ID: 1163795154

View in Genome Browser
Species Human (GRCh38)
Location 19:19333748-19333770
Sequence GTCGCCTTGCTTACCTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163795151_1163795154 12 Left 1163795151 19:19333713-19333735 CCCAAAGGGAGGAGGGGGAATTC 0: 1
1: 0
2: 1
3: 10
4: 208
Right 1163795154 19:19333748-19333770 GTCGCCTTGCTTACCTCTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 97
1163795150_1163795154 15 Left 1163795150 19:19333710-19333732 CCGCCCAAAGGGAGGAGGGGGAA 0: 1
1: 0
2: 6
3: 36
4: 330
Right 1163795154 19:19333748-19333770 GTCGCCTTGCTTACCTCTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 97
1163795152_1163795154 11 Left 1163795152 19:19333714-19333736 CCAAAGGGAGGAGGGGGAATTCA 0: 1
1: 0
2: 6
3: 15
4: 216
Right 1163795154 19:19333748-19333770 GTCGCCTTGCTTACCTCTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163795154 Original CRISPR GTCGCCTTGCTTACCTCTGC TGG Intronic
905917715 1:41697436-41697458 CACGCCTTTCTTAGCTCTGCGGG + Intronic
906071676 1:43021474-43021496 GACCCCATGCTTTCCTCTGCAGG - Intergenic
906559767 1:46747881-46747903 GTTTCCATGCTTCCCTCTGCTGG - Intergenic
906712527 1:47941622-47941644 ATCACCTTGCCTACCTCTCCAGG + Intronic
913160297 1:116139207-116139229 GTTCCCTTGCTGCCCTCTGCTGG - Intergenic
916501504 1:165391324-165391346 GTCTCCTTGCTTACCTGTATGGG - Intergenic
916989365 1:170225935-170225957 GTTGGCTTGCCTGCCTCTGCAGG + Intergenic
921333854 1:214066534-214066556 GTTGCCCTGCTTATCTCTCCAGG - Intergenic
922291352 1:224211412-224211434 GGAGCCCTGCTTATCTCTGCTGG - Intergenic
922542930 1:226432916-226432938 GGCTGCTGGCTTACCTCTGCAGG + Intergenic
922962045 1:229655954-229655976 CTGGCCTTGCTCACCTCGGCAGG + Intronic
924095787 1:240549445-240549467 GTCCCTTTCCTTAGCTCTGCTGG - Intronic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1062901165 10:1147919-1147941 GGCTCCTGGCTGACCTCTGCAGG + Intergenic
1063559672 10:7114420-7114442 GGCGCTTTGCTCACCTCTTCCGG + Intergenic
1064200112 10:13277158-13277180 GTCTCCTTGCTGCCCTCAGCTGG + Intergenic
1064501146 10:15974723-15974745 GTCGCCTTGTTAATCTCAGCTGG - Intergenic
1070801350 10:79246220-79246242 GCCCCCTGGCTGACCTCTGCTGG - Intronic
1070959487 10:80488582-80488604 GTGGCCTTCCTCACCTCTGAGGG + Intronic
1073680566 10:105699081-105699103 GTCGCCTTGCTCTCCTTTGCAGG - Intergenic
1076480088 10:130779210-130779232 GTCACCAAGCTTCCCTCTGCAGG + Intergenic
1089138110 11:116265644-116265666 GTCACCTTGCTCATCTCTGGAGG + Intergenic
1090135357 11:124192350-124192372 GTAGCTTTGCTTACTTCTGTGGG + Intergenic
1093078057 12:14777355-14777377 AACGGCTTGCTTATCTCTGCAGG - Intronic
1093176445 12:15918288-15918310 GCCGCCTCGCCTCCCTCTGCAGG + Intronic
1094043736 12:26145086-26145108 GTCACCTTGCCTCCCTCAGCTGG - Intronic
