ID: 1163804426

View in Genome Browser
Species Human (GRCh38)
Location 19:19386979-19387001
Sequence AGGGGAGTCCCTTTCTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 1, 3: 89, 4: 344}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163804413_1163804426 7 Left 1163804413 19:19386949-19386971 CCCCTTCCTATCTGAGGACCCCC 0: 1
1: 0
2: 2
3: 33
4: 223
Right 1163804426 19:19386979-19387001 AGGGGAGTCCCTTTCTCTGAGGG 0: 1
1: 0
2: 1
3: 89
4: 344
1163804409_1163804426 19 Left 1163804409 19:19386937-19386959 CCTCCCTAGAGACCCCTTCCTAT 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1163804426 19:19386979-19387001 AGGGGAGTCCCTTTCTCTGAGGG 0: 1
1: 0
2: 1
3: 89
4: 344
1163804415_1163804426 5 Left 1163804415 19:19386951-19386973 CCTTCCTATCTGAGGACCCCCGC 0: 1
1: 0
2: 1
3: 11
4: 80
Right 1163804426 19:19386979-19387001 AGGGGAGTCCCTTTCTCTGAGGG 0: 1
1: 0
2: 1
3: 89
4: 344
1163804411_1163804426 15 Left 1163804411 19:19386941-19386963 CCTAGAGACCCCTTCCTATCTGA 0: 1
1: 0
2: 1
3: 13
4: 134
Right 1163804426 19:19386979-19387001 AGGGGAGTCCCTTTCTCTGAGGG 0: 1
1: 0
2: 1
3: 89
4: 344
1163804408_1163804426 23 Left 1163804408 19:19386933-19386955 CCTGCCTCCCTAGAGACCCCTTC 0: 1
1: 0
2: 1
3: 22
4: 283
Right 1163804426 19:19386979-19387001 AGGGGAGTCCCTTTCTCTGAGGG 0: 1
1: 0
2: 1
3: 89
4: 344
1163804416_1163804426 1 Left 1163804416 19:19386955-19386977 CCTATCTGAGGACCCCCGCCTCT 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1163804426 19:19386979-19387001 AGGGGAGTCCCTTTCTCTGAGGG 0: 1
1: 0
2: 1
3: 89
4: 344
1163804414_1163804426 6 Left 1163804414 19:19386950-19386972 CCCTTCCTATCTGAGGACCCCCG 0: 1
1: 0
2: 0
3: 61
4: 152
Right 1163804426 19:19386979-19387001 AGGGGAGTCCCTTTCTCTGAGGG 0: 1
1: 0
2: 1
3: 89
4: 344
1163804406_1163804426 25 Left 1163804406 19:19386931-19386953 CCCCTGCCTCCCTAGAGACCCCT 0: 1
1: 1
2: 3
3: 55
4: 354
Right 1163804426 19:19386979-19387001 AGGGGAGTCCCTTTCTCTGAGGG 0: 1
1: 0
2: 1
3: 89
4: 344
1163804407_1163804426 24 Left 1163804407 19:19386932-19386954 CCCTGCCTCCCTAGAGACCCCTT 0: 1
1: 0
2: 1
3: 32
4: 244
Right 1163804426 19:19386979-19387001 AGGGGAGTCCCTTTCTCTGAGGG 0: 1
1: 0
2: 1
3: 89
4: 344
1163804410_1163804426 16 Left 1163804410 19:19386940-19386962 CCCTAGAGACCCCTTCCTATCTG 0: 1
1: 0
2: 1
3: 12
4: 124
Right 1163804426 19:19386979-19387001 AGGGGAGTCCCTTTCTCTGAGGG 0: 1
1: 0
2: 1
3: 89
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163804426 Original CRISPR AGGGGAGTCCCTTTCTCTGA GGG Intronic
902459800 1:16565612-16565634 AGGTGAGTACCTTTCTATGAAGG - Exonic
902459986 1:16567158-16567180 TGGTGAGTACCTTTCTATGAAGG - Exonic
903152989 1:21426213-21426235 TGGTGAGTACCTTTCTATGAAGG - Intergenic
903160143 1:21481768-21481790 TGGTGAGTACCTTTCTATGAGGG + Exonic
905788410 1:40776254-40776276 AGGGGACTCTCATTCTCTGTAGG - Intergenic
906068068 1:42996443-42996465 AGGGCAGTCCCGCACTCTGATGG + Intergenic
906209241 1:44002992-44003014 AGGGGAGACTCTGTCACTGAGGG + Intronic
907023788 1:51095139-51095161 AGGGGAGCCCATTGCCCTGAAGG + Intergenic
908178573 1:61580737-61580759 AGGGTTGTCCTTTTCTCTGTTGG + Intergenic
908828853 1:68159491-68159513 AGGGGCCTCACTCTCTCTGAGGG + Intronic
910658577 1:89644515-89644537 AGTGGAGTCTCTTTCTGTCAAGG - Intronic
911019880 1:93375548-93375570 AGGGGAGTCCACTGCCCTGAAGG + Intergenic
912906601 1:113714388-113714410 AGGGGAGCCCGTTGCCCTGAAGG + Intronic
913605424 1:120461425-120461447 TGGTGAGTACCTTTCTATGAAGG + Intergenic
913605787 1:120464547-120464569 AGGTGAGTACCTTTCTATGAAGG + Intergenic
913642290 1:120824145-120824167 TGGTGAGTACCTTTCTATGAAGG + Exonic
913642467 1:120825685-120825707 TGGTGAGTACCTTTCTATGAAGG + Intronic
913642647 1:120827225-120827247 TGGTGAGTACCTTTCTATGAAGG + Intronic
913643206 1:120832159-120832181 AGGTGAGTACCTTTCTATGAAGG + Exonic
913643380 1:120833774-120833796 TGGTGAGTACCTTTCTATGAAGG + Intronic
913643507 1:120834801-120834823 AGGTGAGTACCTTTCTATGAAGG + Intronic
913643973 1:120838916-120838938 AGGTGAGTACCTTTCTATGAAGG + Intronic
913989575 1:143598333-143598355 TGGTGAGTACCTTTCTATGAAGG - Intergenic
