ID: 1163797315

View in Genome Browser
Species Human (GRCh38)
Location 19:19345116-19345138
Sequence GACCCAAGCCAATGTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163797315_1163797325 25 Left 1163797315 19:19345116-19345138 CCCACCCCACATTGGCTTGGGTC 0: 1
1: 0
2: 0
3: 6
4: 137
Right 1163797325 19:19345164-19345186 TACCTGCCTTGCAGCTGGCTCGG 0: 1
1: 0
2: 1
3: 13
4: 204
1163797315_1163797324 20 Left 1163797315 19:19345116-19345138 CCCACCCCACATTGGCTTGGGTC 0: 1
1: 0
2: 0
3: 6
4: 137
Right 1163797324 19:19345159-19345181 CATATTACCTGCCTTGCAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163797315 Original CRISPR GACCCAAGCCAATGTGGGGT GGG (reversed) Intronic
901235058 1:7663230-7663252 GACCCCAGCCGCTGTGGGGCAGG + Intronic
901316334 1:8312301-8312323 GACCCAAGCAGATGTTGGCTGGG + Intergenic
902377832 1:16038395-16038417 GGCACAGGCCAATGTGGGGAGGG + Intergenic
902382980 1:16061311-16061333 GGCACAGGCCAATGTGGGGAGGG + Intronic
902653742 1:17853462-17853484 GCCCCAGGCCAAAGTGGGATGGG - Intergenic
903478080 1:23634221-23634243 GTTCCAGGCCAAGGTGGGGTAGG + Intronic
905874253 1:41422281-41422303 GATACAGGCCAATATGGGGTTGG + Intergenic
906845487 1:49186858-49186880 GACCGAAGCCAACCTGGGGAGGG + Intronic
912401641 1:109398050-109398072 GACGCGAGCCAATGAGGAGTGGG - Intergenic
915846959 1:159276781-159276803 GACCCATGTCAATGTGAGCTGGG + Intergenic
917688480 1:177442988-177443010 AAGCCAAGACAATGTGGGGATGG - Intergenic
918094975 1:181326930-181326952 GAGCCAGGCCCACGTGGGGTGGG - Intergenic
920936565 1:210440454-210440476 CACCCAAGCCTTTCTGGGGTGGG - Intronic
921174231 1:212579797-212579819 GATCCCAGCCGATGTGGAGTAGG + Intronic
923169105 1:231396546-231396568 GACAGAAGCCAATGAGGGGCCGG - Intronic
924233624 1:241982433-241982455 TACCCATGCAAGTGTGGGGTGGG - Intergenic
1070393209 10:75989090-75989112 GACCCCAGCCCTTGTGGAGTTGG - Intronic
1073250687 10:102118997-102119019 GACCCAGGCCAAGCTGGGCTGGG - Intronic
1073511203 10:104043640-104043662 GACCCAAGCCAGGTTGTGGTGGG + Intronic
1080616038 11:33945653-33945675 GCCCCTAGGCAGTGTGGGGTGGG - Intergenic
1081434810 11:43015508-43015530 GACCCAAGAGAAAGTGGGTTGGG - Intergenic
1083155837 11:60822279-60822301 CATCCAATCCCATGTGGGGTGGG - Intergenic
1083253947 11:61485186-61485208 GACACAAGTCTCTGTGGGGTGGG - Intronic
1090227410 11:125080048-125080070 CACACAAGCCAATTCGGGGTCGG - Intronic
1093086363 12:14869863-14869885 GACCCAAGGCCCTGTGGTGTGGG + Intronic
1093391608 12:18630565-18630587 GCCCCAAGGGAATGTGGAGTCGG + Intronic
1095925778 12:47577717-47577739 GCATCAAGCCAAAGTGGGGTGGG + Intergenic
1097144169 12:56928563-56928585 GTCCCAAGCCTGTGTGGGGCTGG - Intronic
1097225813 12:57476295-57476317 GCCTCACGCCAATGTGGGGGCGG - Intronic
