ID: 1163793827

View in Genome Browser
Species Human (GRCh38)
Location 19:19324123-19324145
Sequence AGTAAGAGGTTAGGCAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 223}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163793821_1163793827 24 Left 1163793821 19:19324076-19324098 CCCACGTAAGCCTAGGTTTTCAT 0: 1
1: 0
2: 0
3: 8
4: 80
Right 1163793827 19:19324123-19324145 AGTAAGAGGTTAGGCAGTGATGG 0: 1
1: 0
2: 0
3: 22
4: 223
1163793824_1163793827 14 Left 1163793824 19:19324086-19324108 CCTAGGTTTTCATGAGGAAGACA 0: 1
1: 0
2: 7
3: 85
4: 391
Right 1163793827 19:19324123-19324145 AGTAAGAGGTTAGGCAGTGATGG 0: 1
1: 0
2: 0
3: 22
4: 223
1163793822_1163793827 23 Left 1163793822 19:19324077-19324099 CCACGTAAGCCTAGGTTTTCATG 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1163793827 19:19324123-19324145 AGTAAGAGGTTAGGCAGTGATGG 0: 1
1: 0
2: 0
3: 22
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163793827 Original CRISPR AGTAAGAGGTTAGGCAGTGA TGG Intronic
900315125 1:2052486-2052508 AGGAAGAGGTGTGGCAGGGAAGG - Intronic
900335463 1:2160885-2160907 AGAAAGAGGTGAGGGTGTGACGG + Intronic
902721812 1:18309060-18309082 AGTATGGGGGTATGCAGTGAGGG - Intronic
903591271 1:24457636-24457658 AGTAAGAGGCTAGAAAGTGGCGG + Intronic
904402642 1:30266972-30266994 AGCAAGAGGTGAGGCCGGGAAGG + Intergenic
904883509 1:33718251-33718273 GGTAAGAGATCAGGTAGTGAGGG + Intronic
906088223 1:43154751-43154773 ACTATGAGGTTTTGCAGTGAGGG + Intronic
906777073 1:48539434-48539456 ATTAAGGGGTCAGACAGTGAGGG - Intronic
907702605 1:56803901-56803923 AGAAAGAGGTTAAGCTTTGAAGG - Intronic
907894936 1:58679192-58679214 AGTGAGTGGTTAGGCACTGGAGG - Intronic
909626623 1:77724108-77724130 GGGAAGAGGTTAGAAAGTGAGGG + Intronic
910375660 1:86566883-86566905 AGTGAGAGGTTAGGAACAGAAGG + Intronic
911658183 1:100468319-100468341 AGAAAAAGGGTAGGCAGAGATGG - Intronic
912714108 1:111969944-111969966 GGTAAGAGGAGAGACAGTGAAGG - Intronic
915833492 1:159153515-159153537 AAGAAGAGGTTAGGGAGGGATGG + Intergenic
916699610 1:167277835-167277857 AGTAAGAATTTGGGAAGTGAGGG - Intronic
918082000 1:181214857-181214879 AGGAAGAGAATAGGGAGTGATGG - Intergenic
924214482 1:241806604-241806626 AGCCAGAAGTTAGGGAGTGAGGG + Intergenic
924534416 1:244922119-244922141 TGTCAGAGGTAAGGCTGTGAAGG + Intergenic
1062809703 10:453580-453602 AGGGAGAGGCTAGGAAGTGACGG + Intronic
1063150901 10:3335357-3335379 AGGAAGAGGTTGGGAAGTCAGGG + Intergenic
1063932615 10:11044143-11044165 GGTAAGAGGATAGAAAGTGATGG - Intronic
1064536195 10:16360183-16360205 AGAAACTGGTCAGGCAGTGAGGG + Intergenic
