ID: 1163804883

View in Genome Browser
Species Human (GRCh38)
Location 19:19389669-19389691
Sequence CAGGGGAAGGGAAAGTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 947
Summary {0: 1, 1: 1, 2: 5, 3: 82, 4: 858}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163804873_1163804883 2 Left 1163804873 19:19389644-19389666 CCTGGTCAGCTGTAGGCACTGCC 0: 1
1: 0
2: 1
3: 21
4: 137
Right 1163804883 19:19389669-19389691 CAGGGGAAGGGAAAGTTGGAGGG 0: 1
1: 1
2: 5
3: 82
4: 858
1163804872_1163804883 8 Left 1163804872 19:19389638-19389660 CCTCTTCCTGGTCAGCTGTAGGC 0: 1
1: 0
2: 0
3: 16
4: 184
Right 1163804883 19:19389669-19389691 CAGGGGAAGGGAAAGTTGGAGGG 0: 1
1: 1
2: 5
3: 82
4: 858
1163804870_1163804883 12 Left 1163804870 19:19389634-19389656 CCTGCCTCTTCCTGGTCAGCTGT 0: 1
1: 0
2: 3
3: 30
4: 329
Right 1163804883 19:19389669-19389691 CAGGGGAAGGGAAAGTTGGAGGG 0: 1
1: 1
2: 5
3: 82
4: 858

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163804883 Original CRISPR CAGGGGAAGGGAAAGTTGGA GGG Intronic
900018412 1:170437-170459 CTGGGGAAGGGAAAGTGTTATGG + Intergenic
900048668 1:529032-529054 CTGGGGAAGGGAAAGTGTTATGG + Intergenic
900070897 1:770856-770878 CTGGGGAAGGGAAAGTGTTATGG + Intergenic
900084978 1:888560-888582 GAGGGAAAGGGAAAGAAGGAAGG + Intergenic
900414437 1:2528556-2528578 CAGGGGGAGGGAGGGATGGAGGG - Intergenic
900466426 1:2827750-2827772 TGGGAGAAGGGAAAGATGGAAGG + Intergenic
900503198 1:3016609-3016631 GAGAGGAAGGGAAAGAGGGAGGG + Intergenic
900508940 1:3049062-3049084 CAGGGGAAGGAGACGCTGGATGG + Intergenic
900578754 1:3397275-3397297 TAGGGAAAAGGAAATTTGGAAGG - Intronic
900663040 1:3795661-3795683 CAGGAGAAGGGGGAGTTGGAAGG + Intronic
900834211 1:4987641-4987663 TAGAGGAAGGGAAGGCTGGAAGG - Intergenic
901224190 1:7602158-7602180 GAGGGGAAGGGAAGGGAGGAGGG - Intronic
901320320 1:8335940-8335962 CAGAGCAAGACAAAGTTGGAAGG - Intronic
902525266 1:17053432-17053454 CAGGGGAAGGGAGAGATGGAGGG - Intronic
902622015 1:17656195-17656217 CAGGGGCAGAGAATGTTGGTGGG - Intronic
903360142 1:22772016-22772038 CTGGGGAAGGGAAAGAAGGGAGG - Intronic
903559857 1:24219221-24219243 GAAGGGAAGGGAAGGTAGGAAGG - Intergenic
903747113 1:25595028-25595050 CAGGTGAATGGAAGGTTGGGTGG - Intergenic
903927462 1:26840853-26840875 CAGTTGAAGGGAAAGTTGAAGGG - Intronic
904025338 1:27499308-27499330 CAGAGGAAGGGCCATTTGGAAGG + Intergenic
904051226 1:27640216-27640238 CTGTGGAAGGAAAAGCTGGATGG - Intergenic
904330976 1:29757614-29757636 CTGGGGAAGGGAATGTAGGGAGG + Intergenic
904613938 1:31739696-31739718 CAGGGGAAGAGACAGATGTAGGG + Intronic
904652019 1:32013286-32013308 TTGGGGAAGGGAAACCTGGAGGG - Intergenic
904866001 1:33579421-33579443 CAGGGAAAGGAGAGGTTGGATGG + Intronic
904989417 1:34579611-34579633 TAGGGGTAGGGAAATGTGGAGGG - Intergenic
905104580 1:35557138-35557160 CAGGGGAGGGGCAAGCGGGACGG - Intronic
905312384 1:37058959-37058981 CAGAGGAAGGGAGAGATGAAAGG - Intergenic
905859640 1:41341739-41341761 CAGGGGAAGGGAAGGATGCAAGG + Intergenic
905906634 1:41622778-41622800 CAGGGGAAAGGGAAGGTGGCTGG + Intronic
906192257 1:43905786-43905808 GAGGGGAAGGAAAAGTGGCAGGG - Intronic
906587748 1:46994606-46994628 GTGGGGAAGGTAAAGTGGGAAGG + Intergenic
906644352 1:47463140-47463162 TAGTGGAAGGGAGAGATGGATGG + Intergenic
906710359 1:47924829-47924851 CTGGGGATGGGAAAGGTGCAGGG + Intronic
906938272 1:50233787-50233809 CAGGGGAAGGGAAAAGTTGGAGG - Intergenic
906954940 1:50366434-50366456 GAAGGGAAGGGAAAGAAGGAAGG - Intergenic
906956611 1:50380843-50380865 GAGGGGAAGGGAAGGGAGGAGGG + Intergenic
907099057 1:51811176-51811198 CAGGGAAAGGTAAAGGAGGAAGG - Intronic
908390514 1:63679428-63679450 CAAGGGCAGTGGAAGTTGGAAGG - Intergenic
908468459 1:64417781-64417803 CATCTGAAGGCAAAGTTGGATGG + Intergenic
909506095 1:76391582-76391604 AAGGGGAAGGGGAAGGTGAAAGG - Intronic
909533873 1:76711658-76711680 TAGGGGATGGGAAACTTTGATGG - Intergenic
910372350 1:86530231-86530253 CTGGGGGAGGGATGGTTGGAAGG - Intergenic
910601753 1:89040172-89040194 AAGGGGAAGGGAAAGGGGAAGGG - Intergenic
910840709 1:91558781-91558803 AAGGGGAAGGGAAGGATGGGAGG - Intergenic
910880665 1:91919791-91919813 CTGAGGAAGGGAAAGGTGGTTGG - Intergenic
911429545 1:97766611-97766633 CAGGGGAAAGGAAAGGGGAAGGG + Intronic
912509522 1:110179505-110179527 AAGGGGAAGGGAAAGGAAGAAGG - Intronic
913183880 1:116348943-116348965 AAGGGGAAGGGAAGGAAGGAAGG + Intergenic
913282353 1:117198478-117198500 CAGGGAATGGAAATGTTGGATGG - Intronic
913305403 1:117425109-117425131 GAGGAGAAGGGAAAGGGGGAAGG + Intronic
913527568 1:119708780-119708802 CAGAGGAAGGGAGAGAAGGAGGG + Intronic
913528934 1:119719327-119719349 GAGGGGAAGGGAAAGTAGGCAGG + Intronic
913531448 1:119737027-119737049 CAGGCAACAGGAAAGTTGGAGGG - Intronic
915161291 1:153922609-153922631 TGGGGGAAGGGAAAGGTGGAGGG - Intronic
915393123 1:155562313-155562335 GAGGAGAAGGGAAAGGTGGAAGG + Exonic
915409278 1:155688219-155688241 GAGGAGAAGGGAAAGGTGGAGGG + Exonic
916540440 1:165748485-165748507 GAGAGGAAGAGAAAGTTGAAAGG + Intronic
916554814 1:165885105-165885127 CAGGGGAAGGGAGACAGGGAGGG - Intronic
917147545 1:171908925-171908947 CAGGAGGAAGGAAAGATGGAAGG - Intronic
917246767 1:173011523-173011545 CAAATGAAGGGAAAGTGGGATGG + Intergenic
917520000 1:175740522-175740544 CAGTGGTGGGGAAAGATGGAAGG - Intronic
918280877 1:183004494-183004516 CAAGAGAAGAGAGAGTTGGAGGG - Intergenic
918723304 1:187882558-187882580 CAAGGGAAGGGAAAGGGAGAGGG + Intergenic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
919260501 1:195187625-195187647 CAGGGAAAGGAAAAGAGGGATGG - Intergenic
919710312 1:200720994-200721016 GAGGGGAAGGGAAGGGAGGAAGG - Intergenic
920125831 1:203693085-203693107 GAGGGGAAGGAAAACTTGGCAGG - Intronic
920297341 1:204967118-204967140 CAGGACAAGGGAAAGGTGGAGGG - Intronic
920330237 1:205202089-205202111 AAGGGGAAGGGAGAGGGGGAAGG + Intronic
921070931 1:211656949-211656971 CATGGGAAGGGGAGGTTGGGTGG - Intergenic
921285028 1:213601893-213601915 GAAGGGAAGGGAAAGAGGGAAGG - Intergenic
921383402 1:214547428-214547450 AAGCGGAAGGGAATGTTAGAAGG - Intronic
921687026 1:218101735-218101757 CAGGGGAAGGAAAAGGAGAAAGG + Intergenic
921833120 1:219750346-219750368 CTGGGGAAGGCAGAGTAGGATGG + Intronic
922106263 1:222516302-222516324 CTGGGGAAGGGAAAGTGTTATGG + Intergenic
922247731 1:223817205-223817227 GAGGGGGAGGGAAAGGAGGAGGG + Intronic
922247744 1:223817241-223817263 GAGGGGGAGGGAAAGGAGGAGGG + Intronic
922247752 1:223817259-223817281 GAGGGGGAGGGAAAGGAGGAGGG + Intronic
922247760 1:223817277-223817299 GAGGGGGAGGGAAAGGAGGAGGG + Intronic
922247768 1:223817295-223817317 GAGGGGGAGGGAAAGGAGGAGGG + Intronic
922247776 1:223817313-223817335 GAGGGGGAGGGAAAGGAGGAGGG + Intronic
922247784 1:223817331-223817353 GAGGGGGAGGGAAAGGAGGAGGG + Intronic
922247792 1:223817349-223817371 GAGGGGGAGGGAAAGGAGGAGGG + Intronic
922247800 1:223817367-223817389 GAGGGGGAGGGAAAGGAGGAGGG + Intronic
922936405 1:229426357-229426379 GAGGGAAAGGGAAATTTTGAAGG - Intergenic
923072427 1:230577865-230577887 AAGGGGAAGGGGAAGAAGGAGGG - Intergenic
923119794 1:230979136-230979158 CAGGGGAAGGGGAACGTGGATGG + Exonic
923209784 1:231793226-231793248 GAGGGGAAGGGAAAGTGTGCAGG - Intronic
923514189 1:234680855-234680877 CTGAGGAAGTGAAAGATGGAGGG + Intergenic
923589043 1:235302215-235302237 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
924004058 1:239587426-239587448 CAGGGGAAGGCAAAGCGGGAGGG - Intronic
924190441 1:241546143-241546165 CAGGAGAAGGGCAAACTGGAAGG - Intronic
924348443 1:243093867-243093889 CTGGGGAAGGGAAAGTGTTATGG + Intergenic
924370179 1:243339138-243339160 CAGAGGAAGGGAATGATGGGTGG + Intronic
924777413 1:247119642-247119664 CAGGCGAGGGCAAGGTTGGAAGG + Intergenic
1063150053 10:3328694-3328716 AAGGGGAAGGGCAAGAAGGAAGG - Intergenic
1063207576 10:3849122-3849144 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1063285228 10:4679782-4679804 CAGGAGTAGGGAAAGATTGATGG + Intergenic
1063511211 10:6646919-6646941 GAGGGAAAGGGAAAGGGGGAGGG - Intergenic
1063511268 10:6647220-6647242 CAGAGGAAGGGAAAGAAGGAAGG - Intergenic
1063832396 10:9969098-9969120 AAGAGGAAGGGATAGTAGGAAGG - Intergenic
1063858604 10:10283571-10283593 CAGAGGAGGGGAAAGGAGGAGGG - Intergenic
1063951460 10:11227038-11227060 CAGGGGAAGGGCAAGTATGGAGG + Intronic
1064315106 10:14248019-14248041 CAGGGGTAGGGACAGCAGGAAGG - Intronic
1064587396 10:16852267-16852289 GTGAGGAAGGGAAAGATGGAGGG - Intronic
1064709901 10:18112326-18112348 TAGCGGAAGGGAAAGTGGGCAGG - Intergenic
