ID: 1163800468

View in Genome Browser
Species Human (GRCh38)
Location 19:19361939-19361961
Sequence TGAGACTCAAACACTCGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163800468_1163800471 15 Left 1163800468 19:19361939-19361961 CCTGTGCGAGTGTTTGAGTCTCA No data
Right 1163800471 19:19361977-19361999 CACCCCAACCATCGATGCCTGGG No data
1163800468_1163800470 14 Left 1163800468 19:19361939-19361961 CCTGTGCGAGTGTTTGAGTCTCA No data
Right 1163800470 19:19361976-19361998 GCACCCCAACCATCGATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163800468 Original CRISPR TGAGACTCAAACACTCGCAC AGG (reversed) Intergenic
No off target data available for this crispr