ID: 1163800465

View in Genome Browser
Species Human (GRCh38)
Location 19:19361929-19361951
Sequence ACACTCGCACAGGGCCGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163800465_1163800471 25 Left 1163800465 19:19361929-19361951 CCACACCGGCCCTGTGCGAGTGT No data
Right 1163800471 19:19361977-19361999 CACCCCAACCATCGATGCCTGGG No data
1163800465_1163800469 -7 Left 1163800465 19:19361929-19361951 CCACACCGGCCCTGTGCGAGTGT No data
Right 1163800469 19:19361945-19361967 CGAGTGTTTGAGTCTCAACATGG No data
1163800465_1163800470 24 Left 1163800465 19:19361929-19361951 CCACACCGGCCCTGTGCGAGTGT No data
Right 1163800470 19:19361976-19361998 GCACCCCAACCATCGATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163800465 Original CRISPR ACACTCGCACAGGGCCGGTG TGG (reversed) Intergenic
No off target data available for this crispr