914082761 1:144424669-144424691 AGGTGAGTACCTTTCTATGAAGG - Exonic
914083116 1:144427797-144427819 TGGTGAGTACCTTTCTATGAAGG - Exonic
914177675 1:145293183-145293205 AGGTGAGTACCTTTCTATGAAGG - Exonic
914178040 1:145296317-145296339 TGGTGAGTACCTTTCTATGAAGG - Exonic
914178220 1:145297941-145297963 AGGTGAGTACCTTTCTATGAAGG - Exonic
914178585 1:145301079-145301101 TGGTGAGTACCTTTCTATGAAGG - Exonic
914178765 1:145302703-145302725 AGGTGAGTACCTTTCTATGAAGG - Exonic
914179143 1:145305872-145305894 AGGTGAGTACCTTTCTATGAAGG - Exonic
914179519 1:145309055-145309077 AGGTGAGTACCTTTCTATGAAGG - Exonic
914179882 1:145312187-145312209 TGGTGAGTACCTTTCTATGAAGG - Exonic
914180063 1:145313811-145313833 AGGTGAGTACCTTTCTATGAAGG - Exonic
914180428 1:145316957-145316979 TGGTGAGTACCTTTCTATGAAGG - Exonic
914180608 1:145318583-145318605 AGGTGAGTACCTTTCTATGAAGG - Exonic
914180971 1:145321719-145321741 TGGTGAGTACCTTTCTATGAAGG - Exonic
914181151 1:145323345-145323367 AGGTGAGTACCTTTCTATGAAGG - Exonic
914181514 1:145326469-145326491 TGGTGAGTACCTTTCTATGAAGG - Exonic
914181694 1:145328093-145328115 AGGTGAGTACCTTTCTATGAAGG - Exonic
914182059 1:145331236-145331258 TGGTGAGTACCTTTCTATGAAGG - Exonic
914182239 1:145332860-145332882 AGGTGAGTACCTTTCTATGAAGG - Exonic
914182604 1:145335992-145336014 TGGTGAGTACCTTTCTATGAAGG - Exonic
914182784 1:145337616-145337638 AGGTGAGTACCTTTCTATGAAGG - Exonic
914183149 1:145340746-145340768 TGGTGAGTACCTTTCTATGAAGG - Exonic
914183329 1:145342366-145342388 AGGTGAGTACCTTTCTATGAAGG - Exonic
914183694 1:145345500-145345522 TGGTGAGTACCTTTCTATGAAGG - Exonic
914183873 1:145347124-145347146 AGGTGAGTACCTTTCTATGAAGG - Exonic
914184237 1:145350270-145350292 TGGTGAGTACCTTTCTATGAAGG - Exonic
914184417 1:145351896-145351918 AGGTGAGTACCTTTCTATGAAGG - Exonic
914184781 1:145355034-145355056 TGGTGAGTACCTTTCTATGAAGG - Exonic
914184961 1:145356658-145356680 AGGTGAGTACCTTTCTATGAAGG - Exonic
914185326 1:145359781-145359803 TGGTGAGTACCTTTCTATGAAGG - Exonic
914185506 1:145361405-145361427 AGGTGAGTACCTTTCTATGAAGG - Exonic
914185871 1:145364535-145364557 TGGTGAGTACCTTTCTATGAAGG - Exonic
914186052 1:145366159-145366181 AGGTGAGTACCTTTCTATGAAGG - Exonic
914186418 1:145369295-145369317 TGGTGAGTACCTTTCTATGAAGG - Exonic
914186598 1:145370919-145370941 AGGTGAGTACCTTTCTATGAAGG - Exonic
914186962 1:145374043-145374065 TGGTGAGTACCTTTCTATGAAGG - Exonic
914187142 1:145375667-145375689 AGGTGAGTACCTTTCTATGAAGG - Exonic
914187505 1:145378793-145378815 TGGTGAGTACCTTTCTATGAAGG - Exonic
914187685 1:145380419-145380441 AGGTGAGTACCTTTCTATGAAGG - Exonic
914188050 1:145383549-145383571 TGGTGAGTACCTTTCTATGAAGG - Exonic
914188230 1:145385173-145385195 AGGTGAGTACCTTTCTATGAAGG - Exonic
914188593 1:145388297-145388319 TGGTGAGTACCTTTCTATGAAGG - Exonic
914188773 1:145389923-145389945 AGGTGAGTACCTTTCTATGAAGG - Exonic
914189135 1:145393053-145393075 TGGTGAGTACCTTTCTATGAAGG - Exonic
914210633 1:145575626-145575648 AGGTGAGTACGTTTCTATGAAGG - Intergenic
914210988 1:145578762-145578784 TGGTGAGTACCTTTCTATGAAGG - Intergenic
914269749 1:146069522-146069544 TGGTGAGTACCTTTCTATGAAGG - Exonic
914269925 1:146071126-146071148 AGGTGAGTACCTTTCTATGAAGG - Exonic
914270289 1:146074250-146074272 TGGTGAGTACCTTTCTATGAAGG - Exonic
914270466 1:146075848-146075870 AGGTGAGTACCTTTCTATGAAGG - Exonic
914270826 1:146078986-146079008 TGGTGAGTACCTTTCTATGAAGG - Exonic
914271002 1:146080584-146080606 AGGTGAGTACCTTTCTATGAAGG - Exonic
914271363 1:146083716-146083738 TGGTGAGTACCTTTCTATGAAGG - Exonic
914271540 1:146085320-146085342 AGGTGAGTACCTTTCTATGAAGG - Exonic
914271898 1:146088443-146088465 TGGTGAGTACCTTTCTATGAAGG - Exonic
914272075 1:146090041-146090063 AGGTGAGTACCTTTCTATGAAGG - Exonic
914272435 1:146093161-146093183 TGGTGAGTACCTTTCTATGAAGG - Exonic
914272611 1:146094759-146094781 AGGTGAGTACCTTTCTATGAAGG - Exonic
914272973 1:146097883-146097905 TGGTGAGTACCTTTCTATGAAGG - Exonic
914273149 1:146099481-146099503 AGGTGAGTACCTTTCTATGAAGG - Exonic
914273511 1:146102605-146102627 TGGTGAGTACCTTTCTATGAAGG - Exonic
