 TGTGTTGCCCAGGCTGGTCTTGG - Intronic
1172520407 20:35562141-35562163 GATGAGGTCCAGGCTGGGCGCGG + Intergenic
1172731776 20:37094926-37094948 ATAGAAACCCAGGCTGGGCGTGG - Intronic
1172925270 20:38528568-38528590 TCTGTTGCCCAGGCTGGTCTCGG + Intronic
1173480923 20:43398764-43398786 TCTGAGGCGCAGGCTGGGAGAGG - Intergenic
1173695032 20:45003201-45003223 TATGATGCCCAGGCTGGTTTTGG + Intronic
1173739010 20:45382819-45382841 TTTGTTGCCAGGGCTGGGAGTGG - Intronic
1173908966 20:46650096-46650118 CATGATGCCCTGGCTGGGCTGGG + Intronic
1173918737 20:46728188-46728210 TTTGACTCCCTGGCTGGACGGGG - Intronic
1173991210 20:47305039-47305061 CTTGCTGCCCAGGCTGGTCGCGG - Intronic
1174340327 20:49891259-49891281 TTTGCTGCCCTTGCTGGGGGCGG + Exonic
1174480331 20:50826765-50826787 TGTGATGTCCAGGCTGGTCTTGG - Intronic
1174623945 20:51898881-51898903 ATTGTTTCCTAGGCTGGGCGTGG - Intergenic
1174810903 20:53644825-53644847 TCTGTCGCCCAGGCTGGGTGTGG + Intergenic
1175125459 20:56748122-56748144 CTTGTTGCCCAGGCTGGAGGGGG + Intergenic
1175875279 20:62226599-62226621 TGTGTTGCCCAGGCTGGTCTTGG - Intergenic
1175968290 20:62670939-62670961 TATGATTTCCACGCTGGGCGTGG - Intronic
1176904072 21:14478972-14478994 TTTGAAGCCATGGCCGGGCGCGG + Intergenic
1177150724 21:17453045-17453067 TGTGTTGCCCAGACTGGGTGTGG + Intergenic
1177443927 21:21166494-21166516 CTTGATGACCAGGCCAGGCGCGG - Intronic
1177748212 21:25247170-25247192 TTTGTTGCCCAGGATGGTCTTGG - Intergenic
1177945605 21:27465781-27465803 TATGATACCCTGGCTGGGCGCGG - Intergenic
1178088918 21:29140976-29140998 TATGTTGCTCAGGCTGGGCTTGG + Intronic
1178293006 21:31385660-31385682 ATTGATGCCAAGACTGGGTGAGG - Intronic
1178391646 21:32203818-32203840 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
1178506710 21:33168734-33168756 TGTGTTGCCCAGGCTGGTCTTGG - Intronic
1178809235 21:35866339-35866361 CTTGCTGCCCAAGCTGGGCACGG + Intronic
1178848237 21:36191493-36191515 ATTCATGGCTAGGCTGGGCGAGG + Intronic
1179219627 21:39394907-39394929 TCTGTTGCCCAGGCTGGCAGTGG + Intronic
1179442009 21:41401575-41401597 TATGTTGCCCAGGCTGGTCTCGG + Intronic
1179494691 21:41764202-41764224 TTTGATGAGCAGGCTGCGCCAGG - Intronic
1179818946 21:43925348-43925370 TCTGCTGCCCAGACTGGGAGGGG - Exonic
1180126067 21:45791032-45791054 TGGGATGCCCAGGATGGGGGTGG + Intronic
1180565196 22:16657629-16657651 ATTAATTCCCAGGCTGGGCATGG + Intergenic
1180738871 22:18039226-18039248 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
1181012123 22:20047523-20047545 TCTGATCCCCGGGCTGGGTGAGG - Intronic
1181075606 22:20374057-20374079 CATGATGCCCAGCCTGGGAGAGG + Intronic
1181730177 22:24840232-24840254 TGTTTTGCCCAGGCCGGGCGTGG - Intronic
1181933032 22:26417973-26417995 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1182283121 22:29229138-29229160 TATGTTGCCCAGGCTGGTCTCGG - Intronic
1182383781 22:29917443-29917465 TGTGTTGCCCAGGCTGGCCTTGG - Intronic
1182440345 22:30359941-30359963 TATGTTGCCCAGGCTGGTCCTGG - Intronic
1182582159 22:31320690-31320712 TATGTTGCCCAGGCTGGACTGGG + Intergenic
1182618068 22:31601992-31602014 TATGTTGCCCAGGCTGGTCTTGG + Intronic
1183218916 22:36499323-36499345 TTTGATGCTCAGGCTAGGCATGG + Intronic
1183228403 22:36565689-36565711 TGTGTTGCCCAGGCTGGTCTCGG + Intronic
1183384085 22:37505000-37505022 TTGGACTCCCAGGCTGGGTGGGG - Intronic
1183490326 22:38112336-38112358 TAGGATGCTCAGGCTGGGCAGGG + Intronic
1183703635 22:39463708-39463730 TATGTTGCCCAGGCTGGTCTCGG - Intronic
1183816467 22:40306000-40306022 TTTAATTCACTGGCTGGGCGCGG + Intronic
1184163618 22:42714384-42714406 TATGTTGCCCAGGCTGGTCCCGG - Intronic
1184224198 22:43119768-43119790 TTTGTTGCCCAGGCTTGTCTCGG - Intronic
1184381886 22:44149863-44149885 TATCATGGGCAGGCTGGGCGCGG + Intronic
1184551627 22:45207612-45207634 ATTGAAAGCCAGGCTGGGCGCGG - Intronic