1065011825 10:21427816-21427838 CAGTGGATGGGAGAGCTGGAGGG + Intergenic
1065540847 10:26765623-26765645 GAGGGGAAGGGAAGGAGGGAGGG + Intronic
1065608531 10:27446671-27446693 AAGGGGAAGGGAAGGAAGGAAGG - Intergenic
1065932147 10:30489519-30489541 GAGGGCAAGGGAAATTTTGAAGG - Intergenic
1066334611 10:34463142-34463164 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
1066727917 10:38411034-38411056 CTGGGGAAGGGAAAGTGTTATGG - Intergenic
1067363406 10:45602217-45602239 CAGGGGAAGACAGAGCTGGAGGG - Intergenic
1067720237 10:48722589-48722611 CAGTGGAATGGGAAGTTGCATGG + Intronic
1069726916 10:70586086-70586108 CAGGGGCAGGGAACCTTGGCTGG + Intergenic
1069796745 10:71058131-71058153 CAGTGGAAGGTAAAGTTAGTGGG + Intergenic
1069851583 10:71408852-71408874 CAGTTGAAAGGAAAGTAGGAAGG - Intronic
1070150399 10:73801581-73801603 CAGGGGGAGTGAAACTTGGCTGG + Exonic
1070248310 10:74752180-74752202 CAGGTGAAGTGAAGGTGGGAGGG - Intergenic
1070561073 10:77566929-77566951 GAGGGGAAGGGAAGGAAGGAGGG + Intronic
1071018119 10:81021647-81021669 AAGGGGAAGGAAGAGTGGGAAGG + Intergenic
1071366829 10:84908400-84908422 AAGGGAAAGGGAAAGATGGCAGG + Intergenic
1072718562 10:97767228-97767250 GAGGGTAAGGGAAAGGTGGAGGG - Exonic
1073412979 10:103357703-103357725 CTGGGGAAGGGATAATGGGAGGG + Intergenic
1073592105 10:104767552-104767574 GAGAGGAAGGGAAAGGGGGAAGG - Intronic
1073755491 10:106576516-106576538 CAGGAGTAGGGAAAGCTGCAAGG + Exonic
1074074919 10:110114212-110114234 AAGCGGAAGTTAAAGTTGGAAGG + Intronic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1075609073 10:123836855-123836877 CAGGTGAAGGGAAAATTGGTGGG - Intronic
1075609114 10:123836984-123837006 CAGGTGGAGGGAAAGTTAGTGGG - Intronic
1075945360 10:126428282-126428304 CTGGGGTAGGGAAAGTGGGCTGG + Intronic
1076156151 10:128207133-128207155 CAAGGGCAGGGAAGGATGGAAGG + Intergenic
1076486453 10:130822159-130822181 GAGAGGAAGGGAAAGAGGGAGGG + Intergenic
1076560973 10:131363383-131363405 CAAGGGGAGGGATGGTTGGAAGG - Intergenic
1076975015 11:165633-165655 CTGGGGAAGGGAAAGTGTTATGG + Intergenic
1076994758 11:292473-292495 GAGGGCACGGGAAAGTTGGGGGG + Intronic
1077613490 11:3659500-3659522 CAGTGGAGGGGAGAGCTGGATGG + Intronic
1077970588 11:7185001-7185023 CAAGGGAAGGGAGAGGAGGAGGG + Intergenic
1078089584 11:8256457-8256479 CAGGGGAAGGGACAGGAGGGAGG + Intronic
1078285561 11:9951120-9951142 CAAGGGAAAGGAAAGATTGAGGG + Intronic
1079138225 11:17788560-17788582 CAGGGGAAGGGAAGGAAGTAGGG - Intronic
1079150712 11:17896677-17896699 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
1079206142 11:18416683-18416705 GAAGGGAAGGGGAAGATGGAAGG - Intronic
1079515609 11:21264439-21264461 CAGGAGATGGGAAGGCTGGAGGG + Intronic
1079571927 11:21953445-21953467 AAGGGGAAGGAAGAGTGGGAAGG + Intergenic
1079876681 11:25866619-25866641 CAGGGGATGGAAAATTTGCAAGG - Intergenic
1080097251 11:28423714-28423736 CAGGGGAATGGAGAGTAGTAGGG + Intergenic
1080384367 11:31802534-31802556 AAGGAGAGGGGAAAGTGGGAAGG + Intronic
1080775109 11:35378869-35378891 AAGGGGAAGGAGAAGATGGAGGG + Intronic
1081361423 11:42184773-42184795 CAGGGGAAGAGAGAATTGGAGGG + Intergenic
1082284197 11:50301820-50301842 CTGGGGAAGGGAAAGTGTTATGG - Intergenic
1083687247 11:64383881-64383903 CAGGGTAAGGGGAGGCTGGATGG + Intergenic
1083785285 11:64941770-64941792 CAGGGGAAGTGATATTTGAATGG + Intronic
1084215371 11:67644573-67644595 CAGGGCCAGGGGAAGTGGGATGG + Intronic
1084441814 11:69178957-69178979 GAGGGGAAGGGAAGGGAGGAGGG + Intergenic
1084448940 11:69221111-69221133 CAGGGGAAGAGAAGGAGGGAGGG - Intergenic
1084507036 11:69574787-69574809 CGGGTGAAGGGAGAGTTGCAGGG - Intergenic
1084582249 11:70031487-70031509 AAGGGGATGGGAAAGAGGGAAGG - Intergenic
1084774145 11:71364487-71364509 CAGGGGCAGGGAGAGTGGGTAGG + Intergenic
1084792505 11:71483469-71483491 CAGGGGAAGAGAAAGGAGGAGGG - Intronic
1084862210 11:72026737-72026759 CAGAGGATGGCAAGGTTGGAGGG - Intronic
1085247756 11:75117873-75117895 CATGGGATGGGGAAGTGGGAGGG - Intronic
1085817627 11:79757082-79757104 CAGGAGAAGAGAAAGTTGTGAGG + Intergenic
1086077437 11:82869455-82869477 GAAGGGAAGGGAAAGGAGGAAGG + Intronic
1086560719 11:88165933-88165955 CAAGGGAAAGAAAAGTTGTATGG + Intronic
1086800379 11:91166823-91166845 CAGTGTAAAGGAAATTTGGATGG + Intergenic
1087195548 11:95301061-95301083 CAGGGTAAGGCAAGGTGGGAAGG + Intergenic
1088250778 11:107859239-107859261 CAGAGGGAGGGAGAGTGGGAGGG - Intronic
1088645629 11:111913985-111914007 TGGGGGAAGGGAAAGGTGCATGG + Exonic
1088746278 11:112807642-112807664 CAGGGGAAGTGGAAGTTAGAGGG + Intergenic
1089353893 11:117837429-117837451 CAGAAGCAGGGAAGGTTGGAAGG + Exonic
1089602985 11:119626565-119626587 CAGGGGAAGGGGGAGATGAAAGG + Intronic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090158949 11:124471044-124471066 CAGGGCCAGGGTAAGTGGGACGG + Intergenic
1090490127 11:127153290-127153312 CAAGGGAAGAGAAAGTTCTAAGG + Intergenic
1090521209 11:127481376-127481398 CAGAGAAAGGGAAAAATGGAAGG - Intergenic
1090601872 11:128380645-128380667 GAGGGGAAGGGGAAGAGGGAAGG - Intergenic
1091192511 11:133707121-133707143 GAGGGGAAGGGAAAGTAGAGGGG + Intergenic
1091224594 11:133949983-133950005 GCGGGGAAGAGAAAGTAGGAGGG + Intronic
1091241583 11:134056046-134056068 CAGGGGAGTATAAAGTTGGATGG + Intergenic
1091450832 12:571063-571085 CAGGGGAGGGGCAAGTGGGGCGG - Intronic
1091920697 12:4302458-4302480 CAGGGGAGGGGAAAGACGGAGGG - Exonic
1092477032 12:8828327-8828349 AAGGGGAAGGAAGAGTGGGAAGG - Intronic
1092748642 12:11697362-11697384 CAGGTGCAGGAAAAGTTGAAAGG + Intronic
1092930412 12:13310273-13310295 CAGAGGAAGGGAAATATGGGAGG - Intergenic
1093147135 12:15580324-15580346 CAGTGAAAGGGAAAGTAGAAAGG + Intronic
1093297633 12:17410664-17410686 CAGGGGAGGGGATACTTGCATGG - Intergenic
1093459228 12:19393277-19393299 AAGGGGAAGGGGAAGGGGGAAGG + Intergenic
1094003455 12:25721792-25721814 CAGGGGAAGGGAAATGAGGGTGG + Intergenic
1094380758 12:29840663-29840685 AAGGGGAAGGGAAAAGTGAAGGG - Intergenic
1095289755 12:40464306-40464328 CAGGGCTGAGGAAAGTTGGAGGG + Intronic
1096001048 12:48130956-48130978 AAGGAGAAGGGGAAGTTGGTGGG - Intronic
1096100980 12:48970391-48970413 CCGGGGTGGGGAGAGTTGGAGGG - Intronic
1096217978 12:49808976-49808998 CAGGGGGAGGGAGAGAAGGAGGG + Intronic
1096671415 12:53200564-53200586 CAGGGGAAGTGAAACTATGAGGG - Intronic
1097226059 12:57477405-57477427 CAGGGGAAGGAAGAGCTTGAGGG + Intronic
1097242417 12:57584724-57584746 CAGGGGAAGGTAAAATGGAAGGG + Exonic
1098183836 12:67876220-67876242 AAGGGAAAGGGAAAGGTAGAGGG + Intergenic
1098211132 12:68166846-68166868 CAAGGGAAGAGAGAGCTGGAAGG - Intergenic
1098667279 12:73180113-73180135 AAGGTGAGGGGAAAGTGGGAAGG - Intergenic
1098739480 12:74154172-74154194 AAGGGGATGGGAGAGGTGGAGGG + Intergenic
1099146773 12:79056228-79056250 AAGAGGAAGGGAAAGTGTGAGGG + Intronic
1099335567 12:81352339-81352361 CAGGAAAAGGGAAAGGTGGGTGG + Intronic
1100008551 12:89924139-89924161 AAGGGGAAGGGAGAGTTTGGGGG + Intergenic
1100239106 12:92692694-92692716 GTGGGGAAGGGAAAAATGGAAGG + Intergenic
1101076959 12:101140301-101140323 CAGGGGGAAGGAAAGGTGGGTGG - Intergenic
1101270460 12:103138280-103138302 CAGGGGAGGGGACTGGTGGAAGG + Intergenic
1101861882 12:108489146-108489168 AAGGAGAAGGGAAAGAGGGAAGG + Intergenic
1101967297 12:109290404-109290426 CTGGGGACGGGCAGGTTGGAGGG - Intronic
1102223095 12:111208034-111208056 AAGGAGAAGGGGAAGTGGGAGGG + Intronic
1102554607 12:113718890-113718912 TAGGGAGAGGGAAAGCTGGAAGG - Intergenic
1102625488 12:114232464-114232486 CAGGTGCATGGATAGTTGGATGG - Intergenic
1102789837 12:115635913-115635935 GAAGGGAAGGGAAAGGGGGAGGG + Intergenic
1103016977 12:117502481-117502503 TAGGGGTGGGGAAAGTTGGGAGG + Intronic
1103561332 12:121794601-121794623 CAGGGGATGGGAGAGTTGGGGGG - Intronic
1103567256 12:121822997-121823019 CAGGGGAAGGGGCAGAGGGAGGG - Exonic
1103809407 12:123601832-123601854 GAGGGGCAGAGAAAGTGGGAGGG + Intergenic
1104109143 12:125689090-125689112 CAGGGGAGGGGAGGGTTGGTGGG + Intergenic
1104592471 12:130095738-130095760 CAGGGGAAGTGAAAGCTGAGTGG - Intergenic
1104748215 12:131223045-131223067 CAAGGGGAGGGAAAGTGGGCAGG - Intergenic
1107083898 13:36405334-36405356 AAAGGGAAGGAAAAGTGGGAAGG - Intergenic
1107293209 13:38880682-38880704 CAGGGGCAAGGAAAGTTTCAGGG + Exonic
1107819910 13:44277181-44277203 AAGGGGAAGGGAAAGAGGGAGGG + Intergenic
1108853832 13:54768883-54768905 CAAGGGAAGGGAAGGGAGGAAGG - Intergenic
1110347868 13:74468917-74468939 CATGGGAAGAGAAAGCTGAAAGG + Intergenic