1064597097 10:16956505-16956527 AGTAAGAGGTTTTGTAGTGATGG - Intronic
1066323757 10:34332284-34332306 AGTATCAGGTCAGGCAGTGATGG - Intronic
1067850078 10:49749224-49749246 AGAAAGAGGCTAGGCAGTATGGG + Intronic
1069572926 10:69505285-69505307 TGTAAGTGCTTAGGCAGTGGGGG + Intronic
1071302601 10:84267595-84267617 AGTCAGAGGCTGGGAAGTGATGG - Intergenic
1075330396 10:121569984-121570006 AGTAAGAAGAGAGGCAGGGATGG + Intronic
1075967527 10:126625592-126625614 AGCAAGAGGAGAGGCAGTGCAGG + Intronic
1077649278 11:3955221-3955243 AGAATGAGGGTTGGCAGTGAAGG + Intronic
1078653225 11:13215156-13215178 AGAAGGAGGTCAGGCAGTGCGGG + Intergenic
1079011696 11:16833779-16833801 AGTAAGTGCTCAGTCAGTGATGG - Intronic
1079884715 11:25972788-25972810 AATACGAGTTTAGGCAATGATGG - Intergenic
1087883596 11:103449221-103449243 AGTCAGAAGTTAGGTAGTGAGGG + Intronic
1088488812 11:110367035-110367057 AGGGAGAGGTTTGGGAGTGAAGG - Intergenic
1088830339 11:113531440-113531462 ATAAAGTAGTTAGGCAGTGATGG + Intergenic
1089649026 11:119900168-119900190 AGTCAGAGGCTAGGCTGAGATGG + Intergenic
1091152381 11:133340990-133341012 AGAAGGGGGATAGGCAGTGATGG - Intronic
1091532617 12:1374297-1374319 AGAAAGAGGTGAAGCAATGAGGG + Intronic
1093725841 12:22507295-22507317 AGTGAGAGGATAAGCAGTGTGGG + Intronic
1094076788 12:26485181-26485203 AGTAAAAGGGTAAGCAGGGAAGG + Intronic
1094749766 12:33392441-33392463 AGGAAGAGGAAAGGCAGGGAGGG - Intronic
1095345055 12:41140389-41140411 AATAAGAGGTAAGGCAGAGAGGG + Intergenic
1096479007 12:51925688-51925710 AGTAGGAGGTCAGTCAGTGCTGG + Intergenic
1096692495 12:53329563-53329585 TAAAAGAGGTTAGCCAGTGAGGG + Intronic
1097907747 12:64937987-64938009 AATAAGAGGTTATGCTGTGATGG + Intergenic
1099061499 12:77916000-77916022 TGTAATGGGTTAGACAGTGATGG + Intronic
1099425671 12:82519985-82520007 AATGAGAGGTTAAGTAGTGATGG + Intergenic
1101901310 12:108792893-108792915 AGTATGCGGTGAGCCAGTGAGGG + Intronic
1102037035 12:109776601-109776623 AATAAGAGGGAGGGCAGTGATGG - Intergenic
1102967734 12:117141197-117141219 ATTAAGAGGTGAAGCAGGGACGG - Intergenic
1103236597 12:119378141-119378163 AGTAAGAGATTAGGGTGGGATGG - Intronic
1103239949 12:119404692-119404714 TGTCAGAGGTTAGGCAGATAGGG + Intronic
1103492412 12:121332472-121332494 GATAAGAGGTTAGAAAGTGAAGG - Intronic
1105544181 13:21339821-21339843 GGTTAGAGGACAGGCAGTGAGGG - Intergenic
1105644154 13:22298885-22298907 AGTCAGAGGTTAGTCAGAGAGGG - Intergenic
1105679053 13:22706664-22706686 ACTGAGAAGTTAGGCAGGGATGG + Intergenic
1105957369 13:25296710-25296732 AGTATGAGCTTAGGTCGTGATGG - Intergenic
1107578988 13:41761780-41761802 AGTAAGTGGTAAGGAAATGAGGG - Intronic