914273688 1:146104203-146104225 AGGTGAGTACCTTTCTATGAAGG - Exonic
914274050 1:146107323-146107345 TGGTGAGTACCTTTCTATGAAGG - Exonic
914274226 1:146108921-146108943 AGGTGAGTACCTTTCTATGAAGG - Exonic
914274588 1:146112033-146112055 TGGTGAGTACCTTTCTATGAAGG - Intronic
914274762 1:146113631-146113653 AGGTGAGTACCTTTCTATGAAGG - Exonic
914275121 1:146116751-146116773 TGGTGAGTACCTTTCTATGAAGG - Intronic
914275295 1:146118349-146118371 AGGTGAGTACCTTTCTATGAAGG - Exonic
914275658 1:146121477-146121499 TGGTGAGTACCTTTCTATGAAGG - Exonic
914275831 1:146123085-146123107 AGGTGAGTACCTTTCTATGAAGG - Exonic
914276188 1:146126215-146126237 TGGTGAGTACCTTTCTATGAAGG - Exonic
914366632 1:146984984-146985006 TGGTGAGTACCTTTCTATGAAGG + Exonic
914366997 1:146988125-146988147 AGGTGAGTACGTTTCTATGAAGG + Exonic
914367168 1:146989745-146989767 TGGTGAGTACCTTTCTATGAAGG + Exonic
914367533 1:146992883-146992905 AGGTGAGTACGTTTCTATGAAGG + Exonic
914485451 1:148105339-148105361 AGGTGAGTACCTTTCTATGAAGG - Exonic
914485813 1:148108461-148108483 TGGTGAGTACCTTTCTATGAAGG - Exonic
914532586 1:148536203-148536225 TGGTGAGTACCTTTCTATGAAGG - Exonic
914532763 1:148537813-148537835 AGGTGAGTACCTTTCTATGAAGG - Exonic
914533121 1:148540929-148540951 TGGTGAGTACCTTTCTATGAAGG - Exonic
914533298 1:148542533-148542555 AGGTGAGTACCTTTCTATGAAGG - Exonic
914533656 1:148545643-148545665 TGGTGAGTACCTTTCTATGAAGG - Exonic
914533833 1:148547247-148547269 AGGTGAGTACCTTTCTATGAAGG - Exonic
914534192 1:148550351-148550373 TGGTGAGTACCTTTCTATGAAGG - Exonic
914534369 1:148551955-148551977 AGGTGAGTACCTTTCTATGAAGG - Exonic
914534728 1:148555059-148555081 TGGTGAGTACCTTTCTATGAAGG - Exonic
914534905 1:148556669-148556691 AGGTGAGTACCTTTCTATGAAGG - Exonic
914535265 1:148559772-148559794 TGGTGAGTACCTTTCTATGAAGG - Exonic
914535440 1:148561386-148561408 AGGTGAGTACCTTTCTATGAAGG - Exonic
914535800 1:148564518-148564540 TGGTGAGTACCTTTCTATGAAGG - Exonic
914535977 1:148566122-148566144 AGGTGAGTACCTTTCTATGAAGG - Exonic
914536336 1:148569234-148569256 TGGTGAGTACCTTTCTATGAAGG - Exonic
914536511 1:148570844-148570866 AGGTGAGTACCTTTCTATGAAGG - Exonic
914536872 1:148574032-148574054 AGGTGAGTACCTTTCTATGAAGG - Exonic
914537232 1:148577162-148577184 TGGTGAGTACCTTTCTATGAAGG - Exonic
914585417 1:149057314-149057336 AGGTGAGTACCTTTCTATGAAGG - Exonic
914585783 1:149060502-149060524 AGGTGAGTACCTTTCTATGAAGG - Exonic
914586146 1:149063612-149063634 TGGTGAGTACCTTTCTATGAAGG - Exonic
914628692 1:149488184-149488206 TGGTGAGTACCTTTCTATGAAGG + Intergenic
914629051 1:149491310-149491332 AGGTGAGTACCTTTCTATGAAGG + Intergenic
914629225 1:149492939-149492961 TGGTGAGTACCTTTCTATGAAGG + Intergenic
914629584 1:149496073-149496095 AGGTGAGTACCTTTCTATGAAGG + Intergenic
914629758 1:149497696-149497718 TGGTGAGTACCTTTCTATGAAGG + Intergenic
914630119 1:149500828-149500850 AGGTGAGTACCTTTCTATGAAGG + Intergenic
914630293 1:149502457-149502479 TGGTGAGTACCTTTCTATGAAGG + Intergenic
914630653 1:149505589-149505611 AGGTGAGTACCTTTCTATGAAGG + Intergenic
914630827 1:149507218-149507240 TGGTGAGTACCTTTCTATGAAGG + Intergenic
914631184 1:149510350-149510372 AGGTGAGTACCTTTCTATGAAGG + Intergenic
914631358 1:149511979-149512001 TGGTGAGTACCTTTCTATGAAGG + Intergenic
914631716 1:149515107-149515129 AGGTGAGTACCTTTCTATGAAGG + Intergenic
914631890 1:149516735-149516757 TGGTGAGTACCTTTCTATGAAGG + Intergenic
914632252 1:149519859-149519881 AGGTGAGTACCTTTCTATGAAGG + Intergenic
914632426 1:149521490-149521512 TGGTGAGTACCTTTCTATGAAGG + Intergenic
914632789 1:149524616-149524638 AGGTGAGTACCTTTCTATGAAGG + Intergenic
914632961 1:149526241-149526263 TGGTGAGTACCTTTCTATGAAGG + Intergenic
914633323 1:149529345-149529367 AGGTGAGTACCTTTCTATGAAGG + Intergenic
914633496 1:149530970-149530992 TGGTGAGTACCTTTCTATGAAGG + Intergenic
914633859 1:149534096-149534118 AGGTGAGTACCTTTCTATGAAGG + Intergenic
914634032 1:149535725-149535747 TGGTGAGTACCTTTCTATGAAGG + Intergenic
914634395 1:149538847-149538869 AGGTGAGTACCTTTCTATGAAGG + Intergenic