1184586499 22:45451716-45451738 TCTGTTGCCCAGGCTGAGTGCGG + Intergenic
1184770745 22:46595191-46595213 TTTCAATCCCAGGGTGGGCGTGG + Intronic
1184960340 22:47923894-47923916 CTAGATTCCCAGGCTGGGCCAGG + Intergenic
1185067774 22:48640603-48640625 TTTCTTGCAGAGGCTGGGCGGGG + Intronic
949981644 3:9505847-9505869 TTGGAAACCCTGGCTGGGCGTGG - Intronic
949989090 3:9562633-9562655 TGTGTTGCCCAGGCTGGTCTTGG + Intergenic
950019343 3:9776096-9776118 GTTGAAGACCAGGCTGGGCAAGG - Intronic
950032099 3:9860084-9860106 TTGGGTGCCAAGGCTGGGCAGGG + Intergenic
950317390 3:12015758-12015780 TTTAATGCCTAGGCTGAGAGAGG - Intronic
950389769 3:12687364-12687386 TTTGCTGCACAGGCTGGGCGCGG + Intergenic
950415943 3:12869123-12869145 CTCTTTGCCCAGGCTGGGCGGGG + Intronic
950417391 3:12876238-12876260 CTCTTTGCCCAGGCTGGGCGGGG + Intergenic
950478005 3:13226167-13226189 TTTGATGAATTGGCTGGGCGCGG - Intergenic
951588554 3:24239513-24239535 TATGTTGCCCAGGCTGGTCTCGG + Intronic
951714732 3:25628272-25628294 TTTGTTGCCCAGGCTGGTCTTGG - Intronic
951920357 3:27847953-27847975 CATGTTGCCCAGGCTGGTCGCGG - Intergenic
952863277 3:37832719-37832741 TGGGAAGCCCAGGCTGGGCTGGG - Intergenic
952940140 3:38437740-38437762 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
953651319 3:44807512-44807534 TTTCAGTCACAGGCTGGGCGCGG - Intronic
953657352 3:44864150-44864172 GTTGCTGCCCAGGGTGGACGTGG + Intronic
953788434 3:45928725-45928747 TCTGTTCCCCAGGCTGGGCTAGG + Intronic
954168608 3:48781274-48781296 GTTGTTGGCAAGGCTGGGCGTGG - Intronic
954210600 3:49094803-49094825 TCTGAGGCCCAGGCTGGGTCAGG + Intergenic
954743555 3:52773827-52773849 CTGGATGGCCAGGCTGGGCCTGG - Intergenic
955392135 3:58529688-58529710 TCTGAAGCCCAGGCCAGGCGAGG + Intronic
956423618 3:69110550-69110572 TTTTATAACAAGGCTGGGCGCGG + Intronic
957721035 3:83999936-83999958 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
958001848 3:87761096-87761118 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
958192855 3:90205312-90205334 TCTTATGTCCAGGCTGGGCACGG - Intergenic
959062383 3:101627594-101627616 TTTGCTGTCCAGGCTGGTCTTGG + Intergenic
959511179 3:107214157-107214179 TTTGCTGTCATGGCTGGGCGTGG - Intergenic
960734018 3:120758118-120758140 TCTGTTGCCCAGGCTGGCAGTGG - Intronic
960786858 3:121383078-121383100 TATGTTGCCCAGGCTGGCCTTGG - Intronic
960943253 3:122948198-122948220 GTGGATGCCCTGGCTGGGGGTGG - Intronic
960984348 3:123264108-123264130 TTTGTTGCCCAGGCTGGTCTTGG + Intronic
961681783 3:128604334-128604356 TCTGATGCCCAGGCAGGTCCTGG + Intergenic
961687123 3:128641647-128641669 TTTGTTGCCCAGGCTGGCAATGG + Intronic
961784850 3:129341521-129341543 TTGGGTGCCAAGGCTGGGCAGGG + Intergenic
961884382 3:130086463-130086485 TTTGTTGCCCAGGCTGATCTTGG - Intronic
962504274 3:136030008-136030030 TATGTTGCCCAGGCTGGTCTTGG - Intronic
963800984 3:149675993-149676015 TTTGAGTTCTAGGCTGGGCGCGG - Intronic
964319721 3:155482345-155482367 TTTTAGGCCCAGGCTAGGCAAGG + Exonic
965722043 3:171672690-171672712 TATGTTGCCCAGGCTGGTCTTGG + Intronic
965812574 3:172606984-172607006 TTAGAAGGCCTGGCTGGGCGTGG + Intergenic
966628470 3:182045911-182045933 TATGTTGCCCAGGCTGGTCTCGG + Intergenic
966856793 3:184199691-184199713 TCTGTTGCCCAGGCTGGATGAGG - Intronic
967032827 3:185624242-185624264 TTTGTTGCCCAGGCTAGTCTCGG + Intronic
967053978 3:185811881-185811903 TCTGATGCCCAGGCAGGGAGAGG - Intronic
967730257 3:192900650-192900672 CTTGTTGCACAGGCCGGGCGCGG + Intronic
968028575 3:195463733-195463755 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
968093827 3:195914310-195914332 TAAGATGCTCAGGCTGGGCGCGG - Intergenic
968133846 3:196208100-196208122 TATGTTGCCCAGGCTGGTCTGGG + Intronic
968453302 4:685000-685022 TGCGAGGCCCAGGCTGGGAGGGG + Intronic
968557529 4:1254273-1254295 TTCGATACCTAGGCTGGGCACGG - Intergenic
968683469 4:1938566-1938588 CTGGGTGCCCAGGCTGGGCTGGG + Intronic