1113046978 13:106167213-106167235 AGAAAGAGGTGAGGCAGGGGAGG - Intergenic
1115467035 14:33726586-33726608 AGTAAGAGACTAGAGAGTGATGG - Intronic
1115971690 14:38952001-38952023 TGTAAGACGTTAGGCAGTGGTGG - Intergenic
1121899568 14:97681109-97681131 AGTAAGAGGTGGAGCAGAGATGG - Intergenic
1122021586 14:98842183-98842205 AGTAAGAGGCTAGTCCCTGAAGG + Intergenic
1122707979 14:103633395-103633417 AGAAAGAGCATAGGCAGTGGTGG + Intronic
1123481402 15:20635442-20635464 AGCAAGAAGTGAGGCAGTGTGGG + Intergenic
1123636610 15:22364923-22364945 AGCAAGAAGTGAGGCAGTGTGGG - Intergenic
1124398517 15:29328257-29328279 AGTAAGAGTTCAGGGAGAGAGGG + Intronic
1124665748 15:31590979-31591001 AGTAAGAGGTAAGACAGACATGG + Intronic
1125457916 15:39879565-39879587 AGTAAGAGGTTAGAGAGGAAAGG - Intronic
1126465546 15:48958320-48958342 AGTGAGAGGTTGGGAAGTGGAGG + Intronic
1127904277 15:63364795-63364817 TGGAAGAGGTTGGGCAGTGGAGG - Intronic
1128676904 15:69616324-69616346 AGTAGGAGGTTCTGCAATGATGG - Intergenic
1129955760 15:79635415-79635437 GAGCAGAGGTTAGGCAGTGAGGG - Intergenic
1131150622 15:90045364-90045386 ATGGAGAGGTTAGACAGTGACGG + Intronic
1134644024 16:15852057-15852079 AGGCGGAGCTTAGGCAGTGATGG - Intronic
1135013358 16:18903769-18903791 AGGAAGATGACAGGCAGTGATGG - Intronic
1135320288 16:21491365-21491387 AGGAAGATGACAGGCAGTGATGG - Intergenic
1135373123 16:21922855-21922877 AGGAAGATGACAGGCAGTGATGG - Intergenic
1135438666 16:22447847-22447869 AGGAAGATGACAGGCAGTGATGG + Intergenic
1136383354 16:29907328-29907350 ACCAAGAGGCTAGGCAGGGAAGG - Intronic
1137944324 16:52719167-52719189 AGTAAGAGGGTGAGCAGTGAAGG - Intergenic
1138842075 16:60522420-60522442 AGGAAGAGGACAGACAGTGAAGG + Intergenic
1139751843 16:69113693-69113715 AGAAAGGGGTTGGGCAGTGAGGG - Intronic
1140705971 16:77630152-77630174 AGTCAGAGGATAGACAATGATGG + Intergenic
1141576324 16:84966399-84966421 AGTAAGAGGTCAGGAAGGGCTGG + Intergenic
1142154876 16:88528353-88528375 AGTGAGAGGTAAGGCAGGGAAGG + Intronic
1143900720 17:10172767-10172789 AATAAGAAGGTAGGCAGTGAGGG - Intronic
1145934244 17:28705693-28705715 TGTCAGAGGTGAGGCAGTGGTGG - Intronic
1146228996 17:31092375-31092397 AATGAGAGGTTTGGCACTGAGGG + Intergenic
1146374687 17:32286079-32286101 ATTCATAGGATAGGCAGTGAGGG + Intronic
1146667558 17:34715225-34715247 AGTGGGAGCTTAGGCAGTGCTGG - Intergenic
1146708350 17:35018856-35018878 AGGAACAGGTTAGGCTCTGAAGG - Intronic
1147246510 17:39124627-39124649 AGAAAGAGCTTAGGCTCTGAAGG + Intronic
1147894127 17:43739432-43739454 AGGAAGAGGTCAGGGAGTGAAGG + Intergenic
1150851385 17:68707046-68707068 GGTAATAGGTTAGGCAGGGGAGG + Intergenic