914634565 1:149540472-149540494 TGGTGAGTACCTTTCTATGAAGG + Intergenic
914634928 1:149543584-149543606 AGGTGAGTACCTTTCTATGAAGG + Intergenic
914635100 1:149545209-149545231 TGGTGAGTACCTTTCTATGAAGG + Intergenic
914635463 1:149548321-149548343 AGGTGAGTACCTTTCTATGAAGG + Intergenic
914635635 1:149549946-149549968 TGGTGAGTACCTTTCTATGAAGG + Intergenic
914635998 1:149553058-149553080 AGGTGAGTACCTTTCTATGAAGG + Intergenic
915186020 1:154105792-154105814 AGGGGAGCCCACTTCACTGAAGG + Intronic
915585202 1:156840586-156840608 AGTGGGGTCCCTACCTCTGAGGG + Exonic
917226381 1:172788366-172788388 AGGGGAGCCCACTGCTCTGAAGG - Intergenic
918100197 1:181366103-181366125 AGGGGAGTCCTGTTCTCTGGAGG - Intergenic
918569196 1:185967906-185967928 ATGGAATTCCTTTTCTCTGATGG - Intronic
918752702 1:188292639-188292661 AGGGGAGCCCACTTCCCTGAAGG + Intergenic
919251852 1:195066291-195066313 AGGGGAGTCCAGTACCCTGAGGG + Intergenic
919272086 1:195360705-195360727 AGGGGAGCCCATTCCCCTGAAGG + Intergenic
919514879 1:198510797-198510819 ATGGGAGTCCACTTCCCTGAAGG - Intergenic
921746273 1:218743644-218743666 AGGGGAGTCCACTTCCTTGAAGG + Intergenic
921769780 1:219022398-219022420 AAGGGAGCCCACTTCTCTGAAGG + Intergenic
922358079 1:224795564-224795586 AGGGGAGTCCACTACCCTGAAGG - Intergenic
922885860 1:229019978-229020000 GGGGGAGTGCCTTAGTCTGAGGG - Intergenic
1063161615 10:3422699-3422721 AGGAGAGTCCCTTTATCTAGGGG - Intergenic
1063532906 10:6852943-6852965 AGGGGAATCCCTTTCCTTGTAGG + Intergenic
1064327727 10:14366386-14366408 AGGGGTGTCCCTTTCTTTATAGG - Intronic
1064931917 10:20637985-20638007 AGGTCAGTCATTTTCTCTGAAGG + Intergenic
1065142236 10:22728920-22728942 AGGTGAGTCCCTTCCACTGACGG + Intergenic
1065940806 10:30562569-30562591 ATGGGAGCCCCTTTATCTCAAGG + Intergenic
1069021206 10:63490323-63490345 TGAGGAGTCACTTTCTGTGAGGG - Intergenic
1069626330 10:69869839-69869861 AGGGATGTATCTTTCTCTGAAGG + Intronic
1069826390 10:71257484-71257506 AGGGGAGCCCATTTCACAGATGG - Intronic
1070289412 10:75104862-75104884 AGAGCAGTTCCTGTCTCTGAAGG - Intronic
1072898540 10:99387896-99387918 AGTGGAGTCCCCGTCTGTGAAGG - Exonic
1074493434 10:113958713-113958735 AGGCCAGCCCCCTTCTCTGAAGG - Intergenic
1076094637 10:127721104-127721126 AGGGGAGTCCACTGCCCTGAAGG + Intergenic
1077241713 11:1514029-1514051 AGGAGACTCCCATTCTCTGCTGG + Intergenic
1077444797 11:2585941-2585963 AGAGCAGTCCCATTCTCTGGTGG - Intronic
1077560164 11:3255465-3255487 AGGAGAGTCCATTTATCTGAGGG + Intergenic
1077566057 11:3301268-3301290 AGGAGAGTCCATTTATCTGAGGG + Intergenic
1077835517 11:5923607-5923629 AGGGGAGCCCCCTGCCCTGAAGG + Intronic
1079069218 11:17328688-17328710 AGGGGAGCCCACTTCCCTGAAGG - Intronic
1079324293 11:19478293-19478315 AGGGGAGTCCCAGTCACTGAGGG + Intronic
1079530526 11:21447160-21447182 AGGGGAGCCCACTGCTCTGAAGG - Intronic
1080229475 11:30002768-30002790 ACATGAGTCCCTTACTCTGAAGG + Intergenic
1083322839 11:61857727-61857749 AGTGGACTCCCTATGTCTGAGGG - Intronic
1085572098 11:77568681-77568703 AGGGGAGTCCTTTTCCCTGAAGG - Intronic
1085804515 11:79622672-79622694 AGGGGAGCATATTTCTCTGAAGG + Intergenic
1086193646 11:84110655-84110677 AGGTGGGGCCTTTTCTCTGATGG - Intronic
1087380429 11:97398528-97398550 AGAGGAGCCCGTTTCCCTGATGG - Intergenic
1087402368 11:97684024-97684046 AGGGGAGACCATTTCCCTGAAGG - Intergenic
1087691015 11:101320670-101320692 AGGGGAGCCTCTTGCCCTGAAGG - Intergenic
1087720950 11:101664996-101665018 AGGGGAGTTCATTTCCTTGAAGG - Intronic
1088087523 11:105999245-105999267 AGAGGAGGCCTTTTCTCTTACGG + Intronic
1088448361 11:109955631-109955653 AGGGGTGTCCTTTTCTCTCAAGG - Intergenic
1093931832 12:24961579-24961601 AGGGGAGCCCGCTTCCCTGAAGG + Intergenic
1094658168 12:32441034-32441056 AGGGGAGCCCACTTCCCTGAAGG - Intronic
1094845271 12:34358749-34358771 AGGGGAGGCACTTTCTCCCATGG + Intergenic
1096023390 12:48340614-48340636 GGGGAACTCCCTTTCTTTGAAGG + Exonic
1096827668 12:54292307-54292329 TGGGGAGTACCTTTATCAGAAGG + Exonic
1096970250 12:55659767-55659789 AGGGGAGGCCCTGGCACTGAGGG + Intergenic
1101496491 12:105259395-105259417 AGGAGAGACCCTTCCTCTGTCGG - Intronic
