ID: 1163805358

View in Genome Browser
Species Human (GRCh38)
Location 19:19393489-19393511
Sequence GCATGAAAATGTTTTATCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 342}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163805358_1163805364 -5 Left 1163805358 19:19393489-19393511 CCTAAGATAAAACATTTTCATGC 0: 1
1: 0
2: 1
3: 32
4: 342
Right 1163805364 19:19393507-19393529 CATGCTTGGTGATGGGGGTCTGG 0: 1
1: 0
2: 1
3: 24
4: 266
1163805358_1163805366 20 Left 1163805358 19:19393489-19393511 CCTAAGATAAAACATTTTCATGC 0: 1
1: 0
2: 1
3: 32
4: 342
Right 1163805366 19:19393532-19393554 GTGAGCAGGACTGACACAGCTGG No data
1163805358_1163805365 6 Left 1163805358 19:19393489-19393511 CCTAAGATAAAACATTTTCATGC 0: 1
1: 0
2: 1
3: 32
4: 342
Right 1163805365 19:19393518-19393540 ATGGGGGTCTGGCAGTGAGCAGG 0: 1
1: 0
2: 2
3: 25
4: 299
1163805358_1163805363 -10 Left 1163805358 19:19393489-19393511 CCTAAGATAAAACATTTTCATGC 0: 1
1: 0
2: 1
3: 32
4: 342
Right 1163805363 19:19393502-19393524 ATTTTCATGCTTGGTGATGGGGG 0: 1
1: 0
2: 3
3: 27
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163805358 Original CRISPR GCATGAAAATGTTTTATCTT AGG (reversed) Intronic
900283171 1:1885074-1885096 TCATAAAAATATTTTATCTATGG + Intronic
901364772 1:8737113-8737135 TCATTAGAATGTGTTATCTTTGG - Intronic
902031468 1:13425862-13425884 GCATGAAAATGTTTTGCCATTGG + Intergenic
903615428 1:24651042-24651064 GCATCTAAATGTTTTATGTTTGG + Intronic
904162579 1:28532410-28532432 GCATGGAAGTGGATTATCTTTGG - Intronic
904290638 1:29483715-29483737 GCATGGAAGTGTTTGAGCTTTGG - Intergenic
904557740 1:31376206-31376228 GCATTTAAATGTATTATCTCGGG - Intronic
906457905 1:46013302-46013324 GTTTGAAAATGTATGATCTTAGG - Intronic
907143082 1:52206641-52206663 GCATGAAAATGCTTGAACCTGGG - Intronic
908066220 1:60408067-60408089 GCATTAAGATTTTTCATCTTGGG + Intergenic
908119906 1:60976253-60976275 GGATGAAAATGATTTATGTTGGG - Intronic
908514387 1:64877301-64877323 TCAGGCAAATGTTTTAGCTTAGG + Intronic
908664377 1:66473796-66473818 GGATGAAAGTGTTTCATCTCAGG + Intergenic
909043372 1:70680495-70680517 TGATGAAAATATTTTATCATAGG + Intergenic
909133247 1:71766078-71766100 GCAGGAAAATGCTTGAACTTGGG + Intronic
909258305 1:73453198-73453220 TCATTAAAATGTTTTTTATTTGG - Intergenic
909288045 1:73846163-73846185 GAATGACTATGTTTAATCTTGGG - Intergenic
910528263 1:88205989-88206011 GCAGGAAACTGTTTTCTCTGTGG - Intergenic
910576222 1:88767151-88767173 GCATTAAAATGTTCTCTTTTAGG - Intronic
911070430 1:93827834-93827856 GCATGCCAATGTCTTATTTTGGG - Intronic
912218702 1:107647336-107647358 ACATGTAGATGTTTTATCCTGGG + Intronic
915051660 1:153081407-153081429 GGTTGAAAGTGTTTTATTTTAGG - Intergenic
915053247 1:153099978-153100000 GGTTGAAAGTGTTTTATTTTAGG - Intronic
916259658 1:162828788-162828810 GCATGATAATGTGCTAGCTTAGG - Intronic
917608599 1:176662795-176662817 GCATGAAATTGTTTCCTTTTTGG + Intronic
917785725 1:178455653-178455675 ACATGAAAAGGGTTTATCTTTGG - Intronic
918034095 1:180849433-180849455 GCTTTAAAATGCATTATCTTGGG + Intronic
918446423 1:184621668-184621690 ACATGAGCATGTTTCATCTTTGG - Exonic
918751372 1:188274983-188275005 GGCTAAAAATGTATTATCTTAGG - Intergenic
918893412 1:190306974-190306996 TCATGGAAATGATTTATTTTTGG - Intronic
919217984 1:194585342-194585364 TCCTGAAAATGTTTTACCTCAGG - Intergenic
919249930 1:195041255-195041277 ACATAAAGACGTTTTATCTTGGG + Intergenic
919270916 1:195343512-195343534 CCAAGAAAATGTTTTCTGTTTGG + Intergenic