1110717306 13:78720976-78720998 TAGGGGAAGGAAAAGAAGGAGGG + Intergenic
1111204315 13:84984422-84984444 CAGTGGCTGGGAAAGTGGGAAGG + Intergenic
1111353787 13:87070306-87070328 AAGGGGAAGGGGAAGTGGAAGGG - Intergenic
1111505559 13:89184477-89184499 CAGAGGTTGGGAAAGTTCGAAGG - Intergenic
1111706446 13:91755359-91755381 CAGAAGAAGGAAATGTTGGAAGG - Intronic
1111995109 13:95158125-95158147 AAGGGGAAGGTAAACCTGGAAGG - Intronic
1112172005 13:96983412-96983434 GAAGGGAAGGGAAAGGGGGAAGG + Intergenic
1113187505 13:107706139-107706161 CAGGGAAAGGCAAAGCTGGGTGG + Intronic
1113499233 13:110760195-110760217 CAGGAGAAGTGATGGTTGGAGGG + Intergenic
1113680671 13:112242151-112242173 AAGAGGAAGGGAAAGAGGGAAGG + Intergenic
1113975589 13:114225459-114225481 GAGGGGGAGGGAAAGGGGGAGGG + Intergenic
1113975604 13:114225486-114225508 GAGGGGGAGGGAAAGGGGGAGGG + Intergenic
1113975619 13:114225513-114225535 GAGGGGGAGGGAAAGGGGGAGGG + Intergenic
1113975633 13:114225540-114225562 GAGGGGGAGGGAAAGGGGGAGGG + Intergenic
1113987510 13:114330302-114330324 CATGGGAAGAGAACGTTGGGTGG - Intergenic
1114054434 14:18954596-18954618 CAGGGGAAGGAGGAGATGGAAGG - Intergenic
1114108120 14:19447336-19447358 CAGGGGAAGGAGGAGATGGAAGG + Intergenic
1114816485 14:25964918-25964940 CTGTGAAAGGGAAAGTTGAAGGG - Intergenic
1114938178 14:27571245-27571267 CAGGAGAATGGAGAGTTTGAGGG + Intergenic
1115134209 14:30089931-30089953 CAGGGGAAGAGAAAGTGTGGGGG + Intronic
1115644338 14:35357388-35357410 AAGGGGAAAGGAGAATTGGAAGG + Intergenic
1116141034 14:40994873-40994895 AAGGGGAAGGAAGAGTGGGAAGG - Intergenic
1116192645 14:41680035-41680057 CAGGGGAGGGAAGAGTTGGAAGG + Intronic
1116217902 14:42044075-42044097 AAGGGGAAGGGAAGGAAGGAAGG + Intergenic
1116217909 14:42044094-42044116 AAGGGGAAGGGAAGGAAGGAAGG + Intergenic
1116640754 14:47459459-47459481 AAGGGAAAGGAAAAGATGGAAGG - Intronic
1116786203 14:49291482-49291504 CAGGGGAAGGGAAGGGAGGGAGG + Intergenic
1117008783 14:51449223-51449245 GAGGGAAAGGGATAGTGGGAAGG + Intergenic
1117114054 14:52491988-52492010 CCTGGGAAGGAAATGTTGGAAGG + Intronic
1117715009 14:58571629-58571651 AAGGGGGAGGGAAAGGTGCAAGG - Intergenic
1118706225 14:68483014-68483036 TAGGGGAAGGGAAAGGTGGATGG + Intronic
1119150746 14:72357317-72357339 CAGAGGAAGGAACAGTTTGAAGG + Intronic
1119172317 14:72544757-72544779 CAGGGGAAGGAACAGGGGGATGG - Intronic
1119182624 14:72614910-72614932 CTGGGGAAGGGAGGGTGGGAGGG - Intergenic
1119621278 14:76133893-76133915 GTGGGGCAGAGAAAGTTGGATGG - Intergenic
1119640843 14:76313803-76313825 AAGGGGGAGGGAAAGCAGGAGGG - Intronic
1121171103 14:91855102-91855124 CAGGGGAAAGGAAGGATGGGTGG + Intronic
1121593363 14:95137488-95137510 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
1121593388 14:95137561-95137583 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
1121816018 14:96929128-96929150 TAGGTGAAGGGATAGTTGGATGG - Intronic
1122004710 14:98692636-98692658 CAGGGGAAGGACAAGAGGGAGGG - Intergenic
1122030617 14:98908886-98908908 CAAAGGGAGGGAAAGTTAGAGGG - Intergenic
1122163322 14:99802389-99802411 CAGGGGGAGGGCAGGTGGGAAGG + Intronic
1122389947 14:101373381-101373403 CAGCAGAAAGGGAAGTTGGAGGG - Intergenic
1122640096 14:103154788-103154810 AAGGGGAAGGGGAAGGTGGCAGG + Intergenic
1123159129 14:106260430-106260452 GAGGGGCAGGGATACTTGGAAGG + Intergenic
1123207874 14:106730806-106730828 GAGGGGCAGGGATACTTGGAAGG + Intergenic
1202844562 14_GL000009v2_random:156240-156262 CATGGGAAAGGAATGTAGGAGGG + Intergenic
1202913952 14_GL000194v1_random:146484-146506 CATGGGAAAGGAATGTAGGAGGG + Intergenic
1124716151 15:32064243-32064265 AAGGGGAAGGGAAAGGGGCACGG - Intronic
1125539341 15:40460758-40460780 CAGGGGAAGGGAGATCTGGAAGG - Intronic
1125684660 15:41556808-41556830 GAGGGGAAGGGGAAGTGGAAGGG + Intergenic
1126053263 15:44706975-44706997 AAGGGGAGGGAAAAGTGGGAAGG - Intronic
1127155689 15:56122754-56122776 AAGGGGAAGGAAGAGTGGGAAGG - Intronic
1127446391 15:59067343-59067365 AAGGGGAAGGGAAAGGAGAAAGG - Intronic
1127517808 15:59713373-59713395 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1128922130 15:71620750-71620772 GAGGGGTGGGCAAAGTTGGAAGG - Intronic
1128936053 15:71747348-71747370 AATGGGTAGGGAAAATTGGAAGG - Intronic
1128975180 15:72147062-72147084 AAGAGGCAGGGAAAGTGGGAAGG - Intergenic
1129044968 15:72725948-72725970 AGGGGGAAGGGAAAGGAGGAAGG - Intronic
1129230178 15:74192686-74192708 CAGGGGAAGGAAAGGCTTGATGG - Intronic
1129756129 15:78100343-78100365 CACGGGAAGGGAAAGTTGGGTGG + Intronic
1129906775 15:79193315-79193337 CAGGGGAAGAGACATCTGGAAGG + Intergenic
1129951965 15:79599830-79599852 CAGAGGACAGGAAGGTTGGAGGG + Intergenic
1130130404 15:81136359-81136381 AAGGGGAAGGGAAAGGAAGAAGG + Intronic
1130193356 15:81756948-81756970 GAGAGGAAGAGAAGGTTGGATGG + Intergenic
1130734775 15:86536716-86536738 GAGGGGAGGGGAAAATAGGAGGG + Intronic
1130761529 15:86825651-86825673 GAAGGGAAGGGAAAGAGGGAGGG + Intronic
1131641577 15:94299035-94299057 GAGGGGAAGGGGAAGGGGGAGGG - Intronic
1131671796 15:94627490-94627512 CAGGAGAAGAAAAAGTTGAAGGG + Intergenic
1132023493 15:98384878-98384900 AAGGGAAAGAGAAAGATGGAAGG + Intergenic
1132514373 16:359421-359443 CAGGGGCTGGGGAAGTAGGAGGG + Intergenic
1133043616 16:3073986-3074008 CAGGGGCAGGGATGGATGGATGG + Intronic
1133172781 16:3992242-3992264 CAGGAGAAGGGAAGGTGGGCAGG - Exonic
1133467742 16:6043924-6043946 GAGGTGAAGGAAAAGTTAGAGGG - Intronic
1133485457 16:6214843-6214865 CAGGGAAAGAGAAAGAAGGAGGG + Intronic
1133610354 16:7427554-7427576 CAAGGGAAGGTAAAATTGGAGGG - Intronic
1133826669 16:9284160-9284182 GAGGGGAAGGGAAAAATGCAAGG - Intergenic
1134292067 16:12909827-12909849 AAGGGGAAGGGAAGGAGGGAAGG - Intronic
1134510040 16:14838989-14839011 CAGAGGGAGGTAAAATTGGAGGG - Intronic
1134683728 16:16144404-16144426 CAGGGGACAGGAAAGCTTGAGGG - Intergenic
1134974155 16:18557187-18557209 CAGAGGGAGGTAAAATTGGAGGG + Intronic
1135775372 16:25253382-25253404 CTGGGGAAGGGAAAGGGGGTAGG - Intronic
1135811143 16:25588032-25588054 GAGGGGAAGGGAGGGGTGGAAGG - Intergenic
1135932921 16:26754533-26754555 CAGGGGTAGGAAAAGTGGGAAGG + Intergenic
1136255835 16:29038448-29038470 GAGGGGAAGGGAAAGGAGAAGGG - Intergenic
1136381330 16:29897249-29897271 GTGGGGAAGGGAAAGGTGGGGGG - Intronic
1136504172 16:30692246-30692268 CTGGTGAAGTGAAAGTTGGATGG - Intergenic
1137348262 16:47685097-47685119 TAGGGAAAGGAAAAGATGGATGG - Intronic
1137573279 16:49580316-49580338 CAGGGATAGGGAAAATTGGGAGG - Intronic
1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG + Intergenic
1138068562 16:53967389-53967411 CACGGGAAGGGCATGTTAGATGG + Intronic
1138440275 16:57030128-57030150 AAGAGGAGGGGAAAGTGGGATGG + Intronic
1138761281 16:59547656-59547678 AAGGGGGAGGGAAGGTTGAATGG - Intergenic
1139060948 16:63250702-63250724 GAGGGGAAGGGGAAGGAGGAGGG + Intergenic
1139210078 16:65068208-65068230 AAGAGGAAGGGAAAGAGGGAAGG + Intronic
1139328432 16:66169383-66169405 GAGGGGAAAGAAAAGTAGGAAGG + Intergenic
1139363648 16:66419348-66419370 GAGGGGAAGGGAAGGAGGGAGGG + Intergenic
1140980112 16:80100419-80100441 GAGAGGAAGGGGAAGTGGGAGGG + Intergenic
1141190897 16:81823939-81823961 AAGGGAAAGGGAAAGGAGGAAGG - Intronic
1141360733 16:83392961-83392983 CAGGGGAGGGCATAGATGGAGGG + Intronic
1141896052 16:86959365-86959387 AAGGGGAAGGGGAAGATGGATGG + Intergenic
1142250844 16:88991198-88991220 CAGGTGGAGGGAAAGTGGGAAGG - Intergenic
1142261495 16:89044572-89044594 CAGGGGAAGGGAATGGAGGGGGG - Intergenic
1142445248 16:90132026-90132048 CTGGGGAAGGGAAAGTGTTATGG - Intergenic
1142462261 17:103440-103462 CTGGGGAAGGGAAAGTGTTATGG + Intergenic
1143082829 17:4394256-4394278 CGGGAGCAGGGAGAGTTGGATGG + Intergenic
1143728428 17:8865900-8865922 CAGGGGCAGGGAAGCTTGGTGGG + Intronic
1143871312 17:9959018-9959040 CAGGAGAAGGGGAGGTGGGAGGG + Intronic
1144057904 17:11558383-11558405 CAAGGGAAGGGAGAGTGGCAAGG - Exonic
1145769392 17:27481812-27481834 CAGGAGAAGGGACAGTGGGAGGG - Intronic
1145875791 17:28317650-28317672 CAAGGGAAGGGGAAGCTGGGCGG + Intergenic
1145988877 17:29066085-29066107 CTGGGGAGGGGAGAGTTGGAGGG + Intergenic
1146282728 17:31555635-31555657 CAGGGGAAAGGCAAGCAGGAAGG - Intergenic
1146786242 17:35724460-35724482 CAGGGGAAAGGAAAGGAGTAAGG - Intronic
1147536927 17:41327501-41327523 CAGGACAATGGAAAGTGGGAGGG - Intergenic
1148536665 17:48444797-48444819 CACCGGAAGTGAAGGTTGGAGGG + Intergenic
1148696952 17:49566319-49566341 CAGAGGAAGGGAAAGTGGAAAGG + Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1148852826 17:50562930-50562952 CCGGGGGAAGGAAAGGTGGAGGG + Intronic