1155275965 18:24187798-24187820 CTTAAAAGGTGAGGCAGTGAGGG + Intronic
1156910175 18:42402909-42402931 AGTAGGATGTGAGGAAGTGAAGG + Intergenic
1159972747 18:74674168-74674190 ATTAAGTGGTGAGGGAGTGAAGG - Intronic
1162053643 19:8050305-8050327 AGTGAGGGGTGAGGCAGGGAGGG + Intronic
1163264370 19:16209573-16209595 GGTATGAGGTTAGAAAGTGAAGG + Intronic
1163793827 19:19324123-19324145 AGTAAGAGGTTAGGCAGTGATGG + Intronic
1166304422 19:41929529-41929551 AATAGGAGGGTAGACAGTGAGGG - Intronic
1166874177 19:45887049-45887071 AGTAAGGGGTTAAGAAGTGACGG + Intergenic
1167489122 19:49781724-49781746 AGGAGGAGGGTAGGCAGTGAGGG - Intronic
1168028472 19:53661177-53661199 ATGAAGAGTTTAGGGAGTGAAGG + Intergenic
1168501044 19:56893700-56893722 AATAAGAATTTAGTCAGTGAAGG + Intergenic
925171393 2:1752169-1752191 ACTGAGAGGTGAGGCAGTTAGGG + Intergenic
925720526 2:6822233-6822255 AGCACGAGGCCAGGCAGTGATGG - Intergenic
928187007 2:29119673-29119695 AGTCAGAGGTGAGGCTGTAAGGG - Intronic
929362213 2:41105668-41105690 ATTAGGAGATGAGGCAGTGATGG - Intergenic
929483073 2:42330268-42330290 GGTAACAGGATGGGCAGTGATGG + Exonic
929600929 2:43204119-43204141 AGGAAGAGGACAGGCAGTGGGGG + Intergenic
930812057 2:55552933-55552955 AGAAAGAAGCTAGGCAGTAAAGG + Intronic
931060093 2:58518201-58518223 AGAAAGAGCATAGGCTGTGATGG + Intergenic
932370611 2:71184413-71184435 AGTAGGGGGTTGGCCAGTGAGGG + Exonic
932390887 2:71389882-71389904 AGTCAGAGGAAAGGCAGTTACGG + Intronic
934164588 2:89282588-89282610 AATAAGATGTCAGGGAGTGAGGG - Intergenic
934202686 2:89899936-89899958 AATAAGATGTCAGGGAGTGAGGG + Intergenic
934915170 2:98295616-98295638 AGAAAGAGGGGAGGCAGTGGAGG + Intronic
935157143 2:100493519-100493541 AGTGAGAGGATAGGGAGAGAAGG + Intergenic
937857431 2:126682644-126682666 AGTCAGAGGTTACACAGTGGGGG + Intronic
938419088 2:131129469-131129491 AGTAAGGGGTAAAGGAGTGAGGG + Intronic
939238750 2:139532125-139532147 AGTAAGAGGTTAGGAAGATCAGG + Intergenic
942291550 2:174476783-174476805 ATTAAGAAGTTAGGGGGTGACGG - Intronic
943608893 2:190008857-190008879 AGTTAGAGGTTAGGAAGTAGGGG + Intronic
946800398 2:223409441-223409463 AGAAGGAGGTAAGTCAGTGATGG - Intergenic
1168875488 20:1169257-1169279 GGTAGGATGGTAGGCAGTGAGGG + Intronic
1170029071 20:11925274-11925296 AGTAAGAGGTGGGACAGTAATGG + Exonic
1170085211 20:12524114-12524136 TTTAAGAGGTTAGGCCATGAGGG + Intergenic
1170560523 20:17553628-17553650 AGAAAGAGGATAGACAGTGGAGG + Intronic
1170921463 20:20683473-20683495 GGTTAGAGGATAGGGAGTGAAGG - Intronic
1173337610 20:42125501-42125523 TGTAATAGGTTAGGCAGACAGGG - Intronic
