ID: 1163800466

View in Genome Browser
Species Human (GRCh38)
Location 19:19361934-19361956
Sequence CTCAAACACTCGCACAGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163800466_1163800470 19 Left 1163800466 19:19361934-19361956 CCGGCCCTGTGCGAGTGTTTGAG No data
Right 1163800470 19:19361976-19361998 GCACCCCAACCATCGATGCCTGG No data
1163800466_1163800471 20 Left 1163800466 19:19361934-19361956 CCGGCCCTGTGCGAGTGTTTGAG No data
Right 1163800471 19:19361977-19361999 CACCCCAACCATCGATGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163800466 Original CRISPR CTCAAACACTCGCACAGGGC CGG (reversed) Intergenic
No off target data available for this crispr