1149040411 17:52181832-52181854 CAGAGGAAGGGAAAGGTGGTGGG - Intergenic
1149456771 17:56794543-56794565 CAGGGAAAGGGAAAGACAGAGGG + Intronic
1149784717 17:59425226-59425248 CCTGGGCAGGGAAAGTGGGAAGG + Intergenic
1150519566 17:65852268-65852290 GAGGGGAAGGGAAGGAGGGAGGG - Intronic
1150519593 17:65852337-65852359 GAGGGGAAGGGAAGGAGGGAGGG - Intronic
1151221394 17:72615506-72615528 AAGGGGAGGGGAAGGATGGAGGG + Intergenic
1151784104 17:76266522-76266544 AAGGGGACTGGGAAGTTGGAAGG + Intronic
1152358902 17:79821045-79821067 CTGGGGAAGGGTAGATTGGAAGG - Intergenic
1152417336 17:80171146-80171168 GAGGGGAAGGGGAAGGTGAATGG - Intronic
1152437954 17:80287731-80287753 GAACGGAAGAGAAAGTTGGAGGG + Intronic
1152609221 17:81307449-81307471 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1152609255 17:81307532-81307554 AAGGGGAAGGGGAAGGGGGACGG - Intergenic
1152720185 17:81919770-81919792 CAGGGGAAGGGGAAGAGGGGTGG + Exonic
1203162620 17_GL000205v2_random:64650-64672 CAGGGGAAGGTAAGGTTTGAGGG - Intergenic
1153851020 18:9094467-9094489 CAGGGGAATGGAAAGTGGTAGGG - Intergenic
1154095775 18:11413744-11413766 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1154111936 18:11577692-11577714 AAGGGGAAGGGGAAGGTGGGAGG + Intergenic
1155070615 18:22312730-22312752 CGGGGCCAGGGAAAGTTGGTAGG + Intergenic
1155249427 18:23940829-23940851 CAGGGGAGGGGACAACTGGAGGG - Intronic
1155479332 18:26268433-26268455 GAGGGGAAGGGAATCTAGGAAGG - Intronic
1157196482 18:45624120-45624142 CTAGGGAAGGGAAAGAGGGAAGG + Intronic
1157229676 18:45903282-45903304 CAGGGAGAGGAAATGTTGGAGGG + Intronic
1157252668 18:46109324-46109346 CAGGGGAGGGGACTGATGGAAGG - Intronic
1157751695 18:50184357-50184379 CTGGGGCAGGGAGAGTTGCAGGG + Intronic
1157969673 18:52251845-52251867 CAGGAGAAGAGAAAGTGGGGAGG + Intergenic
1158234746 18:55300733-55300755 CAGGGGATTGGAAGGTGGGAGGG - Intronic
1158430912 18:57386401-57386423 CAGGGGCAGGGATTGGTGGAGGG + Intergenic
1158437430 18:57443221-57443243 CAAAGGAAGGGAAATTAGGAGGG + Intronic
1158669070 18:59458237-59458259 AAGAGGAAGGAAAGGTTGGATGG - Intronic
1160012550 18:75116872-75116894 CAGGTGAAGGGAAACTGGGCAGG + Intergenic
1160651967 19:235816-235838 CTGGGGAAGGGAAAGTGTTATGG + Intergenic
1160819783 19:1052533-1052555 GAGGGGAAGGGAGAGGAGGAGGG + Intronic
1161139311 19:2638396-2638418 GATGGGAAGGGAAAGGGGGAGGG + Intronic
1161624664 19:5319471-5319493 CAGGTGAAGGCAAAGGTGGGTGG - Intronic
1161912656 19:7206126-7206148 CATGGGAAGAGAGGGTTGGATGG + Intronic
1161926812 19:7306919-7306941 CAGGAGAGGGGAAAGAGGGAGGG + Intergenic
1162686187 19:12386485-12386507 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
1162686192 19:12386497-12386519 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
1162828599 19:13269993-13270015 CAGGGGAAGGGAATAGGGGAAGG - Intronic
1162867582 19:13560512-13560534 GAGGGGAAGTGAAAGAGGGAAGG - Intronic
1162992099 19:14310105-14310127 CACAGAAAGGGAAAGTTGGTGGG - Intergenic
1163804883 19:19389669-19389691 CAGGGGAAGGGAAAGTTGGAGGG + Intronic
1164477748 19:28588206-28588228 CAGGGGCAGGGAGAGCTGGAAGG - Intergenic
1164544855 19:29151867-29151889 AAGGGAAAGGGAAAGGAGGAAGG + Intergenic
1164557369 19:29263859-29263881 CATAGGAAGGGAGAGTTGAAAGG - Intergenic
1164601394 19:29566076-29566098 CAGGGGAGGGGCAAGTGTGATGG + Intergenic
1164601430 19:29566182-29566204 CAGGGGAGGGGCAGGTTTGATGG + Intergenic
1164772005 19:30816498-30816520 GAGAGGAAGGGAAAGAAGGAAGG - Intergenic
1164795956 19:31030228-31030250 CAGAGGAAACGAAAATTGGAGGG + Intergenic
1164956641 19:32392223-32392245 GAGGGGAAGGGAAAGAAAGAAGG + Intergenic
1165477861 19:36042074-36042096 GAGGGGAAGGGGAAGGGGGAGGG + Intronic
1165890386 19:39108602-39108624 CAGGGGAAGATAAAGATGGGGGG + Intronic
1165910286 19:39221805-39221827 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1166034965 19:40161432-40161454 AAGGGGAAGGGAAAGGGAGAGGG + Intergenic
1166214028 19:41324130-41324152 CAGGGAAAGTGAGAGCTGGATGG + Exonic
1166536059 19:43575512-43575534 GAGGGGCAGGGAGAGTGGGAGGG + Exonic
1166548578 19:43649659-43649681 AAGGAGAAGGGAAAGAAGGAAGG + Intronic
1167440683 19:49507036-49507058 GAGGGGAAGGGGAAGGGGGAGGG - Intronic
1168120190 19:54247675-54247697 CTGGGGAAGGGAGGGTTGTAAGG - Intronic
1168598715 19:57700826-57700848 CAGGGACAGGGACAGTAGGATGG - Exonic
925013817 2:506644-506666 CAAGGGGACGGAAAATTGGAGGG - Intergenic
925199244 2:1952890-1952912 GAGAGGAAGGGAAAGAAGGAGGG - Intronic
925283439 2:2700941-2700963 GAGGGGAAGGGGAGGATGGAGGG - Intergenic
925506279 2:4568806-4568828 AAAGGGAAGGGAGAGTGGGAAGG - Intergenic
925622564 2:5808065-5808087 CAGGGGCAGGCAGAGTTGGATGG - Intergenic
925872617 2:8284216-8284238 CTGGGAAAGGGACAGTTGGAGGG - Intergenic
925949714 2:8899133-8899155 CATTGGAAGGGCAATTTGGAAGG - Intronic
926516326 2:13851064-13851086 AAGGGGAAGGAAGAGTGGGAAGG + Intergenic
926521785 2:13924382-13924404 CAGGGGCAGGGAAAGTTCTCTGG - Intergenic
926725482 2:15994233-15994255 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
926728646 2:16018049-16018071 AAGGGGAAGGGAAGGAAGGAAGG - Intergenic
927906824 2:26864512-26864534 CACGGAAAGGAAAAGGTGGATGG + Intronic
928293605 2:30061553-30061575 AAGGGGAAGGAAGAGTGGGAAGG + Intergenic
928389153 2:30895768-30895790 CAGGGAAAGAGAAGGTGGGAGGG - Intergenic
928836377 2:35551724-35551746 CAGGGGAAGGGCATGGTGGGAGG - Intergenic
928897452 2:36281489-36281511 CAGGGGAAGAGAACATGGGAGGG + Intergenic
929226064 2:39512793-39512815 CAGAGGAAGGCTAAGTTGAATGG + Intergenic
929481218 2:42310293-42310315 AAGGGGAAGGGAAAGGGGAATGG - Intronic
929524967 2:42693461-42693483 AAGGGGAAGGAAAAGCAGGAAGG - Intronic
929706783 2:44221546-44221568 CAGAAGAGGAGAAAGTTGGAAGG + Intronic
930763176 2:55058143-55058165 AAGGAGAGGGAAAAGTTGGAGGG + Intronic
931123192 2:59244046-59244068 AAGGGGAAAGGAAAGAAGGAAGG + Intergenic
931264628 2:60649802-60649824 GGGAGGAAGGGAGAGTTGGAGGG + Intergenic
931316834 2:61140854-61140876 CAGAGGAAGGAATAGGTGGAAGG + Intergenic
931439332 2:62276946-62276968 AAGAGCAAGAGAAAGTTGGAGGG - Intergenic
931512848 2:63019776-63019798 GAGGAGAAGGGAAAGGGGGAGGG + Intronic
931796152 2:65712148-65712170 AAGGGGAAGGGAAAGAAGGAAGG - Intergenic
931981719 2:67700179-67700201 CAGTGGAAGAAAAAGCTGGAAGG + Intergenic
932263274 2:70344746-70344768 TAGGAGAAGGCAGAGTTGGATGG - Intergenic
932356677 2:71073268-71073290 CAAGATAAGGGAAAGTTGGAGGG - Intronic
932530386 2:72523974-72523996 CAAGGGAAGGGAAAGGAAGAAGG + Intronic
932921648 2:75921541-75921563 CTGGGGAAGGGAAAAGGGGAGGG + Intergenic
933030846 2:77326818-77326840 CAGAGGAAGGGAAAGTAGGCTGG - Intronic
933069268 2:77836808-77836830 AAGGGGAAGGGAAGGAGGGAGGG + Intergenic
933387907 2:81634652-81634674 AAGGAGAAGGAAAAGTGGGAAGG + Intergenic
933734750 2:85486876-85486898 GAGGGGAAGGGAAGGGAGGAGGG + Intergenic
933786544 2:85847340-85847362 CAGAGGAAGTGAGATTTGGAAGG - Intronic
934053643 2:88233031-88233053 AAGTGGAAGAGAAAATTGGAAGG + Intergenic
935179527 2:100677252-100677274 GAGGGGAAGGGATGGTGGGAAGG - Intergenic
935320616 2:101884788-101884810 CAGGACTAGGGAAAGTTGTAAGG + Intronic
936037330 2:109123382-109123404 CAGGGGAAGGGAGGGAGGGAGGG - Intergenic
936052708 2:109236997-109237019 CAGGGGAAGCTAAACTTAGAAGG + Intronic
936073258 2:109385075-109385097 CAGAGGAAGGGACAGATGAAGGG - Intronic
936257125 2:110926693-110926715 CAGGGGGATAGAAAGTTTGAGGG - Intronic
936674582 2:114700252-114700274 CAGGGGCAGGAGAAGGTGGAGGG - Intronic
936770122 2:115902460-115902482 AAGGGAAAGGGAAAGAGGGAAGG - Intergenic
937280748 2:120715814-120715836 CAGGGGAGGGGAATTTTGTAGGG + Intergenic
937555147 2:123144908-123144930 GAGGGGAAGGGAAAGATGACTGG - Intergenic
937906957 2:127057111-127057133 CAGGGCCAGGGAGAGTTGGAAGG - Intronic
939547617 2:143572414-143572436 CAGGGCAAGGGAAAGGGAGAGGG - Intronic
940242537 2:151578629-151578651 CAGGGCAAGGGAAGGAGGGAAGG + Intronic
940315115 2:152320246-152320268 AAGGAGAAGGAAAAGTGGGAAGG - Intergenic
940526719 2:154825165-154825187 CAGGAAAAGGGTAAGTTGGGAGG - Intronic
940605727 2:155922646-155922668 TAGGGGAAGGGAAACCTCGAAGG - Intergenic
940922359 2:159322918-159322940 CAGGGGAAGAGAAAGAGAGAAGG - Intronic
941637785 2:167954421-167954443 CAGGTGGAGTGAAAATTGGAAGG - Exonic
942103332 2:172607762-172607784 CAGGGGAAGGAAAAGGAGCAGGG + Intronic
942629232 2:177938111-177938133 GAGTGAAAGGGAAGGTTGGAAGG + Intronic
943063584 2:183063817-183063839 AAGGGGAAGGGAAGGAAGGAAGG - Intergenic