968837249 4:2974049-2974071 TATGTTGCCCAGGCTGGCCTCGG + Intronic
968918216 4:3507013-3507035 TGTGTTGCCCAGGCTGGTCTCGG - Exonic
969034054 4:4237435-4237457 TATGTTGCCCAGGCTGGCGGGGG - Intronic
969198155 4:5579549-5579571 GAAGATGCCGAGGCTGGGCGTGG + Intronic
969300605 4:6294862-6294884 GTTGAGGACCAGGCTGGGTGAGG - Intronic
969526106 4:7704887-7704909 GCTGATTCACAGGCTGGGCGAGG + Intronic
970601015 4:17641133-17641155 TATGTTGCCCAGGCTGGTCTTGG + Intronic
971032541 4:22656357-22656379 TGTGCTGCCCAGGCTGGTCTCGG + Intergenic
971505968 4:27366950-27366972 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
972513399 4:39790891-39790913 TTTGTTGCCCAGTCTGGTCTTGG - Intergenic
973683589 4:53346562-53346584 CTTGAGGCCAAGGCTGGGGGTGG - Intronic
973852268 4:54972860-54972882 TTAGATTTCTAGGCTGGGCGCGG - Intergenic
974006474 4:56562012-56562034 TTTGATTCCCAGGCCAGGCGCGG - Intronic
974011071 4:56607784-56607806 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
974436532 4:61863525-61863547 AATGATGCCCAGGCCGGGCACGG - Intronic
975119286 4:70711158-70711180 TGTGTTGCCCAGGCTGGTCTTGG + Intronic
975122833 4:70747811-70747833 TATGTTGCCCAGGCTGGACTTGG - Intronic
975879789 4:78890902-78890924 TTTGCTGCCTAGGCTGGGTGGGG + Intronic
975902876 4:79173855-79173877 TTTAATGCCTAGGCTGGCCCTGG + Intergenic
976244185 4:82990771-82990793 TTGGGTTCCCTGGCTGGGCGCGG - Intronic
976616257 4:87080622-87080644 TATGGTGCCCAGGCTGGCCTGGG - Intronic
976653425 4:87460657-87460679 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
976749433 4:88439305-88439327 TGTGTTGCCCAGGCTGGACTTGG - Intronic
976815155 4:89139348-89139370 TTTGTTGCCCAGGCTGGTCTGGG - Intergenic
977240333 4:94560761-94560783 GCTGTTGCCCAGGCTGGGTGTGG + Intronic
977532145 4:98212573-98212595 TTAGATTTCAAGGCTGGGCGCGG - Intergenic
977638458 4:99328096-99328118 TTTGCTGCCCTGGATGGGCCAGG + Intergenic
978435154 4:108676281-108676303 TGTGTTGCCCAGGCTGGACTGGG + Intergenic
978502231 4:109421835-109421857 TCTGTTGCCCAGGCTGGTCTTGG + Intergenic
979624824 4:122832535-122832557 TTTGTGCCCCAGGCTGGGCACGG - Intronic
979687309 4:123524972-123524994 GTTGAATTCCAGGCTGGGCGCGG - Intergenic
980022755 4:127729457-127729479 TATGTTGCCCAGGCTGGACTTGG + Intergenic
980502565 4:133674716-133674738 TGTGATCCCCAGGCCGGGTGCGG - Intergenic
981193769 4:141894536-141894558 TTTGTTGCCCAGGCTGGAGCTGG + Intergenic
982051282 4:151504906-151504928 ATTTCTTCCCAGGCTGGGCGCGG - Intronic
982104431 4:151999272-151999294 TTTGAGGCTCTGGCCGGGCGTGG + Intergenic
984246570 4:177281945-177281967 TTATTTGCCCAGGCTGGGCATGG - Intergenic
985893033 5:2730923-2730945 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
986016859 5:3765029-3765051 TTTGTAGCCAAGGCTGGGAGTGG - Intergenic
986175103 5:5345739-5345761 GTTTATGCTCAGGCCGGGCGTGG + Intergenic
986692859 5:10328166-10328188 TATGTTGCCCAGGCTGAGCTGGG + Intergenic
986785807 5:11112850-11112872 TATCATGTACAGGCTGGGCGCGG + Intronic
986911167 5:12559098-12559120 TTTGTTGCCCAGGCTGGTCTTGG + Intergenic
987295448 5:16546367-16546389 TATGTTGCCCAGGCTGGTCTGGG + Intronic
987304443 5:16624546-16624568 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
987581593 5:19800915-19800937 CGTGTTGCCCAGGCTGGTCGCGG - Intronic
988486088 5:31669198-31669220 TATGCTGCCCAGGCTGGTCCTGG - Intronic
988938546 5:36116962-36116984 AATGAAGGCCAGGCTGGGCGTGG - Intronic
989267999 5:39499905-39499927 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
989383301 5:40830403-40830425 TATGTTGCCCAGGCTGGTCTTGG - Exonic
990270284 5:54130035-54130057 TCTGTTGCCCAGGCTGGTCTTGG - Intronic
990539450 5:56757611-56757633 TTGGCTGCCTTGGCTGGGCGCGG + Intergenic
990904439 5:60788755-60788777 TCTGTTGCCCAGGCTGGACCAGG - Intronic
991698041 5:69291643-69291665 ATTTATGGCCAGGCTGGGTGTGG - Intronic