1100366726 12:93928333-93928355 GTCGCCATGCTTATATCTTCAGG + Intergenic
1102678200 12:114672725-114672747 TTCCCCTTGGTTACCTCTGTGGG - Intronic
1103834552 12:123808386-123808408 GTCTCCCTGCTTCCCCCTGCCGG - Intronic
1104053511 12:125212019-125212041 GTCACCTTTCTTCCCTCTTCAGG + Intronic
1108057465 13:46498904-46498926 GTGGCCTTGCACACCTCTCCAGG - Intergenic
1115109635 14:29806077-29806099 CTTGCCTTGCTTTCCTCTCCTGG - Intronic
1118833531 14:69458402-69458424 GTGGCCATGCTTTTCTCTGCCGG + Exonic
1132376877 15:101334015-101334037 AGGGCCTTGCTTACCTCTTCCGG - Intronic
1132942968 16:2517397-2517419 GTCGTCTTGGGTGCCTCTGCAGG + Intronic
1139770924 16:69275622-69275644 CTGGCCTTGCCTCCCTCTGCAGG - Intronic
1143104291 17:4520631-4520653 GTCTCCTTGCTGTCCTCAGCAGG + Intronic
1148498962 17:48074509-48074531 GGAGCCTTGCTGACCCCTGCTGG + Intronic
1149527635 17:57369117-57369139 GTAGCATTGTTTACCTCTGGTGG + Intronic
1153412282 18:4807259-4807281 TTCTCCCTGCTTGCCTCTGCTGG - Intergenic
1156354641 18:36330658-36330680 GTCACCCTGCCTACCTCTGGTGG - Intronic
1161728840 19:5946565-5946587 GTCTTCTTGCTTCCCTCCGCTGG - Intronic
1163795154 19:19333748-19333770 GTCGCCTTGCTTACCTCTGCTGG + Intronic
930064336 2:47316230-47316252 GGCTCCTTCCTTGCCTCTGCTGG + Intergenic
930170256 2:48244512-48244534 GATGCCTTGCGGACCTCTGCTGG - Intergenic
931609898 2:64087512-64087534 TTTGCCTAGCATACCTCTGCAGG - Intergenic
933743369 2:85552402-85552424 CTCCCCTTGCCCACCTCTGCTGG + Exonic
933753036 2:85615530-85615552 GTCGCCTAGTTTTCCTGTGCAGG + Intronic
935680244 2:105629700-105629722 GAGGCCCTGCTTTCCTCTGCTGG + Intergenic
942017886 2:171835534-171835556 GTGGCCTTCATTACCTCTGCAGG + Intronic
948850589 2:240703609-240703631 GTGGCCTTGCTTTCCTGGGCTGG + Intergenic
1170430906 20:16275548-16275570 CTAGCCTTGCTCACCTCTCCTGG - Intronic
1175414383 20:58792291-58792313 ATCAACTTGCTTTCCTCTGCAGG + Intergenic
1178490520 21:33048128-33048150 GTGACCCTGCTTGCCTCTGCAGG - Intergenic
1180823027 22:18845184-18845206 GTCTCCTTGTCTCCCTCTGCTGG - Intergenic
1181189934 22:21130828-21130850 GTCTCCTTGTCTCCCTCTGCTGG + Intergenic
1181209270 22:21279677-21279699 GTCTCCTTGTCTCCCTCTGCTGG - Intergenic
1181502639 22:23326509-23326531 GTCTCCTTGTCTCCCTCTGCTGG + Intergenic
1181653439 22:24274910-24274932 GTCTCCTTGTCTCCCTCTGCTGG + Intronic
1182709214 22:32310189-32310211 GTGGCCTTGCCTCCCTCTCCTGG - Intergenic
1184396811 22:44247124-44247146 GTGGCCTTGCCTCCCTCTCCTGG - Exonic
1203217674 22_KI270731v1_random:15766-15788 GTCTCCTTGTCTCCCTCTGCTGG + Intergenic
1203273167 22_KI270734v1_random:71090-71112 GTCTCCTTGTCTCCCTCTGCTGG - Intergenic
950134058 3:10568194-10568216 GACAGCTCGCTTACCTCTGCCGG + Intronic
953428126 3:42812578-42812600 GTTTGCTTGCTTACCTCTCCAGG + Intronic