1104726398 12:131078142-131078164 AGCAGAGACGCTTTCTCTGACGG - Intronic
1105730143 13:23205674-23205696 AGCTGAGTCCATTTCACTGATGG + Intronic
1105815343 13:24031170-24031192 AGGGGAGGCCCTTTCATGGATGG + Intronic
1106871970 13:34031394-34031416 TGGGGAGTCCCTGTATCTGGAGG - Intergenic
1107840136 13:44449266-44449288 TGGTGAGCCCCTTTCTCTGTCGG - Intronic
1113037878 13:106070984-106071006 AAGTGAGTGGCTTTCTCTGAGGG + Intergenic
1113834981 13:113322774-113322796 GGGGGTGCCGCTTTCTCTGAGGG + Exonic
1114248092 14:20933589-20933611 AGGGGAATCCACTTCCCTGAAGG + Intergenic
1115320529 14:32076166-32076188 AGAGGAGTCCATTTCTCCGTCGG - Intronic
1115731268 14:36272224-36272246 AGAGGAATCCCTTTCCCAGAAGG - Intergenic
1116354853 14:43914928-43914950 AGGGGAGTCCACTGCCCTGAAGG + Intergenic
1116458423 14:45144726-45144748 AGGGGAACCCACTTCTCTGAAGG - Intronic
1117234006 14:53752482-53752504 CGGGGAGTCCAGTTCCCTGAAGG + Intergenic
1117264899 14:54076689-54076711 AGGGGAGACCACTTCCCTGAAGG - Intergenic
1117418391 14:55519195-55519217 AGGGGAGCCCATTGCTCTGCAGG + Intergenic
1119092275 14:71795754-71795776 AAGGAAGTCCCTTTCTGTCAAGG - Intergenic
1119541131 14:75438878-75438900 AGGGCTGGCCGTTTCTCTGAAGG + Intronic
1121845424 14:97168352-97168374 AGGGGGATCCCCTGCTCTGAAGG - Intergenic
1122102515 14:99424661-99424683 AGGGGGGTCCCTTCCTCAGAGGG + Intronic
1122830218 14:104392323-104392345 ATGGGAATCCCTGTCTCAGATGG + Intergenic
1124989595 15:34658414-34658436 AGGTGAGTCTCTTTCTATTAAGG + Intergenic
1127094345 15:55497715-55497737 GTGGGAGACCCTTTCTGTGACGG - Exonic
1128412549 15:67414065-67414087 ATGGGATTCCCTGCCTCTGAAGG - Intronic
1129181916 15:73883057-73883079 AAAGGAGTCCGTTCCTCTGATGG - Intronic
1129229893 15:74191277-74191299 AGGGGAAGCCCATTCCCTGAGGG + Intronic
1129413144 15:75360835-75360857 AGGAGAGCCTCTCTCTCTGATGG + Intronic
1129642424 15:77393885-77393907 AGGGGAGCCCACTGCTCTGAAGG + Intronic
1129876881 15:78981371-78981393 AGGGAAGGCCCTTTCCCTCAGGG + Intronic
1131950145 15:97673131-97673153 AGGGGAGTCCACTGCACTGAAGG - Intergenic
1132646623 16:1002209-1002231 TGGACAGTCCCTTGCTCTGAGGG + Intergenic
1132700664 16:1220761-1220783 AGTGGAGACCCTTTCTTGGACGG + Exonic
1134185228 16:12079758-12079780 GGAGGAGTCCCGGTCTCTGATGG - Intronic
1135884801 16:26296034-26296056 AGGGAAGTCCCTATATCAGAGGG - Intergenic
1138180216 16:54936222-54936244 AGGCCAGTCCCCTTCTCTTAAGG + Intergenic
1140646605 16:77038244-77038266 AGGGGAGCCCACTGCTCTGAAGG - Intergenic
1141412504 16:83845187-83845209 AGGGGAGGACACTTCTCTGAAGG - Intergenic
1141664176 16:85457400-85457422 AGGGGAGAGGCTGTCTCTGATGG + Intergenic
1143491439 17:7287444-7287466 AGGTGAGTCCTTTTCCCTGCAGG - Exonic
1143773292 17:9181791-9181813 AAGTGAGTCCCTTCCTCTTAGGG + Intronic
1145826343 17:27879903-27879925 GGGGGACTCCCTGTCTCTGGGGG - Intronic
1148993713 17:51689095-51689117 AGGGTGCTCCCTTTCTCTGAGGG - Intronic
1149231296 17:54537219-54537241 AGGGGAGTCCACTGCCCTGAAGG + Intergenic
1150418069 17:65003499-65003521 AAGGAATTGCCTTTCTCTGAAGG + Intergenic
1150793612 17:68220716-68220738 AAGGAATTGCCTTTCTCTGAAGG - Intergenic
1150871045 17:68911194-68911216 AGGGGAGCCCATTGCCCTGAAGG + Intronic
1151141872 17:72000906-72000928 AGGGAAGTCAGCTTCTCTGAAGG + Intergenic
1151454000 17:74215334-74215356 AGGGGACTCCCTCACCCTGATGG + Intronic
1155207563 18:23574260-23574282 AGGTCAGTGCCTTGCTCTGAAGG + Intronic
1159865762 18:73702890-73702912 AGGGCAGGCCTTTACTCTGAAGG + Intergenic
1161056605 19:2193825-2193847 CAGGGCGTCACTTTCTCTGATGG - Intronic
1162788371 19:13050412-13050434 AGGCCAGTCCCTCCCTCTGAGGG + Intronic
1163804426 19:19386979-19387001 AGGGGAGTCCCTTTCTCTGAGGG + Intronic
1164574330 19:29396897-29396919 AGGGGAGTGCCCTGCCCTGAGGG + Intergenic
1165532306 19:36414258-36414280 ATAGCAGTCCCTTTCTCTAAAGG + Intronic
1166296009 19:41889861-41889883 AGGGGACTCCCTTGCTCAGAGGG - Intronic
1202676044 1_KI270711v1_random:7796-7818 AGGTGAGTACCTTTCTATGAAGG - Intergenic
1202676417 1_KI270711v1_random:10890-10912 TGGTGAGTACCTTTCTATGAAGG - Intergenic
925831966 2:7904518-7904540 AGTGGAGTGCCTTTCCCTGCTGG + Intergenic