1174150520 20:48483129-48483151 AGAAAGAGGGTATGCAGCGAGGG + Intergenic
1174366899 20:50061895-50061917 AGTAAGTGGCAAGGCAGGGATGG - Intergenic
1174367571 20:50065674-50065696 TGGAAGAGGTCAGGCAGTGCTGG - Intergenic
1177031932 21:15991157-15991179 AGAAAGAGGTATGGCAGTGAAGG - Intergenic
1179257292 21:39727799-39727821 AATTAGAGGTTAGGCTGAGAGGG - Intergenic
1181452525 22:23033498-23033520 AGCAAGAGGGCAGGCAGTAATGG + Intergenic
1181480615 22:23196786-23196808 AGGTAGAGCTTAGGCAGTAATGG + Intronic
1181900755 22:26153746-26153768 AGCAAGAGGTGAGGAAGAGAAGG - Intergenic
1182311416 22:29411225-29411247 AGTAAGGGGGTTGGGAGTGATGG + Intronic
1182397737 22:30048473-30048495 ACTAAGAGGTCAGGCAGGGTGGG - Intergenic
1183056356 22:35308728-35308750 GGTAAGAAGTGAGGCTGTGAAGG - Intronic
1183092891 22:35535505-35535527 AGCAAGAGTTCAGACAGTGAGGG + Intergenic
1184320503 22:43739050-43739072 AGGAAGAGGTGAGGCAAGGAGGG - Intronic
951261764 3:20518152-20518174 AGAAAGAGGTAAGGCCGGGAAGG - Intergenic
951693933 3:25426639-25426661 GGCAAGTGGTTAGGCAGGGAGGG - Intronic
952138960 3:30457247-30457269 AGTAAGAGAATACACAGTGATGG + Intergenic
952247687 3:31613070-31613092 AGTAAGAGCTTAGTGAGTGTAGG + Intronic
953517739 3:43612704-43612726 AGAAAGATGTTATGCAGTGTTGG - Intronic
954187500 3:48929447-48929469 AGTAAGAGATGAGGCGGCGAAGG - Intronic
955922323 3:63970549-63970571 AGCAACAAGTTAGGCAGGGAAGG + Intronic
960958448 3:123051893-123051915 AGTAAGAGGTTTCCCAGGGAAGG + Intergenic
960998429 3:123354558-123354580 AGGAAGAGATGAGGAAGTGAAGG + Intronic
961135946 3:124511440-124511462 AGCAAGAGGATAGAGAGTGAAGG - Intronic
962939873 3:140116069-140116091 AGAAAGAGGTTAGTCTGGGAGGG - Intronic
964661383 3:159123965-159123987 AGGTTGAGGTTAGGCAGTGATGG - Intronic
966298321 3:178449898-178449920 AGTAAGTGGTGAGGCCCTGATGG + Intronic
969128319 4:4971207-4971229 AGTAAGAGGTGAGACAGTTAGGG + Intergenic
970218758 4:13785882-13785904 AGTGAAAAGTTAGACAGTGACGG - Intergenic
971355564 4:25891854-25891876 AGTCAGAGGTTGGTCAGTGGGGG - Intronic
972906295 4:43752033-43752055 AGTAATAGGTTAGGCATGGATGG - Intergenic
973710437 4:53624620-53624642 GGTGGGAGGGTAGGCAGTGAGGG - Intronic
975633652 4:76424450-76424472 GGTAGGAGGTTAGGGAGTGTGGG + Intergenic
975767890 4:77688247-77688269 TGGAGGAGTTTAGGCAGTGAAGG + Intergenic
976607908 4:86999817-86999839 TGTAAGAAGCTTGGCAGTGATGG + Intronic
977427251 4:96883016-96883038 AGGAAGTGATTAGGCCGTGAGGG + Intergenic
979708692 4:123751324-123751346 AGAAAAAGGTTAGACAGTGAAGG + Intergenic
980344041 4:131588838-131588860 AGTAAAAGGTTATGGAGAGATGG - Intergenic
980679323 4:136136802-136136824 AGTTAGAGTGCAGGCAGTGATGG - Intergenic
