ID: 1163800469

View in Genome Browser
Species Human (GRCh38)
Location 19:19361945-19361967
Sequence CGAGTGTTTGAGTCTCAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163800462_1163800469 24 Left 1163800462 19:19361898-19361920 CCCAAAGTGCTGGGATTACAGTC 0: 1708
1: 229429
2: 279413
3: 183504
4: 140958
Right 1163800469 19:19361945-19361967 CGAGTGTTTGAGTCTCAACATGG No data
1163800465_1163800469 -7 Left 1163800465 19:19361929-19361951 CCACACCGGCCCTGTGCGAGTGT No data
Right 1163800469 19:19361945-19361967 CGAGTGTTTGAGTCTCAACATGG No data
1163800463_1163800469 23 Left 1163800463 19:19361899-19361921 CCAAAGTGCTGGGATTACAGTCG 0: 738
1: 129306
2: 281700
3: 224502
4: 151443
Right 1163800469 19:19361945-19361967 CGAGTGTTTGAGTCTCAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163800469 Original CRISPR CGAGTGTTTGAGTCTCAACA TGG Intergenic
No off target data available for this crispr