1102098333 12:110257969-110257991 GTCCCAGCCCAAGGTGGGGTGGG + Intergenic
1102490932 12:113289098-113289120 GACCCAGGCTACTGTGGGGGTGG - Intronic
1108287147 13:48919782-48919804 GAGATAAGCCAAGGTGGGGTTGG + Intergenic
1109524439 13:63557218-63557240 GAGGAAAGGCAATGTGGGGTTGG + Intergenic
1110219596 13:73059258-73059280 GACCCAAGCCAGCGTGGGCGAGG + Exonic
1110260083 13:73475064-73475086 GACCCAAACAACTGTGGTGTGGG - Intergenic
1112101058 13:96189950-96189972 GATCTGAGTCAATGTGGGGTGGG - Intronic
1115154089 14:30318594-30318616 GGCCCAAGGAAATATGGGGTAGG - Intergenic
1116428594 14:44820338-44820360 GACCCAAGGCACAGTGGTGTGGG - Intergenic
1120951522 14:90046101-90046123 GAGCCAGGCCAGTGGGGGGTAGG + Intergenic
1122300815 14:100730117-100730139 GACCAGAGACAATTTGGGGTGGG - Intronic
1122772746 14:104104556-104104578 GCCCCCAGCCCATGAGGGGTGGG - Intronic
1124169692 15:27361352-27361374 GGACCAAGCCAATGTGGCCTTGG + Intronic
1124599022 15:31116129-31116151 GAGCCTAACCAATGTGGGGGAGG + Intronic
1128388773 15:67168786-67168808 GACCCCAGCCAGTGTGTGGGTGG + Intronic
1128687797 15:69699705-69699727 GTCCCAGGCCACGGTGGGGTCGG - Intergenic
1129890620 15:79069378-79069400 GACACAGGCCCATGTGGGGATGG + Intronic
1131055501 15:89372130-89372152 GACCCTAGGCAAAATGGGGTGGG - Intergenic
1131330135 15:91490471-91490493 GACCCAAGCCTATGTGTGCCTGG + Intergenic
1132995040 16:2818364-2818386 GCACCACGCCAATGTGGGATTGG - Intronic
1134059627 16:11191297-11191319 GCCCCAAGTCAATAAGGGGTGGG - Intergenic
1134192933 16:12136450-12136472 GACCCAAGCTAATTTGGTGTGGG - Intronic
1138200245 16:55083036-55083058 GTCCCAGGTCCATGTGGGGTGGG + Intergenic
1141865632 16:86748016-86748038 GAACCAGGCCAGTGTAGGGTGGG + Intergenic
1142919930 17:3176070-3176092 AACCCAATCCAAAGTGGGGTGGG + Intergenic
1143983778 17:10893735-10893757 GACCCCTCCCAATGTGGGGAGGG + Intergenic
1147310773 17:39595097-39595119 CACCCAAGCCTGTGTGGGTTTGG + Intergenic
1147330336 17:39695554-39695576 GCCTCAAGGCACTGTGGGGTAGG + Intronic
1149665217 17:58360504-58360526 GACCCATGGCAATGAAGGGTGGG - Intronic
1151794244 17:76332665-76332687 GACCCAGGCAAATGTGAGGGTGG - Intronic
1153884058 18:9447411-9447433 GACCCCAGCCCATGTGGGAGTGG + Intergenic
1161952645 19:7476485-7476507 CACCTCAGCCAATGTGTGGTGGG - Intergenic
1162746272 19:12800431-12800453 CACCCAACCCAGGGTGGGGTGGG - Intronic
1163599581 19:18240778-18240800 GAGCCAGGGCAAAGTGGGGTGGG + Intronic
1163797315 19:19345116-19345138 GACCCAAGCCAATGTGGGGTGGG - Intronic
1166684844 19:44790136-44790158 GAGCCAAGGCAACGTGGGGGTGG - Intronic
925449731 2:3958710-3958732 GGCTCAAGCCAGTGTGGGGCTGG + Intergenic
927879378 2:26679910-26679932 CACCCAACTCATTGTGGGGTGGG - Intergenic