981287686 4:143038899-143038921 AGGAAGAGGTTATGCAGAGCAGG + Intergenic
981918241 4:150058287-150058309 AGAAGCAGGTTAGGCAGTGAGGG + Intergenic
984529180 4:180895155-180895177 TTTAGGAGGTTAGGCTGTGAGGG - Intergenic
988449458 5:31326367-31326389 AGTAAGTGGCCAGGAAGTGAAGG - Exonic
989098073 5:37799510-37799532 GGTAACAGGATAGGGAGTGATGG + Intergenic
989424046 5:41275126-41275148 AGTAAGAGGGGAGGAATTGAAGG - Intergenic
990176697 5:53115870-53115892 AATAAGAACTGAGGCAGTGAAGG + Intergenic
992640820 5:78767087-78767109 AGTAAGACCCTTGGCAGTGAGGG + Intronic
993167136 5:84371871-84371893 AATAAGAAGATAGGAAGTGATGG - Intronic
994192450 5:96883279-96883301 AGAAACAGGTAAGGGAGTGAGGG - Intronic
994445776 5:99871386-99871408 ATTAAGAGGTTAGGCTGTTTGGG - Intergenic
994742178 5:103633969-103633991 GGTAAGAGGATGAGCAGTGAGGG - Intergenic
995626251 5:114079705-114079727 AGTAAGTGTTTAGGAAGTGGAGG + Intergenic
997125617 5:131224074-131224096 ACTGAGAGGTTAGACAGTAAAGG - Intergenic
998610366 5:143681955-143681977 AGGAAGAGGTTGGGGAGGGAGGG + Intergenic
1000534759 5:162466237-162466259 AGTAACTGATTAAGCAGTGATGG - Intergenic
1001095025 5:168769359-168769381 TGTCAGAGGTCAGGCAGGGAGGG - Intronic
1001377629 5:171277834-171277856 AGAAACAGGATTGGCAGTGATGG + Intronic
1002063020 5:176637623-176637645 TGAGAGAGGTTAGGAAGTGAGGG + Intronic
1002211548 5:177602347-177602369 AGAAAGGGGTAAGGCAGTCAGGG - Intronic
1003407898 6:5838563-5838585 GGTTAGAGGACAGGCAGTGAGGG + Intergenic
1005148144 6:22716229-22716251 AAAAAGAGGTTAGGAAGTTATGG - Intergenic
1006730129 6:36230388-36230410 AGTAAGAGGCTGGGCAGTAGTGG - Intronic
1007179512 6:39919130-39919152 AGTAAGGGGATAATCAGTGATGG - Intronic
1007598186 6:43064832-43064854 CGGAATAGGTTAGACAGTGAGGG + Intronic
1008461436 6:51778560-51778582 AGTATGATGGTGGGCAGTGAAGG + Intronic
1012328157 6:97949929-97949951 AGTCAGAGGTAAGTCTGTGAAGG - Intergenic
1013418925 6:109948934-109948956 AGGAACAGGTGAGGCAGGGAAGG + Intergenic
1013648647 6:112170980-112171002 AGTAAGAGGTGAGGCTGAGGAGG + Intronic
1014175280 6:118325379-118325401 GCTGAGAGGTCAGGCAGTGAGGG - Intergenic
1015228645 6:130887559-130887581 AGTCAGAGCTTAGGAAGTGGCGG - Intronic
1015326381 6:131928592-131928614 AGTAAGAATTTTGGCAGTGCCGG + Intergenic
1015335801 6:132036660-132036682 AATAACAAGTTAGCCAGTGATGG - Intergenic
1015926204 6:138312486-138312508 AGTAAGAGGGAAGGATGTGAGGG - Intronic
1018367923 6:163140260-163140282 AGAAACAGAGTAGGCAGTGAGGG + Intronic
1020899836 7:13990648-13990670 ACTAGGACGTTAAGCAGTGAGGG + Intronic
1023425844 7:40035448-40035470 AGGAAGAGCTCAGGCAGTTATGG - Intronic
