ID: 1163804137

View in Genome Browser
Species Human (GRCh38)
Location 19:19385957-19385979
Sequence CCCCGCGCCGCCCGCGCAGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 159}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163804131_1163804137 -6 Left 1163804131 19:19385940-19385962 CCCGCCGCCCGAGCGCGCCCCGC 0: 1
1: 1
2: 3
3: 52
4: 457
Right 1163804137 19:19385957-19385979 CCCCGCGCCGCCCGCGCAGTCGG 0: 1
1: 0
2: 2
3: 12
4: 159
1163804126_1163804137 16 Left 1163804126 19:19385918-19385940 CCCCGGCGCGCGCACGCGCACCC 0: 1
1: 0
2: 4
3: 30
4: 254
Right 1163804137 19:19385957-19385979 CCCCGCGCCGCCCGCGCAGTCGG 0: 1
1: 0
2: 2
3: 12
4: 159
1163804128_1163804137 14 Left 1163804128 19:19385920-19385942 CCGGCGCGCGCACGCGCACCCCC 0: 1
1: 0
2: 4
3: 40
4: 331
Right 1163804137 19:19385957-19385979 CCCCGCGCCGCCCGCGCAGTCGG 0: 1
1: 0
2: 2
3: 12
4: 159
1163804132_1163804137 -7 Left 1163804132 19:19385941-19385963 CCGCCGCCCGAGCGCGCCCCGCG 0: 1
1: 0
2: 4
3: 54
4: 409
Right 1163804137 19:19385957-19385979 CCCCGCGCCGCCCGCGCAGTCGG 0: 1
1: 0
2: 2
3: 12
4: 159
1163804130_1163804137 -5 Left 1163804130 19:19385939-19385961 CCCCGCCGCCCGAGCGCGCCCCG 0: 1
1: 1
2: 8
3: 51
4: 397
Right 1163804137 19:19385957-19385979 CCCCGCGCCGCCCGCGCAGTCGG 0: 1
1: 0
2: 2
3: 12
4: 159
1163804124_1163804137 29 Left 1163804124 19:19385905-19385927 CCCAGGGTCAGCGCCCCGGCGCG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1163804137 19:19385957-19385979 CCCCGCGCCGCCCGCGCAGTCGG 0: 1
1: 0
2: 2
3: 12
4: 159
1163804129_1163804137 -4 Left 1163804129 19:19385938-19385960 CCCCCGCCGCCCGAGCGCGCCCC 0: 1
1: 1
2: 14
3: 109
4: 662
Right 1163804137 19:19385957-19385979 CCCCGCGCCGCCCGCGCAGTCGG 0: 1
1: 0
2: 2
3: 12
4: 159
1163804133_1163804137 -10 Left 1163804133 19:19385944-19385966 CCGCCCGAGCGCGCCCCGCGCCG 0: 1
1: 0
2: 5
3: 45
4: 386
Right 1163804137 19:19385957-19385979 CCCCGCGCCGCCCGCGCAGTCGG 0: 1
1: 0
2: 2
3: 12
4: 159
1163804127_1163804137 15 Left 1163804127 19:19385919-19385941 CCCGGCGCGCGCACGCGCACCCC 0: 1
1: 0
2: 5
3: 27
4: 229
Right 1163804137 19:19385957-19385979 CCCCGCGCCGCCCGCGCAGTCGG 0: 1
1: 0
2: 2
3: 12
4: 159
1163804125_1163804137 28 Left 1163804125 19:19385906-19385928 CCAGGGTCAGCGCCCCGGCGCGC 0: 1
1: 0
2: 1
3: 18
4: 162
Right 1163804137 19:19385957-19385979 CCCCGCGCCGCCCGCGCAGTCGG 0: 1
1: 0
2: 2
3: 12
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163804137 Original CRISPR CCCCGCGCCGCCCGCGCAGT CGG Exonic