ID: 1163804126

View in Genome Browser
Species Human (GRCh38)
Location 19:19385918-19385940
Sequence GGGTGCGCGTGCGCGCGCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 254}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163804126_1163804140 20 Left 1163804126 19:19385918-19385940 CCCCGGCGCGCGCACGCGCACCC 0: 1
1: 0
2: 4
3: 30
4: 254
Right 1163804140 19:19385961-19385983 GCGCCGCCCGCGCAGTCGGTCGG 0: 1
1: 0
2: 0
3: 7
4: 47
1163804126_1163804137 16 Left 1163804126 19:19385918-19385940 CCCCGGCGCGCGCACGCGCACCC 0: 1
1: 0
2: 4
3: 30
4: 254
Right 1163804137 19:19385957-19385979 CCCCGCGCCGCCCGCGCAGTCGG 0: 1
1: 0
2: 2
3: 12
4: 159
1163804126_1163804142 24 Left 1163804126 19:19385918-19385940 CCCCGGCGCGCGCACGCGCACCC 0: 1
1: 0
2: 4
3: 30
4: 254
Right 1163804142 19:19385965-19385987 CGCCCGCGCAGTCGGTCGGTCGG 0: 1
1: 0
2: 0
3: 1
4: 9

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163804126 Original CRISPR GGGTGCGCGTGCGCGCGCCG GGG (reversed) Exonic