953481615 3:43256956-43256978 GTGGCCTTGCTGACCTCTTCAGG - Intergenic
960442430 3:117705454-117705476 CTTGCATTTCTTACCTCTGCAGG - Intergenic
962374173 3:134846668-134846690 GAAGCCTTGCTCACCTTTGCAGG + Intronic
1202739029 3_GL000221v1_random:37783-37805 GTCTCCTTGCCTCCATCTGCAGG + Intergenic
984714058 4:182910226-182910248 GTGGCCTTGCTGATTTCTGCTGG - Intronic
985922956 5:2993900-2993922 GCCTCCTTCCTTGCCTCTGCTGG + Intergenic
996401943 5:123072008-123072030 ATTGCCTTGGTAACCTCTGCTGG + Intergenic
997596288 5:135109301-135109323 GTGGCCTTGCGAACCTCAGCTGG - Intronic
1014817658 6:125953209-125953231 GTAGCCTTCCTGCCCTCTGCTGG + Intergenic
1016761515 6:147742740-147742762 TTCTCCTTGATCACCTCTGCAGG + Intergenic
1020632148 7:10652250-10652272 GTGTCTTTGATTACCTCTGCAGG + Intergenic
1020643181 7:10780450-10780472 GTCTCCTTGCACAGCTCTGCGGG + Intergenic
1022583222 7:31578272-31578294 GTGGCCTTGCTCATCTATGCCGG + Exonic
1023632435 7:42177718-42177740 TTCCCCTTGCTTATCTCTGCTGG - Intronic
1024266921 7:47613897-47613919 ATCGCCTTGCCTAGCACTGCCGG - Intergenic
1026700220 7:72634728-72634750 CTCAGCTTGCTTACATCTGCAGG - Intronic
1027805973 7:82822990-82823012 GTCTCCTACCTGACCTCTGCTGG - Intronic
1029456892 7:100676080-100676102 CTCCCCTTGCTTACCCCTTCCGG + Intronic
1034262279 7:149764632-149764654 GTCGCCTTGCTCACCCCAGGCGG + Exonic
1034532556 7:151705720-151705742 GTCTCCCTGCTTAACTCTCCAGG + Intronic
1038402807 8:27298331-27298353 GTCGGCTGCCTTACCTCTGATGG - Intronic
1042126034 8:65538025-65538047 GGAGCCTTGCTTCCCTCTGCGGG - Intergenic
1044145661 8:88710734-88710756 GTCCCGTTTCTGACCTCTGCTGG + Intergenic
1045757964 8:105568341-105568363 CTCTCCTTTCGTACCTCTGCAGG + Intronic
1049462178 8:142735304-142735326 GTCCCCTTTCTGTCCTCTGCAGG + Exonic
1049784553 8:144444260-144444282 TTCGCCTTGCTCAGCTCTGTGGG + Exonic
1053662111 9:40291299-40291321 GTCTCCTTGCCTCCATCTGCAGG + Intronic
1053912560 9:42921467-42921489 GTCTCCTTGCCTCCATCTGCAGG + Intergenic
1054374238 9:64437539-64437561 GTCTCCTTGCCTCCATCTGCAGG + Intergenic
1054522499 9:66084985-66085007 GTCTCCTTGCCTCCATCTGCAGG - Intergenic
1060247182 9:121956932-121956954 TACGCCTTGCTGACCTCAGCAGG + Intronic
1062334545 9:136059279-136059301 TGCCCCTTGCTTAGCTCTGCGGG - Intronic
1186960269 X:14728963-14728985 CTCACCTTCCTTACCTCTCCAGG + Intronic
1187938225 X:24356522-24356544 GTCTACTTTCCTACCTCTGCAGG + Intergenic
1190650457 X:52563731-52563753 GTCTCCTTGCATAGCTCTACAGG + Intergenic
1190685427 X:52868567-52868589 GTCTCCTTGCACAGCTCTGCAGG + Intergenic
1191000868 X:55658451-55658473 GTCTCCTTGCACAGCTCTGCAGG + Intergenic
1195641147 X:107176013-107176035 GTCTTCTTGCTTACCTCTTCAGG - Intronic
1198565275 X:137897611-137897633 GTGCCCTTTCTTACCTCTCCTGG - Intergenic