991984201 5:72266567-72266589 GATGAAGCCCATGCTGGGCGTGG + Intronic
992586867 5:78249784-78249806 TTTGTTGCCCAGGCTGGTCTCGG + Intronic
993909506 5:93664104-93664126 TCTGTCACCCAGGCTGGGCGGGG + Intronic
994381390 5:99076237-99076259 TTTGAGATCCAGACTGGGCGTGG + Intergenic
994722161 5:103392814-103392836 TTTGGTGCCGAGGCTTGGCAGGG + Intergenic
995392804 5:111657463-111657485 TTTGATCCTGCGGCTGGGCGTGG - Intergenic
995657184 5:114439796-114439818 CTTGATTCCCAGGCTGGGTGGGG + Intronic
996115658 5:119615452-119615474 TGTGTAGTCCAGGCTGGGCGTGG + Intronic
996717993 5:126602712-126602734 TATCTTGCCCAGGCTGGGCGCGG + Intronic
996732610 5:126730306-126730328 TGTGTTGCCCAGGCTGGTCTCGG - Intergenic
997017192 5:129949871-129949893 TATGATGGATAGGCTGGGCGCGG + Intronic
997150174 5:131485125-131485147 TATGTTGCCCAGGCTGGTCTTGG + Intronic
997154626 5:131540871-131540893 TTCAATTCACAGGCTGGGCGTGG + Intronic
997611796 5:135220762-135220784 TGTGATGCCCAGGCTATGCCTGG + Intronic
997987737 5:138517078-138517100 TAAAATGTCCAGGCTGGGCGGGG + Intronic
998084874 5:139312057-139312079 TTAGAAGCCTTGGCTGGGCGTGG - Intronic
999105595 5:149068204-149068226 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
999213235 5:149908813-149908835 TATGTTGCCCAGGCTGGCCCTGG - Intronic
999216036 5:149935948-149935970 TATGTTGCCCAGGCTGGTCTTGG - Intronic
999996134 5:157094238-157094260 TTTGCTGCCCAGGCTGATCTTGG + Intronic
1000849505 5:166322620-166322642 TATGTTGCCCAGGCTGGTCTGGG + Intergenic
1001027667 5:168237850-168237872 TTTAAATCCCAGGCCGGGCGCGG + Intronic
1001319549 5:170668981-170669003 CTGGATTCCCAGGCTGGGCTGGG + Intronic
1001412835 5:171522978-171523000 TATGTTGCCCAGGCTGGCCTTGG + Intergenic
1001461884 5:171923201-171923223 TTTGTTATCCAGGCTGGGTGTGG - Intronic
1001930610 5:175670229-175670251 TATGTTGCCCAGGCTGGTCTTGG - Intronic
1002141725 5:177145620-177145642 TTCCATGGCCAGGCTGGGCGTGG + Intronic
1002172089 5:177380881-177380903 TATGTTGCCCAGGCTGGTCTTGG + Intronic
1002509341 5:179703057-179703079 TTAGCTGGGCAGGCTGGGCGTGG - Intronic
1003209536 6:4048776-4048798 TGTGTTGCCCAGGCTGGGAGGGG + Intronic
1003406499 6:5830984-5831006 AAAGTTGCCCAGGCTGGGCGCGG + Intergenic
1003514910 6:6809983-6810005 TTTAAAGTCCAGGCTGGGTGCGG - Intergenic
1003897271 6:10619553-10619575 TATGTTGCCCAGGCTGGTCTCGG + Intronic
1004107271 6:12677413-12677435 TATGTTGCCCAGGCTGGTCCTGG + Intergenic
1004591539 6:17056401-17056423 TTGGGTAGCCAGGCTGGGCGCGG - Intergenic
1004608626 6:17217495-17217517 TTTGAGACCAAGGCTGGGTGTGG - Intergenic
1004640018 6:17506187-17506209 TTAGATGAGCTGGCTGGGCGTGG - Intronic
1004710034 6:18160953-18160975 TATGTTGCCCAGGCTGGTCTTGG + Intronic
1004728510 6:18334463-18334485 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1005307252 6:24525675-24525697 TTTGTTGCTCAGGCTGGGCTGGG - Intronic
1005326565 6:24707558-24707580 TCTGTTGCCCAGGCTGGTCTTGG + Intronic
1005356561 6:24989752-24989774 TTTAATACCCTGGCTGGGCGCGG + Intronic
1005495705 6:26385838-26385860 AGTGAAGCCCAGGCTGGGCGTGG - Intronic
1006329001 6:33375986-33376008 TCTGCTCCCCAGGCTGGGCGAGG - Intergenic
1006753893 6:36397796-36397818 TATGTTGCCCAGGCTGGTCCTGG - Intronic
1006852163 6:37106674-37106696 TTAAATAACCAGGCTGGGCGCGG + Intergenic
1007055054 6:38874569-38874591 TATGTTGCCCAGGCTGGTCTAGG + Intronic
1007405058 6:41630462-41630484 CATGTTGCCCAGGCTGGTCGCGG - Intergenic
1007557706 6:42781025-42781047 TATGTGGCCCAGGCCGGGCGCGG - Intronic
1007610549 6:43146124-43146146 TATGTTGCCCAGGCTGGTCTCGG - Intronic
1008594685 6:53029688-53029710 TATGCTGCCCAGGCTGGCCTTGG - Intronic
1008667611 6:53731733-53731755 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
1008695224 6:54028281-54028303 TTTGAAGACCAAGCTGGGGGTGG - Intronic
1009675852 6:66820227-66820249 TATGGTGCCCAGGCTGGTCTTGG + Intergenic