926670947 2:15576371-15576393 AGGGAAGTCCCTGTCTCTCTAGG + Intergenic
927423432 2:22956027-22956049 AGGGGCGTTCCTTTGTCTCAGGG + Intergenic
927570244 2:24153079-24153101 ATGGGAGTCCATTGCCCTGAAGG - Intronic
927910929 2:26899092-26899114 AGGGGAGTGGGTTTGTCTGATGG + Intronic
929513488 2:42584864-42584886 AAGGGAGACCCTTTCTCTTGGGG + Intronic
931230070 2:60366562-60366584 AGGGGATACCCTGTCTCTGCTGG - Intergenic
932387009 2:71344263-71344285 AGTAGTGTCCCTTTTTCTGAGGG + Intronic
932722161 2:74146293-74146315 AGGGGAGCCCATGTTTCTGATGG + Intronic
933749492 2:85594045-85594067 AGGGGAAACCATTTATCTGAAGG - Intergenic
934708930 2:96502918-96502940 AGGGGTTCCCCTTTCTCTGTAGG - Intronic
934766213 2:96881536-96881558 GGGGGAGTCTCTTTGTCTGGAGG + Intronic
935532706 2:104254099-104254121 AGGGGAGCCCACTTCCCTGAAGG + Intergenic
935924374 2:108051612-108051634 AGAGGACTTCCTTTCTTTGAAGG + Intergenic
936529040 2:113262372-113262394 GGGGGAGTCCCCTCCTCTGTTGG + Intronic
937356889 2:121203292-121203314 AGGGCAGGTCCTTCCTCTGAAGG + Intergenic
939443176 2:142275815-142275837 AGGGGAGCCCATTGCCCTGAAGG - Intergenic
939707896 2:145478280-145478302 AGGAGAGCCCATTTCCCTGAAGG - Intergenic
941005104 2:160239853-160239875 AGGTGGGCCCCTTTCTCGGAGGG - Intronic
941678634 2:168371360-168371382 AGGGGAGCCCATTGCCCTGAAGG + Intergenic
941742250 2:169047302-169047324 AGGGGAGCCCATTGCTCTGAAGG + Intergenic
942814272 2:180033757-180033779 AGGGGAGCCCACTTCCCTGAAGG - Intergenic
944508503 2:200440543-200440565 AGATGAGTCCCTTTTTCTGGTGG + Intronic
945189962 2:207177839-207177861 AGGGGCTTCCCTTACCCTGAGGG - Intergenic
945257457 2:207814150-207814172 AGGGGAGTCACTGTGTGTGAAGG - Intergenic
945551772 2:211229349-211229371 AGGGGAGCCCACTGCTCTGAAGG + Intergenic
1169951242 20:11045776-11045798 AGGGTTGTCCCTTTCTCCGTTGG + Intergenic
1170714162 20:18817641-18817663 ATGTGAGTCCCTTTCTCCGCTGG + Intronic
1172417483 20:34782742-34782764 TGGGGAGCCCCTTGCTCTGTGGG - Intronic
1174003641 20:47392968-47392990 AGGGCTTTCCCTTTCTCTGTGGG + Intergenic
1174370703 20:50085492-50085514 AGGGGAGCCCCTGCCTTTGAGGG - Intronic
1174684319 20:52438926-52438948 AGGAGAATCTCTTTATCTGATGG - Intergenic
1174745092 20:53053885-53053907 AGGGTAGCCCCTTCCTCTCATGG - Intronic
1175917218 20:62432182-62432204 AGGCGAGTCCCTTACTCTTGGGG + Intergenic
1176254851 20:64146578-64146600 CGGGGAGTGCCTTTCTCTGCTGG + Intergenic
1178673360 21:34611910-34611932 AAGGGAGTCCCAGTCTCTGAGGG - Intronic
1179681907 21:43028202-43028224 GTGGCAGTCCCATTCTCTGATGG + Intronic
1182280350 22:29214742-29214764 GGGGGAGTCCCTGTGGCTGAGGG - Intronic
1182749310 22:32628881-32628903 AGTGGGGGCCTTTTCTCTGAAGG + Intronic
1182768972 22:32779978-32780000 AGGGCAGGCCATTTCTCTGTGGG - Intronic
1184774845 22:46618008-46618030 ATGGGTGTCCCTTTCTCTTGAGG + Intronic
949235674 3:1805961-1805983 AGCGGAGCCCATTTCTCTGAAGG - Intergenic
952132785 3:30384291-30384313 AGGGGAGTCCACTGCCCTGAAGG - Intergenic
952203106 3:31151523-31151545 AGGGGAGTGCACTGCTCTGAAGG - Intergenic
954775905 3:53018374-53018396 AGGGATTTTCCTTTCTCTGAAGG - Intronic
956403712 3:68906482-68906504 TAGGGAGTCCCTGTCTCAGAAGG - Intronic
956452741 3:69390528-69390550 AGGAGAGTCCTTTGCTCTGGGGG - Intronic
956476147 3:69622003-69622025 AGGGGAGCCCATTTCCCTGAAGG + Intergenic
958099407 3:88989443-88989465 ATGGGAGGCCCCTTCCCTGAAGG + Intergenic
958150837 3:89692641-89692663 AGGGGAGCATCTTTCTCAGATGG + Intergenic
959525000 3:107366969-107366991 AAGGCATTCCCTTCCTCTGAGGG + Intergenic
959913694 3:111793421-111793443 AGGGGAGTCCACTGCCCTGAAGG - Intronic
959985029 3:112562362-112562384 AGGGTAGTCCCTGACTGTGAAGG + Intronic
960308461 3:116091072-116091094 AGGGGCGTACCTGTCTCTTATGG - Intronic
961684694 3:128621574-128621596 AGGGGAGTCAGTGACTCTGAGGG + Intronic
962406053 3:135101040-135101062 AAGGGAACCCCTTTCTCTTAAGG + Intronic
962862606 3:139418750-139418772 AAGGGAGCCCATTGCTCTGAAGG - Intergenic
962998389 3:140653207-140653229 AGGGGAGCCCAATTCTCTGAAGG + Intergenic
963691639 3:148511134-148511156 AGGTGGGTTCCTTTCTCTGGTGG + Intergenic
963765048 3:149325798-149325820 AGGGAAGTCCCTTGCCCTGAAGG - Intronic