919374616 1:196778660-196778682 TCAAGAAAATGTTTTATTTCTGG + Intronic
920139805 1:203800930-203800952 CCGTGAAATTGTTTTATATTTGG + Exonic
924392674 1:243580434-243580456 GCAGGACAATGTTTTAAATTTGG + Intronic
1063751150 10:8948618-8948640 GCATAGAAATGTATTATCTACGG + Intergenic
1064342038 10:14495991-14496013 GCATGAAATCTTTTTTTCTTTGG - Intergenic
1065334458 10:24642126-24642148 GCATTAAAATGTTTTAAAGTGGG - Intronic
1065523859 10:26597758-26597780 ACATGGAAATATTCTATCTTAGG + Intergenic
1066193541 10:33077491-33077513 GCATGAGAATCATTTAACTTGGG + Intergenic
1066283867 10:33944995-33945017 GCATCTAAATGCTTTATTTTAGG - Intergenic
1067536769 10:47116470-47116492 GCAGGAAAATGTATGAGCTTTGG - Intergenic
1068356563 10:55917320-55917342 GCATGCAAATCACTTATCTTGGG - Intergenic
1068582830 10:58761748-58761770 GCATGGAAATCTTTGATTTTTGG + Intronic
1068737436 10:60430335-60430357 GAATGACAATGTTTGGTCTTTGG - Intronic
1068878782 10:62026998-62027020 TCATGCATATGTTTCATCTTTGG - Intronic
1069070788 10:63988749-63988771 GGATGTAAATCTTTTTTCTTTGG - Intergenic
1069198590 10:65585313-65585335 GTATGAAAAAGTTTAATTTTTGG + Intergenic
1069307739 10:66992615-66992637 GGATGAAAATGTTTTATCCCAGG + Intronic
1071039116 10:81285431-81285453 TCATGAAAATATTCTATCTTTGG - Intergenic
1071595052 10:86915633-86915655 GCAGGAAATTGTTTTAACTGGGG + Intronic
1075204191 10:120432464-120432486 GCATAATAATGTCTTAGCTTGGG - Intergenic
1077677494 11:4208670-4208692 GCATGAAAATGTTTAATAAAAGG + Intergenic
1078795190 11:14585235-14585257 GAAAGAAAATGTTATACCTTTGG - Intronic
1078884831 11:15489894-15489916 GCATGGAACTGTCTGATCTTTGG + Intergenic
1079484037 11:20915101-20915123 AGATGAAAATCTATTATCTTTGG + Intronic
1079990383 11:27240376-27240398 GCATAAACATGGTTTATATTTGG + Intergenic
1080529096 11:33156874-33156896 GCATCAAAATATTATTTCTTAGG + Intronic
1081235970 11:40647597-40647619 GCATGAAAATATTTTCTGTTGGG - Intronic
1081260346 11:40952283-40952305 CCCTGAAAATATTTTATTTTGGG - Intronic
1081393235 11:42554727-42554749 GCATAAAAATGTAAAATCTTAGG + Intergenic
1082576596 11:54813294-54813316 ACATAACAATGTTTTTTCTTGGG + Intergenic
1083913144 11:65721559-65721581 CATTGAAAATGTTTTATCTGTGG + Intergenic
1086176064 11:83892475-83892497 ACACTAAAATGTTTTGTCTTTGG + Intronic
1086465997 11:87053930-87053952 ATATGAATCTGTTTTATCTTTGG + Intronic
1086539974 11:87897377-87897399 GCTTCTAAATATTTTATCTTGGG + Intergenic
1087448694 11:98289317-98289339 TCATGAAAATGTGCTTTCTTTGG - Intergenic
1087958351 11:104317771-104317793 GCATGAAAATCTTTTGTTGTGGG + Intergenic
1088451298 11:109984058-109984080 ACATGAAAATGTTTGATCACAGG + Intergenic
1088525970 11:110755375-110755397 TGTTGAAAATGTTTTATCTCAGG + Intergenic
1089927167 11:122270901-122270923 GCCTGAATTTGTTTTCTCTTTGG + Intergenic
1090778945 11:129989709-129989731 GCTTTAAAATGTTTTAACTAGGG + Intronic
1091894578 12:4090886-4090908 GAATTTAAATGTTCTATCTTTGG - Intergenic
1092439433 12:8485278-8485300 GCATGAGAATGTTTTACATGGGG + Intergenic
1092514381 12:9193658-9193680 GCATGAAAACTTTTTAGCTAGGG + Intronic
1093189801 12:16060778-16060800 GCATGAAACTCTGTTTTCTTTGG - Intergenic
1093419240 12:18955854-18955876 GCATATAAATGTTTTTTCTCTGG - Intergenic
1093506902 12:19877773-19877795 GGATGACCATGTTTTAACTTAGG - Intergenic
1093565153 12:20593720-20593742 AAAAGAAAATATTTTATCTTTGG - Intronic
1093914098 12:24781348-24781370 CAATGCAAATGTATTATCTTTGG + Intergenic
1094332418 12:29309129-29309151 TCAGAAAATTGTTTTATCTTTGG - Intronic
