ID: 1163803467

View in Genome Browser
Species Human (GRCh38)
Location 19:19382279-19382301
Sequence GTGCAAACACAGTTGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163803459_1163803467 17 Left 1163803459 19:19382239-19382261 CCCTGGTAGGCCACAGTACATGC No data
Right 1163803467 19:19382279-19382301 GTGCAAACACAGTTGGGGCTGGG No data
1163803461_1163803467 7 Left 1163803461 19:19382249-19382271 CCACAGTACATGCTTCATGCTTT No data
Right 1163803467 19:19382279-19382301 GTGCAAACACAGTTGGGGCTGGG No data
1163803457_1163803467 24 Left 1163803457 19:19382232-19382254 CCCTGATCCCTGGTAGGCCACAG No data
Right 1163803467 19:19382279-19382301 GTGCAAACACAGTTGGGGCTGGG No data
1163803458_1163803467 23 Left 1163803458 19:19382233-19382255 CCTGATCCCTGGTAGGCCACAGT No data
Right 1163803467 19:19382279-19382301 GTGCAAACACAGTTGGGGCTGGG No data
1163803460_1163803467 16 Left 1163803460 19:19382240-19382262 CCTGGTAGGCCACAGTACATGCT No data
Right 1163803467 19:19382279-19382301 GTGCAAACACAGTTGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163803467 Original CRISPR GTGCAAACACAGTTGGGGCT GGG Intergenic
No off target data available for this crispr