965091138 3:164163643-164163665 AGGGGAGTCCCAGTCCCTCATGG + Intergenic
967863035 3:194167147-194167169 TGTAGAGTCCCTTTCTCTCATGG + Intergenic
968273025 3:197419262-197419284 AGGGGAGACCCTGTTTCTCATGG + Intergenic
969253253 4:5984083-5984105 AGGTGAGGCCCTTGCTCTTAGGG - Intronic
969320390 4:6408831-6408853 AGGGGTGTCACTGTCTCAGAGGG + Intronic
975823216 4:78292705-78292727 AGGGGCCCCCCTTTCTCTGTTGG + Intronic
976011971 4:80500252-80500274 AGGAGAATGCCTTTCTCTGATGG - Intronic
978261758 4:106768413-106768435 AGGGGAGTCCATTCCTTTGAAGG + Intergenic
978431250 4:108635230-108635252 AGGAGAGGCCCCTTGTCTGAGGG - Intergenic
979413495 4:120407036-120407058 AGGGGAGCCCATTGCCCTGATGG + Intergenic
982683353 4:158459052-158459074 AGGGGAGCCCACTTCCCTGAAGG - Intronic
983263747 4:165486054-165486076 AGGCTGGTCCCTTTCTCTCAAGG - Intronic
983421707 4:167526837-167526859 AGCGGAGTCCACTGCTCTGAAGG - Intergenic
984311846 4:178070794-178070816 GGGGAAGTCCACTTCTCTGAAGG + Intergenic
985728098 5:1526191-1526213 AGAGGAGTCCCTCTCCCAGAGGG + Intergenic
985849006 5:2374854-2374876 AGGGGAGCCGCTCTCTCTGCAGG + Intergenic
986290522 5:6395879-6395901 AGGTCAGTCTTTTTCTCTGAAGG + Intergenic
986885215 5:12225925-12225947 AGGGGAGCCCACTTCCCTGAAGG - Intergenic
987136504 5:14904461-14904483 AGGGGCCTTCTTTTCTCTGATGG + Intergenic
987645902 5:20672147-20672169 AGGGGAGTCCAATGCCCTGAAGG + Intergenic
988299425 5:29403631-29403653 AGGAGAGTCCACTTCCCTGAAGG + Intergenic
988531798 5:32034289-32034311 CAGGGAATCCCTTACTCTGAAGG + Intronic
989434188 5:41391809-41391831 ACGGGAGACCATTTCCCTGAAGG + Intronic
990039339 5:51360708-51360730 GGTAGAGTCCCTTTCTCTGAGGG + Intergenic
990226200 5:53657435-53657457 TGGGGAGTACCTCTCACTGACGG - Intronic
992284983 5:75225917-75225939 AGGGGAGCCCACTGCTCTGAAGG + Intronic
993197221 5:84764547-84764569 AGGGGAGGCCATTGCCCTGAAGG - Intergenic
994616150 5:102107180-102107202 AGGGGAGCCCATTGCTCTCAAGG - Intergenic
995326460 5:110894413-110894435 GTGGGAGCCCCTTTCTCTGCTGG - Intergenic
996833593 5:127767026-127767048 AGGAGTCTCCCTTTCTCTCAAGG - Intergenic
997640528 5:135445816-135445838 AGGGGAGCCCGTGTCTCTCACGG + Exonic
998716422 5:144889683-144889705 AGGGGAGCCCACTGCTCTGAAGG + Intergenic
999481966 5:151956848-151956870 AGGTGGGTCCCTTTCTTTAAAGG + Intergenic
1000454953 5:161437656-161437678 AGGGGAGTCCACTACCCTGAAGG + Intronic
1000677830 5:164143685-164143707 AGTGGAGTTCCTTTCTTTGGAGG - Intergenic
1004523954 6:16388434-16388456 AGGAGAGTCCATATGTCTGATGG - Intronic
1006257938 6:32845804-32845826 AGGGTAGTCCCCGGCTCTGACGG - Intronic
1006520592 6:34568873-34568895 GGGGGAGACAGTTTCTCTGAGGG + Intergenic
1006720460 6:36146776-36146798 AGGGGTGCCACTTCCTCTGATGG - Intergenic
1007363698 6:41375406-41375428 AGGGGAGACGCTTTGTCTGCAGG - Intergenic
1010343239 6:74781694-74781716 AGGGGAGCCCACTTCCCTGAAGG + Intergenic
1012175428 6:96076077-96076099 AGGGCAGTCAGTTTCTCTGTGGG + Intronic
1012714306 6:102649128-102649150 AGGGGAGCCCACCTCTCTGAAGG + Intergenic
1012836978 6:104281443-104281465 AGTGGAGGGGCTTTCTCTGATGG - Intergenic
1013687481 6:112601794-112601816 AGGGGAGCTCATTTCCCTGAAGG + Intergenic
1014865226 6:126521146-126521168 AGGGGAGCCCACTTCCCTGAAGG - Intergenic
1015769645 6:136755344-136755366 AGAGGAGACCCTGTGTCTGAGGG - Intronic
1016185705 6:141195849-141195871 AGGGGAGCCCACTCCTCTGAAGG - Intergenic
1016883146 6:148931060-148931082 AGGGCAGTCTCTTCTTCTGAGGG + Intronic
1020135802 7:5587222-5587244 AGGTGAGTTCCTGTCTTTGAAGG + Intergenic
1020574793 7:9913059-9913081 AGGGGAGCCCGCTTCCCTGAAGG - Intergenic
1020637882 7:10718224-10718246 AGTTGAGTCCCTTTGTGTGAAGG - Intergenic
1021130987 7:16913035-16913057 AGGGGAGCCCATTGCCCTGAAGG - Intergenic
1021214576 7:17900696-17900718 AGGGGAGCCCATTGCCCTGAAGG - Intronic
1021274456 7:18632453-18632475 TGGGTGTTCCCTTTCTCTGAGGG + Intronic
1028266547 7:88733384-88733406 AGGGGAGCCCACTTCCCTGAAGG - Intergenic
1032854492 7:135823075-135823097 AGGGGAGAGCCATTCTCTGTGGG - Intergenic
1034003413 7:147442394-147442416 AGGGGAGCCCACTTCCCTGAAGG - Intronic
1034672225 7:152867416-152867438 AGGAGAGCACCGTTCTCTGATGG + Intergenic