1009963734 6:70555541-70555563 ACTGATTTCCAGGCTGGGCGAGG - Intronic
1010617859 6:78034785-78034807 TATGCTGTACAGGCTGGGCGTGG - Intergenic
1010759483 6:79706629-79706651 TGTGTTGCCCAGGCTGGTCTTGG - Intergenic
1011440096 6:87378686-87378708 TTTGATCCCCAGGCCGGGCACGG + Intronic
1011597731 6:89032243-89032265 CTTGTTGCCCAGGCTGGAGGGGG + Intergenic
1011745770 6:90406596-90406618 CTTGGTGCCCAGGCTGAGTGTGG + Intergenic
1011764632 6:90606702-90606724 TTTGGCTACCAGGCTGGGCGCGG - Intergenic
1013121785 6:107147725-107147747 TTTGTTGCCCAGGCTGGTCTTGG - Intergenic
1013131142 6:107233963-107233985 TATGTTGCCCAGGCTGGTCTTGG - Intronic
1013239253 6:108228256-108228278 TTAGCTGGGCAGGCTGGGCGTGG + Intronic
1013321295 6:108992315-108992337 CTTGTTGGCCAGGCTGGTCGTGG + Intronic
1013337097 6:109174645-109174667 ATTAATACGCAGGCTGGGCGTGG + Intergenic
1013534563 6:111052013-111052035 TCTGTTGCCCAGGCTGAGTGTGG - Intergenic
1014238548 6:118989250-118989272 AATCATGTCCAGGCTGGGCGCGG - Intronic
1014321623 6:119937039-119937061 TTTGTTGCCCAGGCTGGCTGGGG + Intergenic
1014572577 6:123028456-123028478 TATGCTGCCCAGGCTGGTCTCGG - Intronic
1015535395 6:134262472-134262494 TCTGTTGCCCAGGCTGGTCTTGG + Intronic
1015750919 6:136558086-136558108 TTTTATGCTTGGGCTGGGCGCGG + Intronic
1016416003 6:143834530-143834552 TTAGATGCCATGGCTGGGTGTGG - Intronic
1017289430 6:152718454-152718476 TATGTTGCCCAGGCTGGTCTGGG + Intronic
1017642639 6:156509332-156509354 TATGTTGCCCAGGCTGGTCTCGG + Intergenic
1017673641 6:156792400-156792422 TATGTTGCCCAGGCTGGTCTTGG - Intronic
1017783203 6:157732747-157732769 TATGCTGCCCAGGCTGGCCTTGG + Intronic
1018154029 6:160968933-160968955 ATGGAGGCCCAGACTGGGCGCGG + Intergenic
1018229947 6:161665933-161665955 TCTGATGTCCATGCTGGGCATGG - Intronic
1018259121 6:161951880-161951902 TCTGTTGCCCAGGCTGGCAGTGG - Intronic
1018457937 6:163969619-163969641 TTTGGTGCCCATGTTGGGGGTGG - Intergenic
1018610310 6:165641985-165642007 TTTGACGCCCATTCGGGGCGTGG + Intronic
1019467454 7:1197203-1197225 TGTGTTGCCCAGGCTGGCCTGGG + Intergenic
1019581559 7:1766215-1766237 ATTGTAGCCCAGGCTGGGCATGG - Intergenic
1019666702 7:2255534-2255556 TGTGTTGCCCAGGCTGGCCTTGG - Intronic
1019744955 7:2694495-2694517 TATGTTGCCCAGGCTGGCCTTGG + Intronic
1019814686 7:3190842-3190864 TGTGTTGCCCAGGCTGGTCTTGG - Intergenic
1020244990 7:6423048-6423070 TATGTTGCCCAGGCTGGTCTTGG - Intronic
1020528272 7:9293516-9293538 TTTGTTGCCCAGGCTGGTCTTGG + Intergenic
1021226723 7:18036580-18036602 TTTCAGGCTCAGGCTGGGAGCGG - Intergenic
1021724569 7:23536625-23536647 TTTGAAAGCCTGGCTGGGCGTGG - Intergenic
1022007236 7:26277400-26277422 TTTGATGTTTAGGCTGGGCTCGG - Intergenic
1022494554 7:30844697-30844719 GTTGGTGCCCAGGCTGGGAGGGG + Intronic
1022791731 7:33695771-33695793 TCTGTTGCCCAGGCTGGTCTTGG - Intergenic
1022923162 7:35036849-35036871 TTTAAAGCCCAGGCAGAGCGCGG + Intronic
1023180381 7:37476402-37476424 TTTGGTGCCCAGAATGGGCAAGG + Intergenic
1023371335 7:39515325-39515347 TGTGGTGCCCAGGCTGGTCTTGG + Intergenic
1024316956 7:48029158-48029180 GTCCATGCCCTGGCTGGGCGTGG - Intergenic
1024779456 7:52830261-52830283 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1025623682 7:63198342-63198364 AGTGGTGACCAGGCTGGGCGAGG - Intergenic
1025840719 7:65143268-65143290 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1025877994 7:65506895-65506917 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
1025882331 7:65552689-65552711 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
1025891111 7:65649913-65649935 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1026294176 7:69036655-69036677 TATGTTGCCCAGGCTGGTCTGGG - Intergenic
1026682056 7:72474482-72474504 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1026689015 7:72536374-72536396 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1026724243 7:72858260-72858282 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1026846531 7:73701887-73701909 TGTGTTGCCCAGGCTGGTCTCGG - Intronic