943300790 2:186196322-186196344 CAGGTGAAGGGAGATTTGGATGG + Intergenic
943318913 2:186423058-186423080 CAGGGCAAGGCTTAGTTGGATGG + Intergenic
943876307 2:193071915-193071937 CAGAAGAAGGGAAAGGCGGAAGG - Intergenic
943930519 2:193845537-193845559 CAGGGGAAGGGAAGATTAAAAGG - Intergenic
944414097 2:199466529-199466551 CAGTGGCAGGGAAAGATGGAAGG + Intronic
944677898 2:202049409-202049431 GAAGGGAAGGGAAAGGTGAAGGG + Intergenic
945552526 2:211237764-211237786 CAAGCGAAGGGGAAGTTGGGTGG - Intergenic
945686491 2:212977179-212977201 GAAAGGAAAGGAAAGTTGGAGGG - Intergenic
946060148 2:216934482-216934504 CATGGGGAGGGAAAGGGGGAAGG - Intergenic
946408415 2:219504900-219504922 GAGGGGGAGGGTAACTTGGAGGG + Intronic
947343626 2:229166979-229167001 AAGGGGAAGGGGAAGTGGAAGGG + Intronic
947511007 2:230754385-230754407 GAGGGGAAGGGGAAGAAGGAGGG - Intronic
947511020 2:230754421-230754443 GAGGGGAAGGGGAAGAAGGAGGG - Intronic
948558561 2:238835251-238835273 AAGGGGAAGGGGAAGTGGAAGGG - Intergenic
948654344 2:239467154-239467176 CAGAGGAAGGTAAAGCCGGAGGG + Intergenic
1168748073 20:261829-261851 CAGGGGATGTGAAAGGTGCATGG + Intergenic
1169596376 20:7204266-7204288 CTGGGGAAGGGAGAAGTGGAAGG - Intergenic
1169815797 20:9654801-9654823 CAGGGGAGGGAGAAGTTAGAGGG - Intronic
1171183911 20:23111387-23111409 CAGGGGAAGGGAGATGGGGAAGG + Intergenic
1171257875 20:23704528-23704550 CAGGGGAAGGGAAAGGGAGTAGG + Intergenic
1171355807 20:24544665-24544687 TGGGGTAAGGGAAAGTTTGAAGG + Intronic
1172301952 20:33856640-33856662 CAGGTGAAGGAAAAGCTGGCGGG - Intergenic
1172422999 20:34833660-34833682 AAGTCGAAAGGAAAGTTGGACGG - Intergenic
1172898321 20:38316191-38316213 GAGGGGAAGAGAAAGAAGGAAGG - Intronic
1174041751 20:47705206-47705228 CAGGGGAGGTGAAAATAGGAAGG + Intronic
1174379788 20:50149260-50149282 AGGGGGAAGGGAAAGGTGGAGGG - Intronic
1174423392 20:50415537-50415559 CAGGGGAAGGGAAAGGCGAGTGG + Intergenic
1174767706 20:53269421-53269443 AAGAGAATGGGAAAGTTGGAGGG - Intronic
1174899932 20:54488745-54488767 GAGGGGTAGGGAAAGAGGGAGGG - Intronic
1174948032 20:55010304-55010326 AAGGGGAATTGAAAGATGGAGGG + Intergenic
1175196624 20:57248311-57248333 CAGGGGAGGGAAAAGTGGGTTGG - Intronic
1175239887 20:57539339-57539361 CAGGGGAAGGGAGATTTGAAGGG - Intergenic
1175378955 20:58549364-58549386 CAGAGGAAGGGAAGGGGGGAAGG - Intergenic
1175565007 20:59967737-59967759 AAGGGGAAGGGAAGGGAGGAAGG - Intronic
1175781114 20:61682562-61682584 CAGAGGAAGGGAGAGATGAAGGG + Intronic
1175876300 20:62231837-62231859 CAGAGCAAGGGAAAGTTGTTTGG - Intergenic
1175919644 20:62444709-62444731 CAGGGGATGGGAGAGGTGGATGG + Intergenic
1176633307 21:9161158-9161180 CATGGGAAAGGAATGTAGGAGGG + Intergenic
1176640015 21:9293659-9293681 CATGGGAAAGGAATGTAGGAGGG - Intergenic
1176870093 21:14076960-14076982 CAGAGGAAGGGAAGGAGGGAGGG + Intergenic
1177044674 21:16154751-16154773 CAGATGCAGGGAAAGATGGAGGG + Intergenic
1177212900 21:18091873-18091895 AAGGGGAAGGAAAAGTGGGAAGG + Intronic
1177279607 21:18964027-18964049 CAGGGAAAGGGAAAGGGGAAGGG + Intergenic
1177761422 21:25406682-25406704 AAGGGGAGGGAAAAGTGGGAAGG - Intergenic
1178007297 21:28235443-28235465 AAGGGGAAGGAAGAGTGGGAAGG + Intergenic
1178339777 21:31776349-31776371 GAGAGGAAGGGAAAGCTAGAGGG - Intergenic
1178462797 21:32818327-32818349 AAGGGGAAGGGAAGTTGGGAAGG - Intergenic
1178857221 21:36260225-36260247 AAGGGGAAGGGAAGGGAGGAAGG + Intronic
1179215919 21:39366944-39366966 GAGGGGAGGGGAAAGGGGGAAGG - Intergenic
1180424062 22:12901122-12901144 CATGGGAAAGGAATGTAGGAGGG - Intergenic
1180472905 22:15676972-15676994 CAGGGGAAGGAGGAGATGGAAGG - Intergenic
1181389803 22:22571959-22571981 AAGGGGAAGGGAAGGGAGGAAGG + Intergenic
1182843469 22:33411036-33411058 CAGTAGAAGGGAAAGAAGGAAGG - Intronic
1183097976 22:35565749-35565771 GAGGGGGAGGAGAAGTTGGAGGG - Intergenic
1183268234 22:36844181-36844203 CAGCGGATGGGCAAGTGGGAAGG - Intergenic
1183404720 22:37624850-37624872 GAGGGGAAGGGAAAGGGGCAGGG - Intronic
1183491142 22:38116252-38116274 TGGGGAAAGGGAAAGGTGGATGG - Intronic
1183501375 22:38181597-38181619 CAGGGGGATGAAAAGATGGAAGG + Intronic
1183914193 22:41103591-41103613 TAGAAGTAGGGAAAGTTGGAAGG + Intronic
1184254691 22:43280412-43280434 GAGGGGAAGGGACAGGAGGATGG - Intronic
1184254700 22:43280437-43280459 GAGGGGAAGGGACAGGGGGATGG - Intronic
1184254731 22:43280510-43280532 GAGGGGAAGGGACAGCAGGATGG - Intronic
1184254739 22:43280535-43280557 GAGGGGAAGGGACAGGAGGATGG - Intronic
1184777827 22:46632147-46632169 CTTGGGAGGGGAAGGTTGGAGGG + Intronic
1184841591 22:47055386-47055408 CAGGGGAAGAGATGGATGGATGG + Intronic
1185276407 22:49951825-49951847 CTGGGGCAGGGCCAGTTGGAAGG + Intergenic
949448469 3:4161522-4161544 AAAGGGGAGGGAAAGTGGGAAGG - Intronic
949602743 3:5618491-5618513 CAAGGGATGGGAAATCTGGAAGG - Intergenic
949698811 3:6731635-6731657 CAGGTGAAGGGAAAAGTGCATGG + Intergenic
950141727 3:10620503-10620525 CAGGAGTAGGGAAACCTGGAAGG + Intronic
950981069 3:17304834-17304856 CAGGGGCAAGGAAGATTGGATGG - Intronic
951053541 3:18121644-18121666 CAGAGGAAGAGACATTTGGAGGG + Intronic
951420141 3:22474227-22474249 CAGAGAAAGGGAAAGTGAGAAGG + Intergenic
951470502 3:23051250-23051272 AAGGGGAAGGGAAGGAGGGAGGG + Intergenic
951494987 3:23316336-23316358 AAGGGGAAGGAAGAGTGGGAAGG - Intronic
952220695 3:31321280-31321302 GAGAGGAAGAGAAAATTGGATGG + Intergenic
952341072 3:32448101-32448123 CATGAGGAGTGAAAGTTGGAAGG + Intronic
952882723 3:37994750-37994772 CAGGGGATGGGGGTGTTGGAGGG - Intronic
953217282 3:40931105-40931127 AAGGGGAAGGAAAAGTGGAAAGG + Intergenic
953333641 3:42075263-42075285 CATGGGAAGGGGATGTTGCAGGG + Intronic
953537794 3:43789209-43789231 CAGGGGAAGAGAAAGTGAGCAGG - Intergenic
954050929 3:47976466-47976488 CAGGGTAAGGAAAGGCTGGAGGG - Intronic
954154431 3:48677463-48677485 AAGGGGAAGAGAAAAATGGAAGG - Intronic
954613683 3:51959019-51959041 CAGGGGATGGGATGGCTGGAGGG - Intronic
955150686 3:56363869-56363891 AAGGGAAAGGGAAAGGGGGAGGG + Intronic
955274306 3:57533057-57533079 AAGGGGAGGGAAAAGTAGGAAGG - Intronic
955567708 3:60266583-60266605 CAGGGGAAGGGAAAGGATTAAGG + Intronic
955598673 3:60620644-60620666 GAGGGGGAGGGAAAGAGGGATGG + Intronic
956072211 3:65465815-65465837 CAGGGGAATAGAAAGTGGGTAGG - Intronic
956539475 3:70319777-70319799 CAGTGGGAAGGAAATTTGGAAGG + Intergenic
958087247 3:88826041-88826063 GAGGGGAAGGGAGAGAAGGAAGG - Intergenic
958885470 3:99721473-99721495 GAGGGGAAGGGAAGCCTGGATGG + Intronic
959063641 3:101636808-101636830 AAGGGTTAGGGACAGTTGGATGG - Intergenic
959798072 3:110456863-110456885 AAGGGGAAGGAAGAGTGGGAAGG - Intergenic
959820887 3:110733948-110733970 AAGGGGTGGGGCAAGTTGGAGGG + Intergenic
960056588 3:113280198-113280220 CAGGGGAAGGGCAGGAAGGAGGG - Intronic
960141843 3:114158843-114158865 AAGCGGAATGGAAAGTGGGAGGG + Intronic
960153473 3:114274720-114274742 AAGGGGAAGGAAGAGTGGGAAGG - Intergenic
961573050 3:127814046-127814068 GAGAGGAAGGGAGAGTGGGAGGG - Intronic
961660227 3:128464791-128464813 GAAGGGAAGGGAAAGAAGGAGGG - Intronic
961696375 3:128708079-128708101 CAGAGGAAGAAAAAGTTGGAGGG + Intergenic
961925207 3:130472157-130472179 CAGGGAATGGGGAAGTTGGAGGG + Intronic
962535826 3:136327973-136327995 CAGGTGAAAGGAAAGTGAGAGGG + Intronic
963112048 3:141696054-141696076 TAAGGGAAGGGAGAGATGGAAGG + Intergenic
963143257 3:141965541-141965563 GAGGGGAAGGGGAAGGGGGAGGG + Intronic
963638712 3:147832886-147832908 GAGGGGAGGGGAAAGAAGGAAGG - Intergenic
964064683 3:152563399-152563421 CATTGGAAGGGCAATTTGGAAGG + Intergenic
964089860 3:152862732-152862754 CAGGGGAAGGGAAAAGGGAAAGG - Intergenic
964371929 3:156009019-156009041 CAGAGGAAGGGAGAATTGGACGG + Intergenic
964669580 3:159210058-159210080 CAGAGGAAGGGACAGTTGGGTGG + Intronic
964816929 3:160727666-160727688 CAGGGGTAGAGAGAGCTGGAGGG + Intergenic
965044361 3:163556344-163556366 AAGAAGAAGAGAAAGTTGGAGGG + Intergenic
965727968 3:171739534-171739556 AAGTGGGAGGGAAAGTTGAAGGG - Intronic
965891250 3:173516515-173516537 AGGTGGAAGGAAAAGTTGGAAGG - Intronic
966159424 3:176952226-176952248 CAGGGGAGGGGAAAACTGGCCGG + Intergenic
966437829 3:179908336-179908358 CAGTGGAGGAGAAAGTAGGAAGG + Intronic
966463552 3:180203748-180203770 AAGGGGAAGGAAGAGTGGGAGGG + Intergenic
966897655 3:184457729-184457751 AAGGGGAAGGGGAAATTGGAGGG + Intronic
966901161 3:184487004-184487026 CAGGGGAAGGGAGGGAGGGAGGG - Intronic
967004740 3:185373747-185373769 CAGGGGTAGGGCAATATGGATGG - Intronic
967090610 3:186131738-186131760 CAGTGTAACGGAAAGTAGGAAGG + Intronic
