ID: 1163804140

View in Genome Browser
Species Human (GRCh38)
Location 19:19385961-19385983
Sequence GCGCCGCCCGCGCAGTCGGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 47}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163804135_1163804140 -10 Left 1163804135 19:19385948-19385970 CCGAGCGCGCCCCGCGCCGCCCG 0: 1
1: 1
2: 10
3: 111
4: 647
Right 1163804140 19:19385961-19385983 GCGCCGCCCGCGCAGTCGGTCGG 0: 1
1: 0
2: 0
3: 7
4: 47
1163804129_1163804140 0 Left 1163804129 19:19385938-19385960 CCCCCGCCGCCCGAGCGCGCCCC 0: 1
1: 1
2: 14
3: 109
4: 662
Right 1163804140 19:19385961-19385983 GCGCCGCCCGCGCAGTCGGTCGG 0: 1
1: 0
2: 0
3: 7
4: 47
1163804126_1163804140 20 Left 1163804126 19:19385918-19385940 CCCCGGCGCGCGCACGCGCACCC 0: 1
1: 0
2: 4
3: 30
4: 254
Right 1163804140 19:19385961-19385983 GCGCCGCCCGCGCAGTCGGTCGG 0: 1
1: 0
2: 0
3: 7
4: 47
1163804128_1163804140 18 Left 1163804128 19:19385920-19385942 CCGGCGCGCGCACGCGCACCCCC 0: 1
1: 0
2: 4
3: 40
4: 331
Right 1163804140 19:19385961-19385983 GCGCCGCCCGCGCAGTCGGTCGG 0: 1
1: 0
2: 0
3: 7
4: 47
1163804132_1163804140 -3 Left 1163804132 19:19385941-19385963 CCGCCGCCCGAGCGCGCCCCGCG 0: 1
1: 0
2: 4
3: 54
4: 409
Right 1163804140 19:19385961-19385983 GCGCCGCCCGCGCAGTCGGTCGG 0: 1
1: 0
2: 0
3: 7
4: 47
1163804130_1163804140 -1 Left 1163804130 19:19385939-19385961 CCCCGCCGCCCGAGCGCGCCCCG 0: 1
1: 1
2: 8
3: 51
4: 397
Right 1163804140 19:19385961-19385983 GCGCCGCCCGCGCAGTCGGTCGG 0: 1
1: 0
2: 0
3: 7
4: 47
1163804131_1163804140 -2 Left 1163804131 19:19385940-19385962 CCCGCCGCCCGAGCGCGCCCCGC 0: 1
1: 1
2: 3
3: 52
4: 457
Right 1163804140 19:19385961-19385983 GCGCCGCCCGCGCAGTCGGTCGG 0: 1
1: 0
2: 0
3: 7
4: 47
1163804134_1163804140 -9 Left 1163804134 19:19385947-19385969 CCCGAGCGCGCCCCGCGCCGCCC 0: 1
1: 1
2: 13
3: 87
4: 711
Right 1163804140 19:19385961-19385983 GCGCCGCCCGCGCAGTCGGTCGG 0: 1
1: 0
2: 0
3: 7
4: 47
1163804133_1163804140 -6 Left 1163804133 19:19385944-19385966 CCGCCCGAGCGCGCCCCGCGCCG 0: 1
1: 0
2: 5
3: 45
4: 386
Right 1163804140 19:19385961-19385983 GCGCCGCCCGCGCAGTCGGTCGG 0: 1
1: 0
2: 0
3: 7
4: 47
1163804127_1163804140 19 Left 1163804127 19:19385919-19385941 CCCGGCGCGCGCACGCGCACCCC 0: 1
1: 0
2: 5
3: 27
4: 229
Right 1163804140 19:19385961-19385983 GCGCCGCCCGCGCAGTCGGTCGG 0: 1
1: 0
2: 0
3: 7
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163804140 Original CRISPR GCGCCGCCCGCGCAGTCGGT CGG Exonic