ID: 1163800470

View in Genome Browser
Species Human (GRCh38)
Location 19:19361976-19361998
Sequence GCACCCCAACCATCGATGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163800467_1163800470 15 Left 1163800467 19:19361938-19361960 CCCTGTGCGAGTGTTTGAGTCTC No data
Right 1163800470 19:19361976-19361998 GCACCCCAACCATCGATGCCTGG No data
1163800466_1163800470 19 Left 1163800466 19:19361934-19361956 CCGGCCCTGTGCGAGTGTTTGAG No data
Right 1163800470 19:19361976-19361998 GCACCCCAACCATCGATGCCTGG No data
1163800468_1163800470 14 Left 1163800468 19:19361939-19361961 CCTGTGCGAGTGTTTGAGTCTCA No data
Right 1163800470 19:19361976-19361998 GCACCCCAACCATCGATGCCTGG No data
1163800465_1163800470 24 Left 1163800465 19:19361929-19361951 CCACACCGGCCCTGTGCGAGTGT No data
Right 1163800470 19:19361976-19361998 GCACCCCAACCATCGATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163800470 Original CRISPR GCACCCCAACCATCGATGCC TGG Intergenic
No off target data available for this crispr