ID: 1163804161

View in Genome Browser
Species Human (GRCh38)
Location 19:19386042-19386064
Sequence CCTGAGGGAGTCGCCTCCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 82}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163804148_1163804161 10 Left 1163804148 19:19386009-19386031 CCGCCGCCGCCACAGCGGCCGCC 0: 1
1: 2
2: 88
3: 1493
4: 2758
Right 1163804161 19:19386042-19386064 CCTGAGGGAGTCGCCTCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 82
1163804149_1163804161 7 Left 1163804149 19:19386012-19386034 CCGCCGCCACAGCGGCCGCCGCG 0: 1
1: 0
2: 12
3: 297
4: 2228
Right 1163804161 19:19386042-19386064 CCTGAGGGAGTCGCCTCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 82
1163804145_1163804161 23 Left 1163804145 19:19385996-19386018 CCTGTCGCCGCTGCCGCCGCCGC 0: 1
1: 14
2: 256
3: 546
4: 1301
Right 1163804161 19:19386042-19386064 CCTGAGGGAGTCGCCTCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 82
1163804152_1163804161 4 Left 1163804152 19:19386015-19386037 CCGCCACAGCGGCCGCCGCGGGC 0: 1
1: 0
2: 1
3: 47
4: 553
Right 1163804161 19:19386042-19386064 CCTGAGGGAGTCGCCTCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 82
1163804153_1163804161 1 Left 1163804153 19:19386018-19386040 CCACAGCGGCCGCCGCGGGCGCC 0: 1
1: 0
2: 10
3: 139
4: 2143
Right 1163804161 19:19386042-19386064 CCTGAGGGAGTCGCCTCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 82
1163804146_1163804161 16 Left 1163804146 19:19386003-19386025 CCGCTGCCGCCGCCGCCACAGCG 0: 1
1: 3
2: 37
3: 540
4: 2881
Right 1163804161 19:19386042-19386064 CCTGAGGGAGTCGCCTCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 82
1163804155_1163804161 -8 Left 1163804155 19:19386027-19386049 CCGCCGCGGGCGCCACCTGAGGG 0: 1
1: 0
2: 1
3: 10
4: 117
Right 1163804161 19:19386042-19386064 CCTGAGGGAGTCGCCTCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163804161 Original CRISPR CCTGAGGGAGTCGCCTCCGC GGG Exonic
900254771 1:1692455-1692477 CCTGATGCAGTCTCCGCCGCAGG + Exonic
900263522 1:1745730-1745752 CCTGATGCAGTCTCCGCCGCAGG + Exonic
901972306 1:12917896-12917918 CCTGATGAAGTCGCCTCATCTGG + Exonic
902012873 1:13283866-13283888 CCTGATGAAGTCGCCTCATCTGG - Exonic
904627303 1:31814386-31814408 ACTGAGGGACTCCCCTCCACTGG + Exonic
904703955 1:32376585-32376607 TCTGATGGAGTCACCTCTGCTGG + Exonic
919790679 1:201288881-201288903 CCTGAGGGAGTCACATGGGCTGG + Intronic
920302575 1:204997834-204997856 CCTGAGGGAGTTTCCTGCCCTGG + Intronic
920560258 1:206933545-206933567 CCTCAGTGAGTCCCATCCGCAGG + Intronic
1067133438 10:43586950-43586972 GGTGAGGGAGTGGCCTCAGCCGG - Intergenic
1076521756 10:131085601-131085623 CCTGAGGGAATGGCCGCTGCTGG + Intergenic
1076821162 10:132940433-132940455 AGTGCTGGAGTCGCCTCCGCAGG + Intronic