1027174566 7:75895058-75895080 TTTCATGACAAGGCTGGGCATGG - Intergenic
1027208555 7:76124441-76124463 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1027216645 7:76188071-76188093 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1028219326 7:88177053-88177075 ATTAAAGACCAGGCTGGGCGTGG - Intronic
1028560886 7:92174769-92174791 ATCTATGTCCAGGCTGGGCGTGG + Intronic
1029091685 7:98053334-98053356 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
1029242679 7:99175377-99175399 TGTGTTGCCCAGGCTGGTCTCGG + Intronic
1029373037 7:100161310-100161332 TATGTTGCCCAGGCTGGCCTCGG - Intronic
1029469313 7:100744137-100744159 TATGTTGCCCAGGCTGGTCTCGG + Intronic
1029545741 7:101209740-101209762 TATGTTGCCCAGGCTGGTCTTGG + Intronic
1029843263 7:103388088-103388110 TATGTTGCCCAGGCTGGTCTTGG + Intronic
1029897735 7:104003396-104003418 TTTGATGCCTAGGCTGGGCGTGG + Intergenic
1030234229 7:107241740-107241762 TATGAAGCACAGGCTGGGCGCGG - Intronic
1030310601 7:108065107-108065129 TTTGCGGCCCAGGCTGGTCTTGG + Intronic
1030336333 7:108331195-108331217 TATGTTGCCCAGGCTGGTCTTGG - Intronic
1030604533 7:111625545-111625567 TTTGTTGTCCAGGCTGGACTTGG + Intergenic
1032208403 7:129889780-129889802 TATGTTGCCCAGGCTGGTCTCGG - Intronic
1032844702 7:135742485-135742507 TTGGCTGCCCAGGCTGGCCGTGG + Intronic
1033254618 7:139789446-139789468 TGTGTTGCCCAGGCTGGTCTAGG + Intronic
1034147727 7:148887014-148887036 TATGTTGCCCAGGCTGGTCTCGG - Intergenic
1034323108 7:150203860-150203882 TTTGGTGCCCGGGCCGGGTGTGG - Intergenic
1034675646 7:152891044-152891066 TATTAAGCCCAGGCTGGGCCAGG - Intergenic
1034770073 7:153765244-153765266 TTTGGTGCCCGGGCCGGGTGTGG + Intergenic
1034893911 7:154863101-154863123 TATGTTGCCCAGGCTGGTCTCGG + Intronic
1035125628 7:156606817-156606839 GGTGGTGCCCAGGCGGGGCGTGG - Intergenic
1035362586 7:158323137-158323159 CTTGCTGCCCTGGCTGGGAGAGG + Intronic
1035523945 8:297077-297099 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1035793800 8:2334198-2334220 TTTGTTACCCAGGCTGAGTGCGG + Intergenic
1036197342 8:6731069-6731091 TGTGTTGCCCAGGCTGGTCTTGG + Intronic
1036517153 8:9455011-9455033 TATGCAGCCCTGGCTGGGCGCGG + Intergenic
1037914986 8:22767788-22767810 TCTGTTGCCCACGCTGGGCTCGG + Intronic
1038274141 8:26105866-26105888 TCTGCTGCCCAGGCTGGAAGTGG + Intergenic
1038427677 8:27474806-27474828 GCTGATGCCCAGGCTGGGGTGGG - Intronic
1038505324 8:28079498-28079520 TTTGTTGCCCAGGCTGGCAGTGG - Intronic
1038552353 8:28481060-28481082 TCTGATGCCCAGGCCCGGCTCGG - Intronic
1038637017 8:29295705-29295727 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
1039069255 8:33634822-33634844 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
1039494648 8:37971816-37971838 CCTGAGGCCCAGGCTGGGTGCGG + Intergenic
1039559039 8:38497917-38497939 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
1039959001 8:42230581-42230603 TAGCATCCCCAGGCTGGGCGTGG + Intergenic
1041027614 8:53703339-53703361 TTGAATGCCCCTGCTGGGCGGGG - Intergenic
1041379677 8:57241726-57241748 GTTGTTGCCCAGGCTGGTCTCGG + Intergenic
1042258580 8:66832701-66832723 TATGTTGCCCAGGCTGGTCTTGG - Intronic
1042515159 8:69651341-69651363 ATAGATGTCGAGGCTGGGCGCGG - Intronic
1042590191 8:70390560-70390582 TATGTTGCCCAGGCTGGTCTTGG - Intronic
1043436590 8:80241165-80241187 TTTGTTGCCCAGGCTGATCATGG + Intergenic
1043536776 8:81213796-81213818 TCTGTTGCCCAGGCTGGCCTTGG - Intergenic
1043853268 8:85237933-85237955 TGTGTTGCCCAGGCTGGTCTTGG + Intronic
1044558479 8:93589936-93589958 AATGAAGCCCAGGCTGGGCATGG + Intergenic
1044576111 8:93770722-93770744 TTTGATTGCTAGGCTGGACGCGG + Intronic
1044686752 8:94833417-94833439 TATGTTGCCCAGGCTGGTCTCGG + Intronic