1036727709 8:11234259-11234281 TGGAGAGTTCCTATCTCTGATGG + Intergenic
1036731704 8:11271346-11271368 AGAGGAGTTCCTTGCTCTGCTGG - Intergenic
1038871861 8:31503902-31503924 AGTGGAGTCCACTGCTCTGAAGG - Intergenic
1040745402 8:50635682-50635704 AGGGGAGCCCACTTCCCTGAAGG - Intronic
1041016236 8:53595098-53595120 GGGGCAGGCCCTCTCTCTGATGG - Intergenic
1041582856 8:59482994-59483016 AGGGGAGCCCACTCCTCTGAAGG - Intergenic
1041691630 8:60693404-60693426 AGGGGGGACCCTCTCTCTGCAGG - Intronic
1047536586 8:125725647-125725669 AGGGCAGTCCCTGGCTCTGAAGG - Intergenic
1050145227 9:2560272-2560294 AGGGAAGCCCCCTTCCCTGAAGG + Intergenic
1050238747 9:3612413-3612435 AGGGGATCCCATTTCCCTGAAGG - Intergenic
1050238796 9:3612721-3612743 AGGGGAGCCCACTTCCCTGAAGG - Intergenic
1055030846 9:71769919-71769941 AGGGGATTCCCCTTCACTGCCGG - Intronic
1056211232 9:84367278-84367300 AGGGGAGCCCATTGCCCTGAAGG - Intergenic
1057146727 9:92764028-92764050 AGGGGAAGTGCTTTCTCTGAAGG + Intronic
1061656673 9:132097247-132097269 AGGAGAGTCACTTTATCTAAAGG + Intergenic
1062378608 9:136276152-136276174 GGGGGAGCCCCTGTCTCTGCAGG - Intergenic
1186348930 X:8723650-8723672 AGGGGAGACATTTTCCCTGATGG - Intronic
1186821040 X:13288328-13288350 AGGAATGTCCCTATCTCTGAAGG - Intergenic
1188068854 X:25695130-25695152 AGGGGAGTCCACTGCCCTGAAGG - Intergenic
1188105487 X:26143255-26143277 AGGCTAGTCCCTTTCACTTATGG + Intergenic
1190386761 X:49889202-49889224 AGGGGAGTCAATCTGTCTGAGGG - Intergenic
1192020437 X:67385406-67385428 AGGGGAGCTCATTGCTCTGAAGG + Intergenic
1192826701 X:74704607-74704629 AGGGGAGCCCACTTCCCTGAAGG - Intergenic
1192855942 X:75011879-75011901 AGAGGAGTCCAATTCCCTGAAGG - Intergenic
1192941073 X:75912253-75912275 AGGGGAGCCCAGTTCCCTGAAGG - Intergenic
1192977984 X:76306634-76306656 AAGGGAGCCCATTTCACTGAAGG - Intergenic
1193088423 X:77468311-77468333 AGAGGAGCCCATTTCCCTGAAGG + Intergenic
1193191717 X:78579014-78579036 AGTGGAGCCCATTTCCCTGAAGG + Intergenic
1193983895 X:88217367-88217389 AGGTCACTTCCTTTCTCTGACGG - Intergenic
1194165093 X:90505984-90506006 AGGGGAGCCCATTGCCCTGAAGG + Intergenic
1194274788 X:91865886-91865908 AGGGGAGCCCATTACCCTGAAGG - Intronic
1194526502 X:94983767-94983789 AGGGGAGCCCACTTCCCTGAAGG + Intergenic
1194546407 X:95240028-95240050 AAGGGAGTTCCCTTCCCTGAAGG + Intergenic
1194553505 X:95330434-95330456 AGGGGAGCCCATTGCCCTGAAGG - Intergenic
1195199386 X:102533045-102533067 AGGGGAGCCCAGTGCTCTGAAGG + Intergenic
1195396169 X:104412581-104412603 AGGGGAGCCCACTTCCCTGAAGG + Intergenic
1195828757 X:109032670-109032692 AGGGGAGCCCATTGCCCTGAAGG - Intergenic
1195834869 X:109102819-109102841 AGGGGAGTCCACTGCCCTGAAGG - Intergenic
1195984534 X:110614850-110614872 AGGGGAGCCCACTGCTCTGAAGG - Intergenic
1195989934 X:110672266-110672288 AGGGGAGCACCTTTCTCAAAGGG + Intergenic
1196182106 X:112703736-112703758 AGGGGAGCCCACTTCCCTGATGG - Intergenic
1196215885 X:113050951-113050973 AGGGGAGCCCACTTCCCTGAAGG + Intergenic
1196552533 X:117045928-117045950 TGGGGAGCCCATTTCCCTGAAGG + Intergenic
1196660549 X:118264451-118264473 AGGGGAGCCCATTGCCCTGAAGG + Intergenic
1197028311 X:121782492-121782514 AGGGGAGCCCATTTCCCTGAAGG - Intergenic
1197112953 X:122797879-122797901 AGGGGAGTCTATTGCCCTGAAGG + Intergenic
1197558888 X:127992707-127992729 AGGGGAGCCCACTTCCCTGAAGG + Intergenic
1198537594 X:137601590-137601612 AGGGGAGCCCACTGCTCTGAAGG + Intergenic
1199148319 X:144397614-144397636 AGGGGAGCCCATTGCCCTGAAGG + Intergenic
1199439625 X:147853994-147854016 AGGGGAGCCCACTGCTCTGAAGG - Intergenic
1200315891 X:155132847-155132869 AGGGGAGCCCCCTGCCCTGAAGG + Intronic
1200419816 Y:2952845-2952867 GGGTGAGACCCTGTCTCTGAGGG + Intronic
1200511358 Y:4083784-4083806 AGGGGAGCCCATTGCCCTGAAGG + Intergenic
1200592030 Y:5087287-5087309 AGGGGAGCCCATTACCCTGAAGG - Intronic
1200606030 Y:5264166-5264188 AGGGGAGCCCACTTCCCTGAAGG - Intronic
1200746983 Y:6911402-6911424 AGGGGAGTCCCTTTCATCCACGG + Intronic
1201939802 Y:19447634-19447656 AGAGGTGACCCTTTCTCTGGTGG - Intergenic
1202052417 Y:20795035-20795057 TGGCCATTCCCTTTCTCTGATGG + Intergenic