1077142658 11:1031259-1031281 CCTGCGGGAGACGGCTCTGCTGG + Exonic
1081537765 11:44007706-44007728 CCTCAGGGAGGCTCCTCCTCTGG + Intergenic
1083694267 11:64432160-64432182 CCTTAGGTAGTCTCCTCCCCGGG + Intergenic
1084446680 11:69207681-69207703 CCTGTGGGAGTCACCTGCACAGG - Intergenic
1084948995 11:72654436-72654458 CCTGGGGGAGGCTCCTCCGCCGG + Intronic
1085252809 11:75154715-75154737 CCTGAGGGAGCTGGCTCTGCAGG + Intronic
1095427580 12:42093740-42093762 GCTGAGGGAGTTGCCTCAGCTGG + Intronic
1096649413 12:53054520-53054542 CCTGGCGGCCTCGCCTCCGCTGG - Intronic
1097186062 12:57197127-57197149 GCTGTGGGGGTCGCCGCCGCGGG - Exonic
1101050727 12:100861036-100861058 CCTGAGAGAGTTGCCGCTGCTGG + Intronic
1108590184 13:51906194-51906216 CCTCAGGGAGTCCCCTTAGCGGG - Intergenic
1116326811 14:43540802-43540824 CCTGAGGGAGGCCACTGCGCAGG - Intergenic
1131807739 15:96140513-96140535 CCTGAGGGAGTTGCCGCTACTGG + Intergenic
1132691489 16:1183627-1183649 CCTGAGTGCGGCGCCTCCCCCGG - Intronic
1140404669 16:74700766-74700788 CCTGAGGCAGTGGCCTCCGGAGG - Exonic
1141459845 16:84171645-84171667 TCTGAGCGAGTCGCCCCTGCTGG + Intronic
1152638611 17:81440282-81440304 CCAGAGGGAGTCCCCTGTGCTGG - Intronic
1152782385 17:82232034-82232056 ACTGAGGGAGGCCCCTCCCCCGG + Intronic
1153668514 18:7387895-7387917 CCTGAGAGGGTTGCCTCTGCTGG - Intergenic
1153906737 18:9668445-9668467 CCTGAGGGAGTTGCCGGGGCTGG - Intergenic
1160232484 18:77058508-77058530 CCTGTGGGCGTCGCATCAGCCGG - Intronic
1160562739 18:79770052-79770074 CCTGTGGGAGCCGCCTCACCTGG - Intergenic
1160780886 19:877612-877634 CCAGAGGGAGGCGCCCCCGGGGG - Intronic
1161169879 19:2807353-2807375 CCTGACGAAGTCGCGGCCGCGGG + Intronic
1163655192 19:18541805-18541827 CCTGAGTGAGCTGCCACCGCTGG - Exonic
1163804161 19:19386042-19386064 CCTGAGGGAGTCGCCTCCGCGGG + Exonic
1165481545 19:36067476-36067498 CCTGAGGGAGTCACCATCGGTGG + Intronic
929242422 2:39666172-39666194 GCTGCGGGACTCGCCCCCGCTGG + Exonic
929775787 2:44929729-44929751 CCTGAGTGAGGCTCCACCGCCGG - Intergenic
933684734 2:85133761-85133783 CCCGAGGTCGTCCCCTCCGCCGG - Exonic
935943907 2:108269220-108269242 CCTGAGGGAGACAGCTCTGCTGG - Intergenic
936154256 2:110037758-110037780 GCTGAGGGTGTGGCCTCAGCTGG + Intergenic
936190427 2:110333657-110333679 GCTGAGGGTGTGGCCTCAGCTGG - Intergenic
937047441 2:118859207-118859229 GCTGAGGCAGTCGCCTCTCCGGG + Intergenic
937221289 2:120344512-120344534 GCGGCGGGAGTCGCCTCTGCTGG + Intergenic
937877843 2:126838708-126838730 CCTGAGTTACTCGCCTCCCCTGG + Intergenic
948374440 2:237512173-237512195 CCTGGGGGAGACGCCTGGGCTGG - Intronic
1168895530 20:1321049-1321071 CCTGTGGGACACGCCTCCCCTGG + Intronic
1179428790 21:41304393-41304415 CCCGAGGGAGTCGCCCCCGAAGG + Intronic