1023664354 7:42506278-42506300 AGTAAGTGGTTAGAAAGAGAAGG + Intergenic
1025943251 7:66088718-66088740 AGGAGGAGGTTAGGCGGTGGGGG - Intronic
1026047787 7:66919584-66919606 AATAAGAGGGTATTCAGTGAAGG + Intergenic
1027683108 7:81245185-81245207 AGTTAGGGGTTTGGGAGTGAGGG + Intergenic
1030366185 7:108649315-108649337 AGTAAGAGCATAGGCAAGGAAGG - Intergenic
1030392562 7:108945462-108945484 AGGAAGGGTTTAGGGAGTGAGGG - Intergenic
1031228585 7:119074671-119074693 AGGCAGAGCTTAGGCAGTAATGG - Intergenic
1033572104 7:142640551-142640573 ATTAAGAGGTGCGGCAGTGTGGG - Intergenic
1034307954 7:150061209-150061231 AGAAAGAGGCTATGCTGTGATGG + Intergenic
1034798899 7:154039460-154039482 AGAAAGAGGCTATGCTGTGATGG - Intronic
1035318352 7:158012248-158012270 GGTAAAAGGTTAGGGAATGAAGG + Intronic
1036390123 8:8318102-8318124 AGGAAAGGGTTAGGCAGGGAAGG + Exonic
1036752917 8:11454680-11454702 AGTAAGAGGTTAGGAGGTCTGGG + Intronic
1041280520 8:56206662-56206684 AGTAAGTGTTTAGGTAGTCATGG - Intronic
1041594664 8:59634083-59634105 AGTAAGAGTTTAGGCACTTCAGG + Intergenic
1045131684 8:99161655-99161677 AGTAAGGTGTTAGGCAGAGTGGG + Intronic
1046679583 8:117153667-117153689 AGTAAGCAGTTATTCAGTGAAGG - Intronic
1050568675 9:6914663-6914685 AGTAAATGATTAGGCATTGAGGG + Intronic
1050992572 9:12172146-12172168 AGTAACAGGCTAGGAAGGGATGG - Intergenic
1055571137 9:77617944-77617966 AGTAAGAGATTAGAGAGTGGAGG - Intronic
1056854710 9:90116245-90116267 AGTCAGAGGCTGGGTAGTGAGGG - Intergenic
1057998783 9:99844545-99844567 AGTAAGAATTTAGGCATTGATGG + Intronic
1059491854 9:114674480-114674502 AGGAAGAGATTAGGAAGTGCTGG - Intergenic
1061366721 9:130175792-130175814 AGCAACAGGTTAGGGAGAGATGG + Intronic
1186285195 X:8035980-8036002 AATAAGAGCTTGGGTAGTGAGGG - Intergenic
1187369372 X:18691918-18691940 AGTAAGAGGCCAAGGAGTGAGGG - Intronic
1189630797 X:42951241-42951263 AGTAAGGGCTTTGGCAGTGTGGG - Intergenic
1190471250 X:50781761-50781783 AGGATGAGGTGAGGGAGTGAGGG - Intronic
1190536826 X:51437311-51437333 AGTGAGAGGAGAGGCAGTGAAGG + Intergenic
1192545670 X:72010922-72010944 AGTAGGAGGTTAGGGTGGGAGGG - Intergenic
1193588710 X:83360858-83360880 ACCAAGAGGTTGGGCAGTGGTGG + Intergenic
1195767923 X:108316439-108316461 GGTAAGAGGGTAGGAAGTGTTGG + Intronic
1198798622 X:140426607-140426629 AGAAAGAGGATAGGCAGTTGAGG + Intergenic
1201427298 Y:13866530-13866552 AGTTAGAGGTTCAGCATTGAAGG + Intergenic
1201783181 Y:17745126-17745148 AGTAAGATGTTTGGCACTGGCGG - Intergenic
1201818372 Y:18160861-18160883 AGTAAGATGTTTGGCACTGGCGG + Intergenic
1202060679 Y:20884672-20884694 ACTAAAAGGTTAGAGAGTGAGGG + Intergenic