ID: 1163800471

View in Genome Browser
Species Human (GRCh38)
Location 19:19361977-19361999
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163800467_1163800471 16 Left 1163800467 19:19361938-19361960 CCCTGTGCGAGTGTTTGAGTCTC No data
Right 1163800471 19:19361977-19361999 CACCCCAACCATCGATGCCTGGG No data
1163800468_1163800471 15 Left 1163800468 19:19361939-19361961 CCTGTGCGAGTGTTTGAGTCTCA No data
Right 1163800471 19:19361977-19361999 CACCCCAACCATCGATGCCTGGG No data
1163800466_1163800471 20 Left 1163800466 19:19361934-19361956 CCGGCCCTGTGCGAGTGTTTGAG No data
Right 1163800471 19:19361977-19361999 CACCCCAACCATCGATGCCTGGG No data
1163800465_1163800471 25 Left 1163800465 19:19361929-19361951 CCACACCGGCCCTGTGCGAGTGT No data
Right 1163800471 19:19361977-19361999 CACCCCAACCATCGATGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163800471 Original CRISPR CACCCCAACCATCGATGCCT GGG Intergenic