967217311 3:187221280-187221302 CAGGTGAAGGAACAGTTGAATGG + Intronic
967399591 3:189045929-189045951 CAAGGGAAGGGTAAGTAAGAGGG + Intronic
967866348 3:194193116-194193138 TGGGGGAAAGGAGAGTTGGAGGG - Intergenic
968223147 3:196953410-196953432 CAGGGTGTGTGAAAGTTGGAGGG - Intronic
968365863 3:198184156-198184178 CTGGGGAAGGGAAAGTGTTATGG - Intergenic
1202746879 3_GL000221v1_random:111363-111385 CATGGGAAAGGAATGTAGGAGGG + Intergenic
968857509 4:3138155-3138177 AAGGGGAAGGGAAAAGGGGAAGG - Intronic
968998731 4:3963304-3963326 CAGGGGTGGGGATAGTTGGAGGG - Intergenic
969237310 4:5874731-5874753 AAGAGGAAAGGAAAGATGGAAGG + Intronic
969397674 4:6933272-6933294 AAGGGGAAGGGGAAGGGGGAGGG - Intronic
969755259 4:9145329-9145351 CAGGTGTGGGGATAGTTGGAGGG + Intergenic
969815159 4:9681528-9681550 CAGGGGTGGGGATAGTTGGAGGG + Intergenic
970225561 4:13852931-13852953 CAGGAGAAGGCAAAGCTGGTTGG + Intergenic
970461005 4:16274970-16274992 CACGGGCAGGCAAAGTTTGATGG - Intergenic
970562347 4:17294974-17294996 CGGGGGCAGGGAAGGTTGGGAGG - Intergenic
970568132 4:17352428-17352450 CGAAGGATGGGAAAGTTGGATGG + Intergenic
970645303 4:18113844-18113866 AAGGGGAAGGGAAAGGGGAAGGG + Intergenic
970750996 4:19360924-19360946 AAGGGGAAAGGAAAATGGGAAGG - Intergenic
971248629 4:24952833-24952855 CAGGGGATGGGGAAGATGGGGGG - Intronic
971445493 4:26742065-26742087 GAGGGGAAGGGACATATGGAGGG + Intronic
971838019 4:31794491-31794513 CAGGGGATGGGAAAGATAGTGGG - Intergenic
972136909 4:35903960-35903982 CAGGGGAGGGGATACTTGAATGG + Intergenic
972138919 4:35930881-35930903 CAGGAGAAAGGAAAGATGGTTGG - Intergenic
972180020 4:36452581-36452603 CAGAAAAAGGGAGAGTTGGAAGG + Intergenic
972346453 4:38196515-38196537 CAGGAGAAGGGGGAGTTGGAGGG + Intergenic
972723160 4:41721024-41721046 CAGGGGGAGGGAAGGCAGGAGGG + Intergenic
973668514 4:53189371-53189393 TGGGGGAAAGGAAAGTTAGATGG + Intronic
974214948 4:58832979-58833001 AAGGGGAAGGGAAAGGGGAAGGG - Intergenic
974290386 4:59921690-59921712 AAAGGAAAGGGAGAGTTGGAAGG + Intergenic
974381687 4:61148562-61148584 CAGGGACAGGGAAACTCGGAAGG + Intergenic
974518327 4:62945324-62945346 TAGAGGAAGGGTAGGTTGGAGGG + Intergenic
975102238 4:70526913-70526935 CAGGGAAAGGCAGGGTTGGAGGG - Intronic
975942046 4:79659740-79659762 CAGGTGTTGGGACAGTTGGAGGG + Intergenic
976096419 4:81513081-81513103 AAGAGGAAGGGAAAGGGGGAGGG - Intronic
976202863 4:82597223-82597245 GAGGGAAAGAGAAATTTGGAGGG - Intergenic
976264809 4:83180528-83180550 CAGGGTAAGGGGAAGTTGGGGGG - Intergenic
976598655 4:86917582-86917604 GAAGGGAAGGGAAAGAAGGAGGG + Intronic
976753802 4:88477404-88477426 GAGGGGAAGGGGAAGGTGAAGGG + Intronic
976982126 4:91244186-91244208 AAGGGGAAGGAAAAGTGGGAAGG + Intronic
978080541 4:104585211-104585233 CCAGAGAAGGGAAAGTTGAAAGG + Intergenic
979254901 4:118599314-118599336 CTGGGGAAGGGAAAGTGTTATGG - Intergenic
979548123 4:121960271-121960293 AAGGTGAAGGGAAGGTTGGTGGG + Intergenic
980019328 4:127689733-127689755 AAGGGGAAAGGAAAGGGGGAGGG + Intronic
980252018 4:130329334-130329356 CAGGGAAAAAGAAAGTAGGAAGG + Intergenic
981369912 4:143948236-143948258 AAGGGGAAGGGAAGGAAGGAAGG - Intergenic
981390407 4:144183541-144183563 CATGGGAAGTGAAAGAAGGATGG - Intergenic
981530744 4:145751862-145751884 AAGGGAAAGGAAAAGTGGGAAGG - Intronic
981862805 4:149378312-149378334 CAGAGGTAGGAACAGTTGGAGGG + Intergenic
982418782 4:155168937-155168959 TAGGAGAAGGGAGATTTGGAAGG - Intergenic
982729835 4:158944237-158944259 GAGGGGAAGGCAAAGAGGGATGG - Intronic
982959169 4:161814102-161814124 AAGGGGAAGAGAAAGATGGAAGG + Intronic
983487988 4:168353832-168353854 CAGGGTAGGGGAAATGTGGATGG + Intergenic
983712011 4:170729939-170729961 CAGGGGAAGGTAAAAATGGGGGG - Intergenic
984136840 4:175951926-175951948 ATGGTGTAGGGAAAGTTGGAAGG - Intronic
984402061 4:179278992-179279014 CAAGGGAAGGGAAAGGTAAAAGG - Intergenic
1202754909 4_GL000008v2_random:52065-52087 CATGGGAAAGGAATGTAGGAGGG - Intergenic
985718234 5:1474802-1474824 CAGGGGAAGGGCCAGTTGGTGGG + Intronic
985790890 5:1926387-1926409 CAGGGGAAGGGGAAGGCGCAGGG - Intergenic
985884891 5:2670153-2670175 CAGTGGAAGGGGAGGCTGGAGGG - Intergenic
986147224 5:5089702-5089724 TAGGGGAAGGGAAGGTGGAAAGG - Intergenic
986723453 5:10577098-10577120 AAGGGGAAGGGAAAGGGGAAGGG - Intronic
986780571 5:11061625-11061647 AAGGGGAAGGGAATGTTGAATGG - Intronic
987539015 5:19229483-19229505 AAGGGGAAAGGAAAGTAGAAAGG - Intergenic
987911752 5:24155501-24155523 AAGTGGAAGGAAAAGTGGGAAGG + Intronic
988615314 5:32769483-32769505 GAGAGAAAGGGAAATTTGGATGG - Intronic
988801215 5:34698192-34698214 GAGGGGAAGGGAGAGAGGGAGGG - Intronic
989373994 5:40740707-40740729 GAGAGGGAGGGAAGGTTGGATGG - Intronic
989629027 5:43461709-43461731 AAGGGGAGGGAAAAGTGGGAAGG + Intronic
990107659 5:52284355-52284377 AAGGGAAAGGGAAAGACGGAGGG + Intergenic
990363075 5:55041132-55041154 CAGGGGAAGGGATGAATGGATGG + Intergenic
990842601 5:60100462-60100484 GAGAGGAAGGGAAAGCGGGAAGG + Intronic
991510543 5:67371779-67371801 TAGGGGAAGGGAAAGAGGGATGG + Intergenic
991646662 5:68807949-68807971 AAGGGGAAGGGAAAAGGGGAAGG + Intergenic
991663692 5:68974855-68974877 AAGGGGAGGGAAAAGTGGGAAGG + Intergenic
992692660 5:79256152-79256174 AAGGGGAGGGAAAAGTGGGAAGG - Intronic
993710234 5:91217067-91217089 CAGGTGGAAGGAAAGGTGGAAGG + Intergenic
993831918 5:92770747-92770769 AAGGGGAAGGGAAGGAAGGAGGG + Intergenic
993932143 5:93953851-93953873 AAGGGGAGGGGAGAGTGGGAAGG - Intronic
993981319 5:94546139-94546161 AAGGGGAAGGAACAGTGGGAAGG + Intronic
994173739 5:96687065-96687087 CAGGGCCAGGGATCGTTGGATGG + Intronic
995063495 5:107836466-107836488 CAAGGGAAGAGAAGGCTGGATGG - Intergenic
995306028 5:110651454-110651476 AAGGGAAAGGGAAAGAGGGAAGG + Intronic
995583256 5:113622224-113622246 CATTGGAAGGGCAATTTGGAAGG - Intergenic
995882448 5:116858269-116858291 AAGGGGAAGGGAAAGGGGAAGGG - Intergenic
996722927 5:126647678-126647700 CAGGGAAAGAGATAGCTGGAAGG - Intergenic
996860705 5:128062544-128062566 CAGGTGAAAGGGAAGTAGGATGG + Intergenic
997047345 5:130333889-130333911 CAGTGGTAGGGAGAGTCGGAAGG - Intergenic
997313365 5:132909871-132909893 AAGGGGAAGGTAAAGAGGGAAGG + Intronic
997435681 5:133873165-133873187 CAGGGGAAGGGGAAGATTGCGGG + Intergenic
997509144 5:134441467-134441489 CAGGGGAGGGGTTAGTTGAAGGG + Intergenic
998210375 5:140192647-140192669 CAGGGGAAGGGAAGGTTCGGTGG + Intronic
998634062 5:143932563-143932585 AAAGGGAAAGGAAAGTAGGAAGG + Intergenic
999083146 5:148863324-148863346 CATGGGTAGAGAAAGTAGGAAGG + Intergenic
999267566 5:150276795-150276817 TAGAGGAAGGGATGGTTGGACGG + Intronic
999567851 5:152885776-152885798 CAGTAGAAGATAAAGTTGGAGGG - Intergenic
1000079390 5:157830724-157830746 GAGGGGCAGGGAGAGTGGGAGGG - Intronic
1000210284 5:159101437-159101459 AAGGGGAAGAGAAAATGGGAAGG + Intergenic
1000651267 5:163821856-163821878 AAGGGGAGGGAAGAGTTGGAAGG - Intergenic
1000841053 5:166219072-166219094 CAGGGAGAGAGAAAGGTGGAAGG + Intergenic
1001024584 5:168213478-168213500 CAGGGGCTGGGAGAGGTGGAGGG - Intronic
1001104712 5:168843282-168843304 CAGGTGAAGAGGAAGGTGGAGGG + Intronic
1001479958 5:172081874-172081896 AAGGGGAAGGGGAGGATGGAAGG - Intronic
1001490817 5:172153894-172153916 CAGAGGAAGGGACATTTGAACGG - Intronic
1001565153 5:172695303-172695325 GAGGGGGAGGGAAAGGAGGAAGG + Intergenic
1002020421 5:176361130-176361152 CAGGGAAAGGGAAAGGGGAAGGG - Intronic
1002725089 5:181289380-181289402 CTGGGGAAGGGAAAGTGTTATGG - Intergenic
1003370592 6:5522215-5522237 CAAGGGAAGGGAGAGCTGCAGGG + Intronic
1003550455 6:7098331-7098353 CAGGTGCAGGGAAAGCAGGAGGG - Intergenic
1003692884 6:8372249-8372271 CAGGGGAGGGGAGAGAAGGAGGG - Intergenic
1003990995 6:11486426-11486448 CAGGGGTATGGTAAGTGGGAAGG + Intergenic
1004275749 6:14233764-14233786 CTGAGGAAGAGAAATTTGGAAGG + Intergenic
1004991533 6:21143973-21143995 TAAGGGAAGAGAGAGTTGGATGG + Intronic
1005018776 6:21398425-21398447 GAGGGGAAGGGACAGAGGGAGGG - Intergenic
1005319818 6:24642099-24642121 GAAGGGAAGGGAAAGAAGGAAGG + Intronic
1005715643 6:28544552-28544574 GAGTGGAGGGGAGAGTTGGAGGG + Intergenic
1006102310 6:31693150-31693172 CTGAGGAAGGGAAAGATGCAGGG + Intronic
1006459282 6:34148940-34148962 CAGGGGAAGGGGAAGGGTGAAGG + Intronic
1006718654 6:36136119-36136141 CAAGGAGTGGGAAAGTTGGAGGG + Intronic
1006903685 6:37518909-37518931 CAGGGGAGGGAACAGTGGGAGGG - Intergenic
1006995405 6:38255248-38255270 CTGGGGCTGGGAGAGTTGGAGGG + Intronic
1007063823 6:38969481-38969503 CAGGGGAAGGGACAGAGTGATGG + Intronic
1007465015 6:42045775-42045797 CAGGGAAAGGGAAACTTGGCAGG + Intronic
