ID: 1163803971

View in Genome Browser
Species Human (GRCh38)
Location 19:19385317-19385339
Sequence CACCGGAGGCGGCCTTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163803971_1163803982 13 Left 1163803971 19:19385317-19385339 CCTGGCCAAGGCCGCCTCCGGTG No data
Right 1163803982 19:19385353-19385375 GAGCCCCTGCAGAGCACTGCGGG No data
1163803971_1163803983 14 Left 1163803971 19:19385317-19385339 CCTGGCCAAGGCCGCCTCCGGTG No data
Right 1163803983 19:19385354-19385376 AGCCCCTGCAGAGCACTGCGGGG No data
1163803971_1163803977 -10 Left 1163803971 19:19385317-19385339 CCTGGCCAAGGCCGCCTCCGGTG No data
Right 1163803977 19:19385330-19385352 GCCTCCGGTGCATTATGGGTGGG No data
1163803971_1163803979 -9 Left 1163803971 19:19385317-19385339 CCTGGCCAAGGCCGCCTCCGGTG No data
Right 1163803979 19:19385331-19385353 CCTCCGGTGCATTATGGGTGGGG No data
1163803971_1163803981 12 Left 1163803971 19:19385317-19385339 CCTGGCCAAGGCCGCCTCCGGTG No data
Right 1163803981 19:19385352-19385374 GGAGCCCCTGCAGAGCACTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163803971 Original CRISPR CACCGGAGGCGGCCTTGGCC AGG (reversed) Intergenic
No off target data available for this crispr