935281952 2:101526030-101526052 GACCCCAGCCAATGGGGAGAGGG - Intergenic
937587232 2:123567399-123567421 TACCTAAGCCAAGCTGGGGTAGG + Intergenic
939069612 2:137523405-137523427 GTCCCAAGAAAATGTGGGATTGG - Intronic
942060119 2:172221511-172221533 CACCTAACCCAATGTGGGGAGGG + Intergenic
944518114 2:200532574-200532596 TACCCAATCCAAGGTGGGGAAGG - Intronic
946628064 2:221636308-221636330 GTACCAAGCCATAGTGGGGTTGG + Intergenic
947388949 2:229620640-229620662 GCCCCATCCCAGTGTGGGGTTGG - Intronic
947592359 2:231393049-231393071 GTCCCAAGCCAAGGTGGAGGTGG - Intergenic
948693592 2:239721702-239721724 GCCCCAGCCCAATGTGGGGGTGG - Intergenic
1170353813 20:15470593-15470615 GACACAAGCCAAGATGGGATTGG - Intronic
1171295002 20:24009608-24009630 GCCCAAAGCCAATGGTGGGTGGG + Intergenic
1174116523 20:48230189-48230211 GTCCCAGGCCACTGTGGGGTAGG + Intergenic
1177368679 21:20173425-20173447 GACAAAAGCCTATGTGGGATAGG - Intergenic
1179018450 21:37616031-37616053 AACCCAAGGTAATGTGGAGTAGG - Exonic
1182881436 22:33737252-33737274 GACAAAAGCCCATGTGGGGAAGG - Intronic
1183648118 22:39138498-39138520 CACCCAGGGCACTGTGGGGTGGG - Intronic
1184862395 22:47180450-47180472 GTTGCAAGCCACTGTGGGGTGGG - Intergenic
1185285380 22:49997574-49997596 GTGCCAAGCCAGTGTGGGGGAGG - Intronic
950479350 3:13235158-13235180 GTCCCCATCCAAAGTGGGGTGGG + Intergenic
951837555 3:26999949-26999971 GACCAAAGCCAGGGTGGGGATGG + Intergenic
954277527 3:49552400-49552422 GACCCCAGTCAGTGTGGGTTGGG - Intergenic
956902426 3:73730502-73730524 GACCCAGGCTTATGTGGGGGTGG + Intergenic
959471006 3:106750238-106750260 CACCCAAGCCCATGTGGAGAGGG - Intergenic
959589611 3:108063445-108063467 TACCACAGCTAATGTGGGGTAGG + Intronic
961139622 3:124544928-124544950 GACCAAAGCCACTGTGTGGCTGG + Intronic
962225345 3:133601995-133602017 GAACCAAGCAAATGGGGGGCTGG + Intronic
962648745 3:137466734-137466756 GGCCAAAACCAAGGTGGGGTTGG + Intergenic
968935267 4:3606999-3607021 GGACCAAGCCACAGTGGGGTGGG + Intergenic
969121297 4:4913429-4913451 GACCCAGGCCAATCAGGGGGTGG - Intergenic
971329900 4:25673792-25673814 TCCCCAAGACAATCTGGGGTGGG - Intronic
977976276 4:103270408-103270430 GACCCAATCCACTGAGGGTTTGG - Intergenic
981615236 4:146638418-146638440 GGCCCAAGCCAGCGTTGGGTAGG - Intergenic
983230398 4:165124399-165124421 GACCCCAGACAAAGTGGAGTTGG + Intronic
985380068 4:189384125-189384147 GCCCAAAGCCAATATGGTGTGGG - Intergenic
985635747 5:1034934-1034956 GGCCCCTGCCAATGTTGGGTAGG - Intronic
985844371 5:2333401-2333423 GACCACAGCCTATGTGGGGCAGG - Intergenic
986296626 5:6444703-6444725 AGCCCAAGCCACTGAGGGGTGGG - Intergenic
987019165 5:13852091-13852113 AACCCAGGCCCTTGTGGGGTAGG - Intronic