1007776022 6:44224797-44224819 CAGGCCAAGGCATAGTTGGAGGG + Intronic
1008393587 6:50981310-50981332 AAAGAGAAGGGAAAGTTGGTGGG + Intergenic
1008482755 6:52003632-52003654 CAGGTGAAGGAAGAGTTTGAAGG - Intronic
1008810027 6:55485202-55485224 CAGAAGATGGGAAATTTGGAGGG - Intronic
1009672547 6:66774603-66774625 CAGGAGGAGGGAAAGAGGGAAGG + Intergenic
1009780393 6:68261263-68261285 AAGTGGTTGGGAAAGTTGGAGGG - Intergenic
1009890703 6:69677526-69677548 AAGGGCAAGGGAAGGTTGAAAGG + Intronic
1010097461 6:72063355-72063377 TAGAGGAAGGGAACGTGGGAGGG + Intronic
1010507244 6:76675615-76675637 AAGGGGAAGGGAAAGGGGAAGGG - Intergenic
1011258435 6:85448121-85448143 CAGTGGAAGGTAAAGTTGGCTGG + Intergenic
1011330241 6:86196756-86196778 CTGGAGAAGGGAAAGTTTGTGGG + Intergenic
1011523362 6:88236061-88236083 CAGATTAAGGGAAGGTTGGAAGG - Intergenic
1012049983 6:94328971-94328993 AAGGGGAAGGAAGAGTGGGAAGG + Intergenic
1012620499 6:101339125-101339147 AAGGGGAAGGAATAGTGGGAAGG - Intergenic
1013173709 6:107659887-107659909 CAGGGGAAGGGGAGGCGGGAGGG + Exonic
1013565240 6:111352445-111352467 CAGGGGAAGGTGAAGTGTGAGGG + Intronic
1013587617 6:111593667-111593689 CAGGGAAAGGGAGAGACGGAGGG - Intronic
1013615398 6:111838300-111838322 CATGGGAAGGGAAAGTTGGTAGG - Intronic
1014629687 6:123773321-123773343 CAGAGGAAGGGACACATGGAGGG - Intergenic
1015113404 6:129619371-129619393 AAGGGGGAGGGAAAGGGGGAGGG + Intronic
1015113410 6:129619383-129619405 AAGGGGGAGGGAAAGGGGGAGGG + Intronic
1015367610 6:132414643-132414665 AAGGCAAAGGGAAAGTGGGATGG + Intergenic
1015659500 6:135559326-135559348 CAGGGGAAGGGGGAATAGGAAGG + Intergenic
1015959503 6:138632143-138632165 AAGGGGAGGGAAAAGTGGGAAGG + Intronic
1016449088 6:144162673-144162695 TAGGGGATGGGAAAGGTTGAGGG + Intronic
1016779707 6:147944104-147944126 GAGGGGGAGGGAAAATTGGATGG - Intergenic
1016830107 6:148425710-148425732 GAGGGGAAGGGAGAGGGGGATGG - Intronic
1017036283 6:150270069-150270091 GAGGGGGAGGGGAAGCTGGATGG + Intergenic
1017198797 6:151730275-151730297 CAGGGGATGTGAAAGCTGGCAGG - Intronic
1017265805 6:152444280-152444302 CATGGGAAGGAAGAGTTGAATGG - Intronic
1017618396 6:156269724-156269746 CAGAGGTAGGGCAAGGTGGAAGG - Intergenic
1018031818 6:159847220-159847242 GAGGGGAAAGGAAAGTTAAATGG + Intergenic
1018165225 6:161087576-161087598 TTGGGAAAGGGAAAGTGGGAAGG - Intronic
1018671164 6:166178470-166178492 TAGGAGGAGGGAAAGCTGGAAGG + Intergenic
1019159077 6:170057617-170057639 AGGGGGAAGGGAAAGGGGGAGGG - Intergenic
1019159101 6:170057664-170057686 AGGGGGAAGGGAAAGGGGGAGGG - Intergenic
1019371463 7:664110-664132 CAGGCGAAGGGAAGGTTGCGTGG - Intronic
1019410165 7:903289-903311 CAGGGGACGGGCACGTGGGAGGG + Intronic
1019860717 7:3656189-3656211 AAGGAGAAGGGAAGGATGGAGGG - Intronic
1019950756 7:4370423-4370445 CTGGGGAAATGAAGGTTGGAAGG + Intergenic
1021128252 7:16880040-16880062 AAGGGGAAGGGAAGGAGGGAGGG - Intronic
1021526505 7:21594525-21594547 CAGGGCAAGGGAATTCTGGAGGG + Intronic
1021674603 7:23067651-23067673 CAGGGGAAGGGAAAGGTGGATGG + Intergenic
1022080264 7:27012969-27012991 AAGGGGAAGGAAGAGTGGGAAGG + Intergenic
1022223528 7:28339858-28339880 AAGGGGAAGGAAGAGTGGGAAGG - Intronic
1022358994 7:29641640-29641662 AAGGGTTAGGGACAGTTGGATGG + Intergenic
1022553324 7:31263306-31263328 CAGAGGCTGGGAAAGGTGGATGG - Intergenic
1022823725 7:33987417-33987439 CTTGAGAAGGGAATGTTGGATGG - Intronic
1023215429 7:37857558-37857580 CAGGGAAAGGAAAAGTAAGATGG + Intronic
1023911138 7:44557668-44557690 AAGGGGAAGGGAAAGGGGAAGGG + Intergenic
1024268254 7:47622795-47622817 CAGAGGAAGGGAGAGAGGGAGGG - Intergenic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1024903969 7:54354707-54354729 AAGGGAAAGGGAAAGTAAGAGGG - Intergenic
1025108988 7:56196896-56196918 GAGGGGAAGGGAAAGGGGGAGGG - Intergenic
1025187309 7:56871207-56871229 CTGGGGAAGGGAAAGTGTTATGG + Intergenic
1025188728 7:56881015-56881037 CTGGGGAAGGGAAAGTGTTATGG + Intergenic
1025683206 7:63695905-63695927 CTGGGGAAGGGAAAGTGTTATGG - Intergenic
1025684616 7:63705713-63705735 CTGGGGAAGGGAAAGTGTTATGG - Intergenic
1026038425 7:66846145-66846167 CTGGGGAAGGGAAAGTGTTATGG - Intergenic
1026144928 7:67738478-67738500 CAGGGGCAGAGAGAGTTGGAGGG - Intergenic
1026807629 7:73437893-73437915 CAGTGGAAGGGAAGATGGGAAGG + Intergenic
1027212976 7:76165441-76165463 CTGGGGAAGGGAAAGTGTTATGG + Intergenic
1027604947 7:80288395-80288417 AAGGGGAAGGAAGAGTGGGAAGG + Intergenic
1027820720 7:83040564-83040586 CTGGGGAAGAGACAGCTGGAAGG - Intronic
1027996622 7:85433536-85433558 CAGGGGTAGGAACAGTTTGAAGG + Intergenic
1028093394 7:86730790-86730812 CAGGGAAAAGGAAACTTTGAGGG + Intronic
1028683041 7:93560454-93560476 AAGGGGAAGGTAAAATTTGAAGG - Intronic
1029111927 7:98217101-98217123 GAGGGGAAGGGAAGGGTGGGAGG + Exonic
1029374241 7:100168379-100168401 CATGGGAAGGGAGAGATGGATGG - Intronic
1029552506 7:101244918-101244940 GAGGGAAAGGGAAGGTCGGAGGG - Intronic
1029795855 7:102893830-102893852 AAGGGGAAGGGAAAGGCGAAGGG + Intronic
1030126264 7:106155386-106155408 AAGGGAAAGGAAAAGATGGAGGG - Intergenic
1030127208 7:106165530-106165552 CCGGGGAATGGAAAGATAGATGG + Intergenic
1030384065 7:108847416-108847438 GAGGGGAGGGGGAAGTGGGAGGG - Intergenic
1031306320 7:120131401-120131423 AAGGGGAGGGAAAAGTGGGAAGG + Intergenic
1031367819 7:120924914-120924936 CAGGGGCAGGGGAGGTTTGAGGG - Intergenic
1031453254 7:121948609-121948631 CAAGGGCAGGGAAAGTGCGAAGG + Intronic
1032172581 7:129597714-129597736 GAGGGGAGGGGAAGGTAGGAGGG + Intergenic
1032496855 7:132369166-132369188 GAGGGGAAGAGGAAGTTGAAAGG - Intronic
1033044958 7:137953538-137953560 CAGAGGAGGGGAGAGTTGGGTGG + Intronic
1033301324 7:140188709-140188731 AAGGGGAAGGGACAGAGGGAGGG + Intergenic
1033951914 7:146795467-146795489 CAAGGGAGTGGAAAGTGGGATGG + Intronic
1034233180 7:149548556-149548578 CAGGGAAAGTGAAAGTTGCAAGG - Intergenic
1034417017 7:150970607-150970629 CTAGAGAAGGGAAAGGTGGAGGG + Intronic
1034625186 7:152487250-152487272 GAGGGGAAGGGAAAGGGGAAGGG - Intergenic
1034625197 7:152487273-152487295 GAGGGGAAGGGAAAGGGGAAGGG - Intergenic
1034625208 7:152487296-152487318 GAGGGGAAGGGAAAGGGGAAGGG - Intergenic
1034625219 7:152487319-152487341 GAGGGGAAGGGAAAGGGGAAGGG - Intergenic
1034650084 7:152683420-152683442 CAGGGGACGGGAGAGTGGGGTGG + Intergenic
1034928736 7:155143863-155143885 GAGGGGCAGGGAAAGTGAGAAGG + Intergenic
1035856958 8:2985966-2985988 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
1035909952 8:3555186-3555208 GAGGTGTAGGGAAAGATGGACGG + Intronic
1036505040 8:9347462-9347484 AAGGGGAAGGGAAGGGAGGAGGG + Intergenic
1036624642 8:10458083-10458105 CAGGGGAAGAGAAGGGTGTACGG + Intergenic
1037700159 8:21266673-21266695 CAGGGAGAGGGAGAGATGGAGGG + Intergenic
1038610385 8:29055367-29055389 AAGGGGAAGGGAAGGAAGGAGGG - Intronic
1038675104 8:29616162-29616184 AAGGGGAAGGGAAAGGGGAAGGG + Intergenic
1038860932 8:31388088-31388110 GAGGGGAAGGGAAAGGAAGAGGG - Intergenic
1039241847 8:35565922-35565944 CAGGAGAAGGCAGAGTTGGCAGG - Intronic
1040599329 8:48869211-48869233 CAGTGGACGGGGAAGTGGGAAGG + Intergenic
1041284832 8:56249545-56249567 AAGGGGAAGGGAAAGGGGAAGGG - Intergenic
1042144926 8:65718150-65718172 CGGGGGAGGGGAAGGTTGGTAGG - Exonic
1042192494 8:66201629-66201651 GGGGTGAAGGAAAAGTTGGATGG + Intergenic
1042397806 8:68311851-68311873 AGGGGGAAGGGAAAGAAGGAAGG - Intronic
1042663964 8:71185963-71185985 AAGAGGAAGGGAAAGAGGGAGGG - Intergenic
1042810604 8:72821809-72821831 AAGGTGAAGGGAAGGATGGAGGG + Intronic
1042871712 8:73405656-73405678 TTGGGGAAGGGGAAGCTGGAAGG - Intergenic
1043740144 8:83801264-83801286 AAGGGGAAGGAAGAGTGGGAAGG - Intergenic
1043938288 8:86167979-86168001 AAGGGGAAGGGGAAGGGGGAGGG + Intergenic
1044733253 8:95250041-95250063 CAGGGGAAGGGAGACATGGGTGG - Intronic
1045679280 8:104641957-104641979 AAGGGGAAGGGAAGGAGGGAGGG - Intronic
1045766061 8:105670589-105670611 CTGGGGAAGGGAAAGTTTACTGG - Intronic
1045922190 8:107544366-107544388 GAGGGGAGGGGAAAGATGAATGG + Intergenic
1046015223 8:108597040-108597062 AAGGGAAAGGGAAAGTTGTTGGG - Intergenic
1046592210 8:116220442-116220464 GAGGGAAAGGGAAAGAGGGAAGG - Intergenic
1046677155 8:117122509-117122531 AAGGAGAGGGAAAAGTTGGATGG - Intronic
1047138299 8:122106774-122106796 AAGGGGAAGGAAGAGTAGGAGGG - Intergenic
1047701395 8:127452702-127452724 AAGGGGAAGGGAGAGGGGGAAGG + Intergenic
1048207981 8:132430972-132430994 TGGGAGAAGGGAAAATTGGAAGG - Intronic
1048676790 8:136792992-136793014 CAGGGGACAGGAAAGTGGGAAGG - Intergenic