1045340678 8:101251713-101251735 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
1046800645 8:118422970-118422992 CGTGTTGCCCAGGCTGGTCGAGG - Intronic
1047236390 8:123045788-123045810 TAAGATGTACAGGCTGGGCGCGG + Intronic
1047286320 8:123490270-123490292 TTTGTTGGCCAGGCTGGTCAAGG + Intergenic
1047650077 8:126911050-126911072 TATGTTGCCCAGGCTGATCGTGG - Intergenic
1048014383 8:130484362-130484384 TATGCTGCCCAGGCTGGTCTTGG + Intergenic
1048452430 8:134545308-134545330 TATGTTGCCCAGGCTGGTCTCGG - Intronic
1049218331 8:141417777-141417799 TTTGTTTCCCGGGCAGGGCGCGG + Intronic
1049629640 8:143646242-143646264 TATGTTGCCCAGGCTGGTCTTGG + Intronic
1049712956 8:144074773-144074795 TATGTTGCCCAGGCTGGTCTCGG + Intergenic
1049736823 8:144212284-144212306 TATGTTGCCCAGGCTGGTCCTGG + Intronic
1049783060 8:144437580-144437602 TGGGGTGCCCAGGCTGGGCGCGG - Intronic
1050706435 9:8404156-8404178 TCTGTTGCCCAGGCTGGGGCTGG + Intronic
1050869666 9:10551130-10551152 TCTGTTGCCCAGGCTGGTCTTGG - Intronic
1051999516 9:23260194-23260216 ATATATGCCCAGGCCGGGCGTGG + Intergenic
1052365458 9:27607362-27607384 ATTAATGGACAGGCTGGGCGCGG - Intergenic
1052713327 9:32084983-32085005 TCTGCTGCCTAGGCTGGGTGTGG + Intergenic
1052763795 9:32619661-32619683 TATGTTGCCCAGGCTGTGCTGGG - Intergenic
1053119196 9:35532953-35532975 TTTGGTGTCGAGGCTGGGTGTGG + Intronic
1053400226 9:37812834-37812856 TTTGTTGTCCAGGCTGGGAATGG + Intronic
1053523974 9:38810186-38810208 TGTGCTGGGCAGGCTGGGCGTGG - Intergenic
1053588615 9:39487052-39487074 CTTGTTGGCCAGGCTGGTCGCGG + Intergenic
1054196207 9:62034594-62034616 TGTGCTGGGCAGGCTGGGCGTGG - Intergenic
1054577689 9:66878242-66878264 CTTGTTGGCCAGGCTGGTCGCGG - Intronic
1054642198 9:67554095-67554117 TGTGCTGGGCAGGCTGGGCGTGG + Intergenic
1055322686 9:75097891-75097913 TCTGTTGCCCAGGCTGAGTGTGG + Intronic
1055436224 9:76294860-76294882 AATGCTGCACAGGCTGGGCGTGG + Intronic
1055470417 9:76605028-76605050 TGTGTTGCCCAGGCTGGTCTTGG + Intergenic
1055484313 9:76742411-76742433 TATGTTGCCCAGGCTGGGTCTGG - Intronic
1055510577 9:76992114-76992136 TTTGACTCCCAGGATGGGGGTGG + Intergenic
1056212053 9:84373810-84373832 AGTGAAGCCCAGGCTGGGTGTGG + Intergenic
1056616552 9:88172429-88172451 ATTCATGCTTAGGCTGGGCGTGG + Intergenic
1057037672 9:91823574-91823596 TTTGTTGCTGAGGCTGGGCACGG - Intronic
1057477657 9:95416948-95416970 CTTGTTGCCCAGGCTGGTCTTGG - Intergenic
1057808879 9:98242149-98242171 ACAAATGCCCAGGCTGGGCGTGG + Intronic
1058226233 9:102368025-102368047 TTTTCTGCCCAGGGTGGGCCAGG - Intergenic
1058719015 9:107746776-107746798 AAGGATACCCAGGCTGGGCGCGG - Intergenic
1059043381 9:110839005-110839027 ATACATGCCCAGGCCGGGCGTGG + Intergenic
1059204733 9:112453681-112453703 TGTGAGGCCAAGGCTGGGCGTGG - Intronic
1059226360 9:112676480-112676502 TATGTTGCCCAGGCTGGTCTGGG - Intergenic
1059259071 9:112958811-112958833 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
1059725468 9:117004320-117004342 TATGTTGCCCAGGCTGGTCTTGG + Intronic
1060139341 9:121194134-121194156 TTTGAAGACCAGGCTGGTCTTGG + Intronic
1060292314 9:122315216-122315238 TATGTTGCCCAGGCTGGTCTTGG + Intronic
1060346611 9:122822352-122822374 TATGTTGCCCAGGCTGGTCTCGG - Intronic
1060386897 9:123239083-123239105 TGGAATGCCTAGGCTGGGCGCGG + Intronic
1060571342 9:124643256-124643278 TATGTTGCCCAGGCTGGTCTTGG - Intronic
1060607173 9:124925677-124925699 TCTGTTGCCCAGGCTGGGAGTGG - Intronic
1060847766 9:126850785-126850807 ATCGCTGTCCAGGCTGGGCGCGG + Intergenic
1060864461 9:126984302-126984324 TGTGTTGCCCAGGCTGGTCTTGG + Intronic
1060951218 9:127604637-127604659 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1061105400 9:128526308-128526330 TTAGACTCCCAGGCTGGGTGCGG - Intronic
1061159696 9:128886173-128886195 TTTGCTCCCCAGGCTGGGAAGGG - Intronic