1180220816 21:46356690-46356712 CCTGAAGGAGTAGCCTGGGCGGG + Intronic
1180740890 22:18052747-18052769 CCAGAGCGAGTTGCCTCTGCCGG + Intergenic
1180981045 22:19878157-19878179 CCTGAGGGAGCCCCCACAGCTGG - Exonic
1183806200 22:40213328-40213350 ACTGAGGGTGCCGCCTCCTCTGG - Intronic
1185366112 22:50437660-50437682 CCTCAGGGAGCTGCCTCCACGGG - Intronic
950614002 3:14145034-14145056 CCTGAGGGCTTTGCCTCAGCTGG - Intronic
952026348 3:29087453-29087475 CCTGAGGGAGTGGGATCTGCAGG - Intergenic
954929255 3:54266685-54266707 CCAGAGGGAGTGACCTCAGCAGG + Intronic
955422036 3:58748518-58748540 CCTGGGGGAGTCTTCTCTGCAGG - Intronic
968550847 4:1222756-1222778 CCTGAGGGCGGCGCCTTCCCAGG - Intronic
969568723 4:7995592-7995614 CCTGTGGGAGGAGCCTCAGCTGG + Intronic
979565796 4:122152694-122152716 TATGAAGGAGTCGCCGCCGCAGG - Intronic
981927457 4:150155571-150155593 CCTCAGGGAGTCCCCTCTGGAGG + Intronic
984699334 4:182808324-182808346 CCTGAGGGGGTCTCCCACGCTGG - Intergenic
985170971 4:187149819-187149841 CCTGAGGGAATCGGCTCTCCAGG - Intergenic
985646883 5:1089172-1089194 CCAGAGGGAGCCCCCTCCCCAGG + Intronic
987314210 5:16709293-16709315 CCTGAGGGTGTGCCCCCCGCAGG - Intronic
988177424 5:27744443-27744465 CCTGAGCGGGTCGCCACTGCTGG - Intergenic
995018563 5:107341560-107341582 CAGGAGGGAGACTCCTCCGCTGG - Intergenic
995583803 5:113625861-113625883 CCTGAGCGAGTTGCCACTGCTGG + Intergenic
1002468954 5:179423210-179423232 CCTGCAGGAGTCTCCTCAGCAGG + Intergenic
1002887871 6:1312176-1312198 CCTCGGGGACTCGCCTCCGCGGG + Intergenic
1005838203 6:29723599-29723621 ACTCAGGGAGCCGCCTCCGGAGG + Intronic
1006523597 6:34586412-34586434 CCTGAGGGAGAGGCCTTCTCAGG + Intergenic
1006606080 6:35259006-35259028 GGTGAGGGACTCGCCTCCGCAGG - Intronic
1010261181 6:73818859-73818881 CCTCAGGGAGTTGCCTAGGCTGG + Intronic
1013908212 6:115241115-115241137 CCTGAGCGAGTTGCCGCTGCTGG + Intergenic
1015517668 6:134100449-134100471 CCTGTAGGAGTAGCCTCTGCAGG + Intergenic
1018705579 6:166461333-166461355 CCTGAGGAAGTCTCCTGAGCTGG + Intronic
1019279745 7:193660-193682 CAGGAGGGAGGCGTCTCCGCCGG - Exonic
1019296947 7:282691-282713 CCTCAGGGAGTCTCCTGAGCCGG - Intergenic
1020213698 7:6173015-6173037 CTGGTGGGAGTCGCCTCAGCCGG - Intronic
1035731457 8:1856546-1856568 CCTGGGGAAGTCGCCTCCCGGGG - Intronic
1039454320 8:37697383-37697405 TTTGCGGGAGTCGCCGCCGCCGG - Exonic
1042020657 8:64369731-64369753 CCTGCGGAAGTCGGCTCCTCTGG - Intergenic
1046252019 8:111643796-111643818 CCTGAGGGGGTTGCCACTGCTGG - Intergenic
1057571023 9:96204309-96204331 CCTGAGGGAGATGCCTCCGGAGG + Intergenic
1060355612 9:122904920-122904942 CCAGAGAGAGGGGCCTCCGCAGG + Intronic
1061482595 9:130904310-130904332 CAGGAGGGAGTCGCCTGCGCAGG + Exonic
1185464458 X:346406-346428 CCTGCGGGAGGCGCCGCCCCAGG + Intronic