ID: 1163794773

View in Genome Browser
Species Human (GRCh38)
Location 19:19331070-19331092
Sequence GAACCCTAAGGTGACCCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 91}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163794762_1163794773 26 Left 1163794762 19:19331021-19331043 CCACTTGAAACCTGTTGGCCCTG 0: 1
1: 0
2: 3
3: 15
4: 130
Right 1163794773 19:19331070-19331092 GAACCCTAAGGTGACCCCAGGGG 0: 1
1: 0
2: 1
3: 14
4: 91
1163794760_1163794773 28 Left 1163794760 19:19331019-19331041 CCCCACTTGAAACCTGTTGGCCC 0: 1
1: 0
2: 0
3: 12
4: 97
Right 1163794773 19:19331070-19331092 GAACCCTAAGGTGACCCCAGGGG 0: 1
1: 0
2: 1
3: 14
4: 91
1163794765_1163794773 7 Left 1163794765 19:19331040-19331062 CCTGTTGCAACCCTCTCTTGCTT 0: 1
1: 0
2: 0
3: 19
4: 151
Right 1163794773 19:19331070-19331092 GAACCCTAAGGTGACCCCAGGGG 0: 1
1: 0
2: 1
3: 14
4: 91
1163794764_1163794773 8 Left 1163794764 19:19331039-19331061 CCCTGTTGCAACCCTCTCTTGCT 0: 1
1: 0
2: 0
3: 17
4: 208
Right 1163794773 19:19331070-19331092 GAACCCTAAGGTGACCCCAGGGG 0: 1
1: 0
2: 1
3: 14
4: 91
1163794761_1163794773 27 Left 1163794761 19:19331020-19331042 CCCACTTGAAACCTGTTGGCCCT 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1163794773 19:19331070-19331092 GAACCCTAAGGTGACCCCAGGGG 0: 1
1: 0
2: 1
3: 14
4: 91
1163794766_1163794773 -3 Left 1163794766 19:19331050-19331072 CCCTCTCTTGCTTTCCCTGAGAA 0: 1
1: 0
2: 6
3: 41
4: 448
Right 1163794773 19:19331070-19331092 GAACCCTAAGGTGACCCCAGGGG 0: 1
1: 0
2: 1
3: 14
4: 91
1163794763_1163794773 16 Left 1163794763 19:19331031-19331053 CCTGTTGGCCCTGTTGCAACCCT 0: 1
1: 0
2: 0
3: 2
4: 101
Right 1163794773 19:19331070-19331092 GAACCCTAAGGTGACCCCAGGGG 0: 1
1: 0
2: 1
3: 14
4: 91
1163794767_1163794773 -4 Left 1163794767 19:19331051-19331073 CCTCTCTTGCTTTCCCTGAGAAC 0: 1
1: 0
2: 3
3: 23
4: 291
Right 1163794773 19:19331070-19331092 GAACCCTAAGGTGACCCCAGGGG 0: 1
1: 0
2: 1
3: 14
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163794773 Original CRISPR GAACCCTAAGGTGACCCCAG GGG Intronic
901488317 1:9581117-9581139 GAGCACTAAGCTGACCCCAGAGG + Intronic
901514979 1:9739092-9739114 GAACCCTCAGGTTACCCCAGAGG - Intronic
901931089 1:12596338-12596360 AAACCCGAAGCTGACCCCGGAGG - Intronic
902209675 1:14895502-14895524 GACCCCTGATGTGATCCCAGGGG - Intronic
907508300 1:54938519-54938541 CAACCCAAGGGTGACCCCTGGGG - Intergenic
915599663 1:156914213-156914235 GAGCCCGAAGCTGACCCCAAAGG - Intronic
918135848 1:181673428-181673450 GAACCCAGAGGTGGCCCGAGGGG + Intronic
919746025 1:201009605-201009627 GGAAGCTTAGGTGACCCCAGAGG + Intronic
920180687 1:204130199-204130221 GACCCCACAGGTGACCCCAGGGG + Intergenic
920358191 1:205391693-205391715 ACACCCCAAGGTGTCCCCAGTGG + Intronic
1063220343 10:3961550-3961572 GACTCCAAAGGAGACCCCAGAGG + Intergenic
1063649940 10:7925071-7925093 CAACCCTTAGGAGACCACAGAGG + Intronic
1069927747 10:71862845-71862867 TAAGACTAAGCTGACCCCAGGGG - Intergenic
1070617767 10:77982120-77982142 TAACCCTAAGGCGACCCCGTGGG + Intronic
1075555020 10:123424350-123424372 GATCCCTGAGGTGATCCCTGAGG + Intergenic
1075689837 10:124387427-124387449 CAAGCCTCAGGTGATCCCAGAGG + Intergenic