1061223258 9:129264796-129264818 TTTACTGCCCAGGCTTGGTGGGG + Intergenic
1061523154 9:131134145-131134167 TTTGTTGCCCACGCTGGTCTCGG + Intronic
1061942953 9:133892826-133892848 TTTATTGCCAAGGCTGGGCCAGG - Intronic
1061988286 9:134143121-134143143 TTTGATGGGCGGGCTGGGTGGGG + Intronic
1062330186 9:136038243-136038265 TTTAAACACCAGGCTGGGCGTGG + Intronic
1062360201 9:136184377-136184399 TTTGGTTTCCTGGCTGGGCGCGG + Intergenic
1062431028 9:136526951-136526973 TCCGATGCCCAGGCTGGGAGTGG - Intronic
1062480527 9:136748811-136748833 CCTGCTTCCCAGGCTGGGCGAGG - Intergenic
1062602737 9:137325886-137325908 TCTGTTGCCCAGGCTGGTCTAGG - Intronic
1185746362 X:2576654-2576676 TCTGTTGCCCAGGCTGGATGTGG - Intergenic
1186374498 X:8984645-8984667 TTTGTTTTCCTGGCTGGGCGCGG + Intergenic
1186861311 X:13675117-13675139 TACAATGCCCTGGCTGGGCGTGG + Intronic
1186916339 X:14226151-14226173 TTTGATGCCCAGGCAGGAATAGG + Intergenic
1187007649 X:15248139-15248161 TTTGAGGCCTGGGCTGGGCTGGG - Intronic
1187137818 X:16565298-16565320 TCTGTTGCCCAGGCTGGTCCTGG - Intergenic
1187714048 X:22084194-22084216 TATGCTGCCCAGGCTGGACTTGG + Intronic
1189782511 X:44529878-44529900 TATGTTGCCCAGGCTGGTCTTGG + Intronic
1189979438 X:46494418-46494440 TTTGTTGCCCAGGCTAAGCTGGG + Intronic
1189987891 X:46570302-46570324 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1190099415 X:47509680-47509702 TATGTTGCCCAGGCTGGACTGGG + Intergenic
1190219951 X:48505594-48505616 TATGTTGCCCAGGCTGGTCTCGG - Intergenic
1190235995 X:48616272-48616294 TATGTTGCCCAGGCTGGACTTGG + Intergenic
1190283712 X:48948315-48948337 TCTGTTGCCCAGGCTGGCTGGGG - Intronic
1190814917 X:53921464-53921486 TTTGTTGCCCAGGCTGGAGTGGG + Intergenic
1191857349 X:65637726-65637748 TATGTTGCCCAGGCTGGTCTTGG + Intronic
1191862319 X:65675926-65675948 TAATTTGCCCAGGCTGGGCGTGG - Intronic
1192120103 X:68447457-68447479 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
1192293448 X:69822253-69822275 TTTGTTGCCGAGGCTGGAGGTGG - Intronic
1192327333 X:70143899-70143921 GATGATGAGCAGGCTGGGCGCGG + Intronic
1192329639 X:70164855-70164877 TATGTTGCCCAGGCTGGTCTCGG - Intronic
1192345267 X:70298067-70298089 TATGTTGCCCAGGCTGGTCTCGG - Intronic
1192415427 X:70975548-70975570 TATGTTGCCCAGGCTGGACTAGG + Intergenic
1192420560 X:71026184-71026206 TCTGTTGCCCAGGCTGGCCTTGG - Intergenic
1192506444 X:71687292-71687314 TATGTTGCCCAGGCTGGTCTTGG - Intergenic
1192506589 X:71689138-71689160 TTTGTTGCCCAGGCTGGTCTCGG + Intergenic
1192520108 X:71792408-71792430 TTTGTTGCCCAGGCTGGTCTCGG - Intergenic
1192520253 X:71794255-71794277 TATGTTGCCCAGGCTGGTCTTGG + Intergenic
1196044236 X:111240127-111240149 TATGTTGCCCAGGCTGGTCCTGG + Intergenic
1196840527 X:119855006-119855028 TTACATGTCCAGGCCGGGCGTGG + Intergenic
1197486933 X:127063458-127063480 TTTGGTGCTCAGGCTGAGCTTGG + Intergenic
1197746101 X:129932788-129932810 TCCGAGGGCCAGGCTGGGCGAGG - Intergenic
1198049662 X:132938437-132938459 TATGTTGCCCAGGCTGGTCTTGG - Intronic
1198122434 X:133607467-133607489 TATGTTGCCCAGGCTGGTCTGGG + Intronic
1198470212 X:136939385-136939407 TGTGTTGCCCAGGCTGGTCTTGG + Intergenic
1198855303 X:141009178-141009200 TCGGATACACAGGCTGGGCGTGG - Intergenic
1198907391 X:141578194-141578216 TCGGATACACAGGCTGGGCGTGG + Intergenic
1198917689 X:141691921-141691943 TCGGATACACAGGCTGGGCGTGG + Intronic
1199704606 X:150412924-150412946 TATGTTGCCCAGGCTGGTCTTGG + Intronic
1200107233 X:153721565-153721587 TTAGTTTTCCAGGCTGGGCGCGG - Intronic
1200252482 X:154560963-154560985 TCTGTTGCCCAGGCTGGTCTTGG - Intronic
1200265285 X:154643453-154643475 TCTGTTGCCCAGGCTGGTCTTGG + Intergenic
1200289086 X:154854839-154854861 TATGTAGGCCAGGCTGGGCGCGG + Intronic
1200789854 Y:7289862-7289884 ATTGATTTTCAGGCTGGGCGTGG + Intergenic
1201241060 Y:11956664-11956686 TCTAAAACCCAGGCTGGGCGCGG - Intergenic