1048894869 8:138982813-138982835 AAGGTGAAGGCCAAGTTGGAAGG - Intergenic
1048995194 8:139789742-139789764 CAGGGGAAGGCCAGGTAGGAGGG + Intronic
1049298994 8:141859815-141859837 CAGGGGAGAGGAAAGGTGGCTGG - Intergenic
1049515763 8:143054394-143054416 CAGGGGATGGTAGAGTTGGATGG - Intronic
1049737768 8:144218828-144218850 CAGGGGAGGGGAAGGGAGGAGGG - Intronic
1049999548 9:1062366-1062388 CAGGAGAGGGGATAGTTGGGAGG - Intergenic
1050404313 9:5291963-5291985 CAGGTGACTGGAAAGTTGGGAGG + Intergenic
1050940430 9:11451125-11451147 CAGGGGTTGGAACAGTTGGAGGG + Intergenic
1051262010 9:15273714-15273736 CAGTGGAATGGAATGTTGGGTGG - Intronic
1052615083 9:30828852-30828874 CAGAGGAAGGGTAATGTGGATGG + Intergenic
1053040115 9:34863047-34863069 AAGGGGAAGGAAGAGTGGGATGG + Intergenic
1053361221 9:37487947-37487969 CAGGGGAAGGGACAGTGGGAAGG + Intronic
1054856223 9:69902200-69902222 AAGGGGAAGGGAAAGCAGAAAGG - Intronic
1054947831 9:70814883-70814905 GAGGGGGAGGGAAAGAGGGAGGG - Intronic
1055004109 9:71485736-71485758 CAGGGCAAGTGAAAATGGGATGG + Intergenic
1055073800 9:72193864-72193886 AAGGGGAAGGAAGAGTGGGAAGG - Intronic
1055150886 9:72997781-72997803 CAGGGGCAGGCAAGGTTGCAGGG + Intronic
1055235576 9:74118786-74118808 TAGAGGAAAGGAAAGTAGGAAGG + Intergenic
1055447305 9:76395635-76395657 AAGGGGAAGGGAAAGTGAAAGGG + Intergenic
1055517611 9:77049068-77049090 CGGAGGAAGGGAGAGCTGGAAGG + Intergenic
1055581479 9:77711145-77711167 GAGGGGAAGGGGAAGGAGGAGGG - Intergenic
1055930291 9:81553229-81553251 CATGGGGTGGGAATGTTGGAAGG + Intergenic
1056606841 9:88093001-88093023 GAGGGGCTGGGAAATTTGGATGG - Intergenic
1056879828 9:90380517-90380539 CTGGGGGTGGGGAAGTTGGAAGG - Intergenic
1056893985 9:90523526-90523548 CAGGGGAAGGAAAAATGGAATGG + Intergenic
1056954734 9:91072947-91072969 CAGGGGAAGAGAAGATGGGAAGG - Intergenic
1057291021 9:93807631-93807653 GAGGGGAAGGGACAGCTGGCAGG - Intergenic
1057479512 9:95433779-95433801 AAGGGGAAGGGAAGGAGGGAGGG - Intergenic
1057593952 9:96398740-96398762 CTGGGGAAGGGAAAGAGAGAGGG - Intronic
1057644494 9:96860043-96860065 GAGGGGAGGGGAGAGTGGGAAGG + Intronic
1058482515 9:105411344-105411366 CAGGGGAAGGGGAAGGAGAAGGG - Intronic
1058780223 9:108325621-108325643 AAGGGGAAGGAAGAGTGGGAAGG + Intergenic
1058817564 9:108699042-108699064 AAGGGGAAGGGAAAGGGGGATGG + Intergenic
1058888163 9:109338734-109338756 CAGGGGGAGGGAAGGTTGGTTGG - Intergenic
1059137806 9:111823728-111823750 GAAGGGAAGGGAAAGTAGGGAGG + Intergenic
1059350140 9:113658573-113658595 GAGAGGAAGGGAAAGAAGGAGGG + Intergenic
1059561472 9:115338830-115338852 AAGGAGAAGGGAAATGTGGAAGG - Intronic
1059665692 9:116444578-116444600 CATGGGAAGTCAAAGCTGGAAGG - Intronic
1059976429 9:119722805-119722827 GAGAGGAAGGGACAGTGGGAAGG - Intergenic
1060024540 9:120160183-120160205 ATGAGAAAGGGAAAGTTGGAGGG + Intergenic
1060049608 9:120368754-120368776 CAAGGGACAGGAGAGTTGGAAGG + Intergenic
1060735725 9:126065530-126065552 GAGGGGGAGGGAAAGGAGGAAGG - Intergenic
1060750488 9:126165365-126165387 CGGGGGAAGAGAAAGTCGGGAGG - Intergenic
1060894864 9:127211119-127211141 GAAGGGAAGGGAGTGTTGGAAGG + Intronic
1061331894 9:129899818-129899840 AAGGGGAAGGGAAGGTAGGAAGG + Intronic
1061367356 9:130178876-130178898 CAGGGGAGGGGAAAGAAGGGAGG - Intronic
1061645688 9:131999219-131999241 CAGGGTAAGAGAGAGTTGGAAGG + Intronic
1062123625 9:134847875-134847897 GAGAGGAAGGGGAAGTGGGAGGG + Intergenic
1062169091 9:135124563-135124585 CAGGGGAAGGGAAGAAAGGAAGG + Intergenic
1062446556 9:136597705-136597727 CAGGGGGAGGGAAGGGTGGAGGG + Intergenic
1062750233 9:138247023-138247045 CTGGGGAAGGGAAAGTGTTATGG - Intergenic
1203697959 Un_GL000214v1:114723-114745 GAGGGGAAGGTGAAGTTTGAGGG + Intergenic
1203756148 Un_GL000218v1:128786-128808 CATGGGAAAGGAATGTAGGAGGG + Intergenic
1203715515 Un_KI270742v1:141456-141478 CATGGGAAAGGAATGTAGGAGGG + Intergenic
1203535702 Un_KI270743v1:36774-36796 CATGGGAAAGGAATGTAGGAGGG - Intergenic
1203649763 Un_KI270751v1:105032-105054 CATGGGAAAGGAATGTAGGAGGG + Intergenic
1185540489 X:899393-899415 AAGGGGAAGGGGAAGTGGAAGGG - Intergenic
1185581452 X:1213404-1213426 GAGGGGAGGGGATAGGTGGAGGG - Intergenic
1185595824 X:1306130-1306152 CAGAGGCAGAGAAAGATGGAGGG + Intronic
1186552095 X:10517017-10517039 CAGGGGTGGGGAGAGTTGGGTGG + Intronic
1186864624 X:13707334-13707356 GGGGAGAAGGGAGAGTTGGAGGG + Intronic
1187116356 X:16356079-16356101 CAGGCTAAATGAAAGTTGGATGG + Intergenic
1187216097 X:17278076-17278098 CAGAGGAAGAGAAAGTGAGAAGG + Intergenic
1187337227 X:18391916-18391938 CAGGGGGAGGGAATTTTGGAAGG + Intergenic
1187483313 X:19678136-19678158 CTGATGAAGGCAAAGTTGGAAGG - Intronic
1187492763 X:19767680-19767702 CAGGGGAAGGGAGATTAGCAGGG - Intronic
1187742221 X:22368325-22368347 CAGAGAAAGGGAAAACTGGAGGG - Intergenic
1189222076 X:39381233-39381255 CAGGGGAAAGGAGAGGTGTAGGG - Intergenic
1189289146 X:39872967-39872989 GAGGGGAAGGGAGAGAAGGATGG - Intergenic
1189364995 X:40381200-40381222 CAGGGTATGGGAGAGGTGGAGGG - Intergenic
1189858387 X:45247472-45247494 AAGGGGAAGGAAGAGTGGGAAGG - Intergenic
1190210641 X:48443921-48443943 CTGGGGAAGGGAAAGGCAGAGGG + Intergenic
1190298192 X:49040744-49040766 GTGGGGAAGGGAAAGGGGGATGG - Intronic
1190534624 X:51413563-51413585 GAGAGGGAGGGAAAGATGGAGGG - Intergenic
1190726191 X:53192501-53192523 CAGGGGAAGGGAGAGGGAGAAGG + Exonic
1191676287 X:63795359-63795381 GAGGAGAAGGGAAAGAAGGAAGG + Intergenic
1191851121 X:65587221-65587243 AAGGGGAAGGGAAAGGGGGCGGG + Intergenic
1191991172 X:67038699-67038721 TATGGGAAGGAAAAGTGGGAAGG - Intergenic
1192151051 X:68712629-68712651 CAGGGGGTGGGAGAGTGGGAGGG + Intronic
1192330418 X:70170885-70170907 CAGGGAAAGGGAAAGTAGGTGGG - Intergenic
1192677665 X:73215238-73215260 CTGGGGAGGGGAGAGGTGGATGG + Intergenic
1192726216 X:73755620-73755642 CAGAAGAAGGGAGAGTGGGAGGG - Intergenic
1193698794 X:84739724-84739746 CAGGGAAGGGGAAAATTGGCAGG - Intergenic
1193799888 X:85922435-85922457 CCTGGGAAGGCAAAATTGGACGG + Intronic
1194320398 X:92439748-92439770 CAGAAGAAGGGATAGTAGGAAGG - Intronic
1194321033 X:92446786-92446808 CAGGGGTTGGAACAGTTGGAGGG + Intronic
1194685026 X:96903103-96903125 CAGGGGTAAGGAGAGTTGAAGGG - Intronic
1194889876 X:99364979-99365001 AAGGGGAAGGAAGAGTTGGAAGG + Intergenic
1195026702 X:100884698-100884720 CAGGGGAGGGCATTGTTGGATGG - Intergenic
1195142843 X:101980597-101980619 CAGGAGCAAGGACAGTTGGATGG - Intergenic
1195234928 X:102887846-102887868 AAGGGGAAGGGAAAGGGGAAGGG - Intergenic
1195669732 X:107459511-107459533 GTGGGGAGGGGAAAGTTGGTGGG - Intergenic
1196018851 X:110967986-110968008 CAAGGGTAAGGAATGTTGGAGGG - Intronic
1196193649 X:112818679-112818701 CGGGGTAAGGGAGAGTTGGAGGG + Intronic
1196845365 X:119892936-119892958 CAGGGGAATGGAGGGTGGGAAGG - Intergenic
1197019712 X:121671974-121671996 CACGGGAAGGGAATGTGGGTGGG + Intergenic
1197148298 X:123192490-123192512 CAAGGTAAGGGAAGGATGGAGGG - Intronic
1197158259 X:123293614-123293636 GTGGGGAAGGGACAGTAGGAAGG + Intronic
1197361065 X:125504481-125504503 AAGGGGAAGGAAGAGTGGGAAGG - Intergenic
1197362507 X:125523131-125523153 CAGGGGAATGGATAGAGGGAGGG - Intergenic
1197792636 X:130270786-130270808 CAGAGGCAGAGGAAGTTGGATGG - Intergenic
1197862393 X:130984676-130984698 CAGGGGAAGGGAAGGCTGGCAGG + Intergenic
1198275284 X:135093933-135093955 CAGAGGAAGGGAAGGCAGGAAGG - Intergenic
1199430903 X:147758732-147758754 CAAGGGAAGGGAAATGTGGCAGG - Intergenic
1199607932 X:149591630-149591652 GAGAGGAAAGGAAAGTAGGAAGG + Intergenic
1199631188 X:149777726-149777748 GAGAGGAAAGGAAAGTAGGAAGG - Intergenic
1199783215 X:151082156-151082178 CAGGGAAAGGGCTAGTTGGAGGG + Intergenic
1199876398 X:151932280-151932302 AAGGGGAATGGTGAGTTGGAGGG - Intergenic
1199893086 X:152107584-152107606 AAGGGGAACGGTGAGTTGGAGGG + Intergenic
1199945139 X:152659201-152659223 AAGGGGAAGGGAAAGTAGTGGGG + Intergenic
1200112107 X:153745639-153745661 CAGGGGAAGGAAAATGTGGCGGG + Intergenic
1200229637 X:154437543-154437565 CAGGGGTAGGGAAGATGGGAGGG - Intronic
1200629150 Y:5559933-5559955 CAGGGGTTGGAACAGTTGGAGGG + Intronic
1200648956 Y:5817404-5817426 AAGGGGAGGGGAGAGTCGGAAGG - Intergenic
1200814029 Y:7513219-7513241 CAGGGGAATGGTAAGCGGGATGG + Intergenic
1201451153 Y:14116210-14116232 GAGGGGAGGGGAAAGAAGGAGGG + Intergenic
1201515215 Y:14812990-14813012 CAGGGAGAGGGAAGGTGGGAGGG - Intronic
1201643200 Y:16200502-16200524 AAGGGTTAGGGACAGTTGGATGG - Intergenic
1201659615 Y:16384819-16384841 AAGGGTTAGGGACAGTTGGATGG + Intergenic