1077056768 11:597725-597747 GCACCCCAGGGTGACCCCAGCGG + Intronic
1077224297 11:1433370-1433392 GCACCCTCAGGAGACCCCAAAGG - Intronic
1079093023 11:17494007-17494029 GAACCCTAATAAGACCCCACTGG - Intronic
1081667483 11:44925047-44925069 GAGCCCTAAGGGCAACCCAGGGG - Intronic
1083282896 11:61638421-61638443 GATCTCTAACCTGACCCCAGGGG + Intergenic
1089257573 11:117201915-117201937 GCACCCTAGGGTGACATCAGTGG + Exonic
1089422864 11:118344578-118344600 GAACTCTAAGGTGACAGCAGAGG - Intronic
1090405697 11:126474765-126474787 GAATCAAAGGGTGACCCCAGTGG - Intronic
1090839195 11:130474210-130474232 GCACCCTCAGGTGGCCCCATGGG + Exonic
1100599929 12:96104438-96104460 AAACCCTAAGGTGACCACTATGG - Intergenic
1101844055 12:108347322-108347344 GAAGCCTGGGATGACCCCAGGGG - Intergenic
1102480837 12:113221940-113221962 GCGCCCTTAGGTGACCCCACAGG + Intronic
1103972133 12:124678909-124678931 GGACCCCCAGATGACCCCAGGGG - Intergenic
1104583501 12:130029007-130029029 GGACCCTCAGTGGACCCCAGGGG + Intergenic
1104684335 12:130774861-130774883 GAACCATGAGGACACCCCAGGGG - Intergenic
1109886646 13:68553514-68553536 GAACCCAAATGCGACCCCATTGG - Intergenic
1110139798 13:72114492-72114514 GAACTCTAAGATGATGCCAGTGG - Intergenic
1113066902 13:106381974-106381996 GAACCCTTGAGTGACACCAGAGG + Intergenic
1113385615 13:109845071-109845093 GAACCCCCAGGTGAGCACAGAGG + Intergenic
1113700487 13:112382498-112382520 GAACCCCAAGGTGAGAACAGTGG + Intronic
1113834050 13:113317205-113317227 GGACCCTCAGGTCTCCCCAGAGG + Intronic
1114821166 14:26020782-26020804 CAACCCTGAGGTGACAGCAGCGG + Intergenic
1115201785 14:30861657-30861679 AAACTCCAAGGTGCCCCCAGGGG - Intergenic
1116324266 14:43511653-43511675 GAAAGCTGAGGTGACCCCAAAGG - Intergenic
1122246710 14:100408178-100408200 AAACCCTAAGGAGACCTCATCGG + Intronic
1123204635 14:106700643-106700665 GAACCCAAAGACGACCCGAGGGG - Intergenic
1123209638 14:106747083-106747105 GAACCCAAAGAGGACCCGAGGGG - Intergenic
1124882866 15:33658525-33658547 ATACCCTAAGGTGACCCCAATGG - Intronic
1130203259 15:81852700-81852722 GGGCCCAAATGTGACCCCAGTGG + Intergenic
1133095716 16:3443738-3443760 GAGTCTTAGGGTGACCCCAGGGG + Exonic
1135398475 16:22148978-22149000 TGACCCGAAGGGGACCCCAGGGG + Intronic
1138203765 16:55109179-55109201 TAACCCTAAGGTTATCACAGAGG + Intergenic
1147382809 17:40065650-40065672 CAACCTCAAGCTGACCCCAGAGG - Intronic
1156483833 18:37452402-37452424 GAACCCCAAGGTGGACCCAGAGG + Intronic
1156510823 18:37635035-37635057 GGACTGGAAGGTGACCCCAGGGG + Intergenic
1157598570 18:48878685-48878707 GAACCCTGAGGTGGACGCAGAGG + Intergenic
1160511629 18:79456388-79456410 GAACCTGAAGGTGAGCCCGGAGG - Intronic
1163739903 19:19005090-19005112 GAACCGTAAGGTGCCCCCCGAGG + Intronic
1163794773 19:19331070-19331092 GAACCCTAAGGTGACCCCAGGGG + Intronic
1165363280 19:35349946-35349968 GGAGGCTCAGGTGACCCCAGTGG + Intergenic
1167220598 19:48196100-48196122 GAGACCAAAGGGGACCCCAGTGG + Intronic
1168125518 19:54280376-54280398 GGTCCCTAAGGAGACCCCAGGGG - Intronic
1168168961 19:54573977-54573999 GGTCCCTAAGGAGACCCCAGGGG + Intronic
1168171734 19:54594343-54594365 AGTCCCTAAGGAGACCCCAGGGG + Intronic
1168176453 19:54631172-54631194 TGTCCCTAAGGAGACCCCAGGGG + Intronic