997449253 5:133968497-133968519 CATCCAAGCCCTTGTGGGGTTGG - Exonic
997661369 5:135591673-135591695 GATCCCAGCCAATGGGGAGTGGG + Intergenic
997999285 5:138611137-138611159 GACCCATGCCAATGTGACATGGG + Intronic
998558299 5:143147402-143147424 GACCAAAGCCCTTGTGGGGTAGG - Intronic
1002020581 5:176361699-176361721 GACCCAAGCCATTGTGAGAGCGG + Exonic
1002925239 6:1602012-1602034 GACCCAAGCCAAGCTTGTGTTGG + Intergenic
1005273773 6:24194762-24194784 GTTCCAAGTCAATCTGGGGTTGG - Intronic
1010273091 6:73937205-73937227 GTCCCCAGCCAAAGAGGGGTTGG - Intergenic
1011335532 6:86255462-86255484 GACCTTGGCAAATGTGGGGTGGG + Intergenic
1011544078 6:88465503-88465525 GACACAAGGACATGTGGGGTGGG + Intergenic
1012685695 6:102245688-102245710 GAACCAAGCCAATATGATGTTGG - Intergenic
1017990207 6:159481149-159481171 GACACTTGCCCATGTGGGGTGGG + Intergenic
1019305118 7:330488-330510 GGCCCAAGACATTGTGGGGGAGG + Intergenic
1019705084 7:2493792-2493814 GACCCAAGGCAGGGTGGGGGTGG - Intergenic
1020016231 7:4833768-4833790 GAGCCAAGTCACTGTGGGGTGGG + Intronic
1020204180 7:6102869-6102891 CACCCAAGCCACTGTAGGGTGGG + Intergenic
1024708567 7:51988544-51988566 AACCCAAACCAAGGTGGGGAGGG + Intergenic
1028978253 7:96938114-96938136 GATACAAGCCAGTGTGGAGTTGG + Intergenic
1031441210 7:121796901-121796923 GACCAAAGCCAATGGGGGACTGG - Intergenic
1037808555 8:22072297-22072319 GACACAAGCAAAGGTGGGGAGGG - Intronic
1039489448 8:37936515-37936537 GATCCAAGCCAAGCTGGGTTGGG + Intronic
1039820441 8:41129734-41129756 GACCCAGGCCATGGTGGTGTGGG - Intergenic
1040912360 8:52531963-52531985 GACCCAATGCAGTCTGGGGTAGG - Intergenic
1054454917 9:65424903-65424925 GGACCAAGCCACAGTGGGGTGGG - Intergenic
1061493677 9:130959854-130959876 GAACCAGGACAATGTAGGGTCGG + Intergenic
1062249839 9:135588541-135588563 GACCAGAGCCATGGTGGGGTGGG + Intergenic
1062584725 9:137244118-137244140 CACCCCGGCCAATGTGGGGAGGG - Intronic
1186528390 X:10270562-10270584 GACCAAAGCCAAGGTGTGGCAGG - Intergenic
1189324345 X:40104006-40104028 GAGCCCCGCCAATGGGGGGTGGG - Intronic
1189372358 X:40438930-40438952 GACCCAAGCCAATGGGGAAAGGG - Intergenic
1189682086 X:43527309-43527331 GCCCTCAGACAATGTGGGGTTGG + Intergenic
1189695392 X:43656445-43656467 GACCCTGGCCAGTGAGGGGTAGG + Intronic
1190268959 X:48847591-48847613 GACCCCAGTCCATGTGGTGTAGG + Intergenic
1191666050 X:63703865-63703887 GAGCCATGTAAATGTGGGGTGGG + Intronic
1193607290 X:83583925-83583947 AACCCAAGCCAGTGGTGGGTTGG - Intergenic
1194191576 X:90842953-90842975 GACTCAAGGAAATGTGGGGAAGG - Intergenic
1198419934 X:136461037-136461059 GAACCAAGACAATGTGGTATTGG - Intergenic
1200448501 Y:3294897-3294919 GACTAAAGCCAATATGTGGTTGG + Intergenic
1200538217 Y:4425385-4425407 GACTCAAGGAAATGTGGGGAAGG - Intergenic