926569522 2:14514188-14514210 GCACACTGAGGTGACCCCAGAGG + Intergenic
926593109 2:14760374-14760396 GGAGCCTGAGGCGACCCCAGGGG + Intergenic
930369607 2:50486595-50486617 GAACTCTAAGGGGAAGCCAGTGG + Intronic
931701456 2:64912664-64912686 GAACCCTAAAATGATCCCAATGG + Intergenic
934558173 2:95298379-95298401 GCACCTTAAGGTAACCTCAGGGG - Intronic
934981760 2:98849071-98849093 GAGCCCTGAGCTGTCCCCAGTGG + Intronic
936500894 2:113065450-113065472 TAACCTTAAGGTCATCCCAGGGG - Intergenic
946832490 2:223740766-223740788 GAGCCCGAAGGTGCCCCCATGGG - Intergenic
948862600 2:240760180-240760202 GATCCCTTAGCTGAGCCCAGTGG - Intronic
1173144436 20:40512462-40512484 GAACCATATGATGAACCCAGAGG + Intergenic
1173664165 20:44753331-44753353 GAACACACAGGTGACTCCAGGGG + Intronic
1175189547 20:57202121-57202143 GAGCCCCAAGGTGACACCACAGG - Intronic
1175500366 20:59445838-59445860 GAACCCTAAGGCGAACTCAGTGG - Intergenic
1181636653 22:24177808-24177830 GAAGCTGAAGGTGACCTCAGGGG + Exonic
1184418305 22:44364618-44364640 AAACCCCAAGATGTCCCCAGGGG - Intergenic
1185157819 22:49204937-49204959 GGGCCCCCAGGTGACCCCAGCGG + Intergenic
949898522 3:8790964-8790986 GAACCCCAAGGTGAGACCACAGG + Intronic
954965110 3:54603412-54603434 GACCCCTAAGGATACCCCAGAGG - Intronic
960191629 3:114713509-114713531 GGACCTTAAGGAGACCACAGGGG - Intronic
961083957 3:124050507-124050529 GAACCCTAAGGCTACTCCTGAGG - Intergenic
967847364 3:194054900-194054922 GAACCCTGAAGTTGCCCCAGTGG + Intergenic
967992498 3:195142035-195142057 GAACACGATGCTGACCCCAGCGG + Intronic
985957683 5:3276983-3277005 GCACCCTCAGGTCACACCAGAGG - Intergenic
995860868 5:116639199-116639221 GAACCTTAAGAAGGCCCCAGGGG + Intergenic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1002533303 5:179862385-179862407 GGAGCCAAAGGTGACCGCAGGGG - Exonic
1006795595 6:36730550-36730572 CATCCCTAAGCTGACCTCAGTGG - Intronic
1008078559 6:47171008-47171030 GACACCTCAAGTGACCCCAGAGG - Intergenic
1013136808 6:107290238-107290260 GAACTCTAAGGTGACAACAGAGG + Intronic
1017800709 6:157893228-157893250 GGACTCTCAGATGACCCCAGTGG - Intronic
1022350712 7:29564423-29564445 GCACCCCAGGGTGACCCCCGGGG - Intronic
1024034296 7:45494768-45494790 GAACCCAGAGGTGTCACCAGTGG + Intergenic
1030134535 7:106234068-106234090 GAAATCTGAGGTGAACCCAGGGG + Intergenic
1033105451 7:138517327-138517349 AAACCCTAAGGTAACCTGAGAGG - Intronic
1033763465 7:144462021-144462043 GAAACCAAAGGTGAACCAAGAGG - Intronic
1036695233 8:10969957-10969979 AAACCCCATGCTGACCCCAGAGG + Intronic
1038130770 8:24728899-24728921 GAAGCCTAAGGGGACAGCAGGGG + Intergenic
1048141294 8:131797229-131797251 TAACCCTAAACTTACCCCAGTGG - Intergenic
1049439606 8:142603111-142603133 AAACACAAAGGTGCCCCCAGTGG + Intergenic
1056644565 9:88399560-88399582 GAAGCTTAAGGAGAGCCCAGAGG + Intronic
1059880510 9:118683788-118683810 CCACCCTAAGCTGTCCCCAGTGG + Intergenic
1203665882 Un_KI270754v1:20459-20481 GAACCCTGAGGCAACCCCTGAGG + Intergenic
1203667031 Un_KI270754v1:26098-26120 GAACCCTGAGGCAACCCCTGAGG + Intergenic
1203668179 Un_KI270754v1:31737-31759 GAACCCTGAGGCAACCCCTGAGG + Intergenic
1187519387 X:20000401-20000423 GAGCCCTCAGGTGACCCCACAGG + Intergenic
1190413106 X:50156375-50156397 GATCCCCAAGGAGACCTCAGGGG - Intergenic