1094677841 12:32638294-32638316 GCATGCCAATGTGTGATCTTGGG + Intronic
1094784506 12:33830710-33830732 GCTTGATAATGTTTTATGTATGG - Intergenic
1096832566 12:54325635-54325657 TCAGGAAACTGTTTTGTCTTCGG + Intronic
1097448582 12:59707824-59707846 ACATGCAAATGTTTCATCTCTGG + Intronic
1099564487 12:84225385-84225407 GCTTGAAAATATATTATCTTAGG + Intergenic
1099886797 12:88541136-88541158 GTGTGAAAATGTGTTATCTGAGG + Intronic
1100581792 12:95946364-95946386 GAATGAAAATGTCCTATTTTAGG - Intronic
1101260482 12:103024677-103024699 GCATGAATGTGCTTTATTTTTGG + Intergenic
1101461344 12:104898194-104898216 GCCTGAAGATGTGTTATGTTTGG + Intronic
1102446382 12:113006035-113006057 TCATGAAAATGTTCTATGTCTGG + Intronic
1104839223 12:131813082-131813104 GCATGAAAATGATATTTATTTGG - Intergenic
1105281897 13:18969418-18969440 GAATGAAAATATTTAATTTTTGG + Intergenic
1105907572 13:24828147-24828169 GCTTGAAAATGTTATCTATTTGG + Intronic
1106023585 13:25937072-25937094 GCATAGAAATGTTTCATCTCAGG + Intronic
1106092018 13:26604750-26604772 GCAAGAAAATCTTTTTACTTGGG + Intronic
1106319770 13:28626301-28626323 ACATGAAAATATTTTATTCTTGG - Intergenic
1107109182 13:36677106-36677128 GCATGAAGACGTTGTATCCTAGG - Intronic
1107445387 13:40465936-40465958 TCATCAAACTGTTTGATCTTTGG + Intergenic
1107606056 13:42058297-42058319 GCATGAAAAAGTGTTATTCTAGG + Intronic
1107675080 13:42787436-42787458 GGCTGAAAATGTATAATCTTTGG - Intronic
1108472016 13:50776972-50776994 TCTTGAAAATGTTGAATCTTGGG + Intronic
1110054457 13:70948318-70948340 TCATGTGAATGTTTCATCTTAGG + Intergenic
1110473192 13:75883846-75883868 ATATGCAAATTTTTTATCTTTGG - Intergenic
1110926256 13:81156273-81156295 TCATAACAATGTTTTATATTTGG + Intergenic
1111366132 13:87247960-87247982 CCATGAAAATATTGTATATTAGG - Intergenic
1112714751 13:102170752-102170774 CCATGAAAAGGGTTTACCTTTGG - Intronic
1112833469 13:103482639-103482661 AAATGAAAATATTTAATCTTTGG - Intergenic
1112837884 13:103538008-103538030 CCCTCAAAATGTTTTATCGTGGG + Intergenic
1113155630 13:107317921-107317943 GCATTAAAATGTTAAATTTTTGG + Intronic
1113200255 13:107859502-107859524 GCATGAAAATATTTAATTCTTGG - Intronic
1113445532 13:110363537-110363559 GCAAGAAAATTCTTTGTCTTTGG + Intronic
1113699943 13:112376874-112376896 GCAAGAAAATGTTTTACATGAGG - Intronic
1114005560 14:18309512-18309534 TTAAGGAAATGTTTTATCTTGGG - Intergenic
1115072628 14:29343227-29343249 GCATCAAAATATTTTCTCCTTGG - Intergenic
1115409835 14:33061600-33061622 GCATGAAAGTGTATTATTTAGGG + Intronic
1115418033 14:33159393-33159415 ACAAGAAAACGTTTTACCTTGGG - Intronic
1116282888 14:42930821-42930843 TCAAGAAAATATTTTATCTTCGG + Intergenic
1117096832 14:52307289-52307311 TCATGAAAATTCTTTTTCTTAGG - Intergenic
1119927613 14:78510978-78511000 TTATAAAAATGTTTTATCTCTGG + Intronic
1122063622 14:99156537-99156559 GCAAGGACATGTTTTATCTTTGG + Intergenic
1124476148 15:30036725-30036747 TAATGAAAATGTTATATTTTTGG - Intergenic
1125435312 15:39637887-39637909 GCATGAAAATTTTCCAACTTTGG - Intronic
1125900217 15:43339261-43339283 GAATGCAGATGTATTATCTTTGG + Intronic
1126449809 15:48793937-48793959 GCCTCAAAATATTTTATTTTAGG + Intronic
1127229593 15:56974839-56974861 TTATGAAAAAGTTTTATCATTGG + Intronic
1128836314 15:70811654-70811676 GCATGAAACTATTTTATGTAAGG - Intergenic
1128859088 15:71050271-71050293 GGAAGAAAATGTTTTGTCTTAGG + Intronic
1129002867 15:72348373-72348395 GGATTAATATGTTTTCTCTTTGG - Intronic
1130329347 15:82909057-82909079 GCAAGAAAAGGTACTATCTTTGG + Intronic
1130954587 15:88618282-88618304 GCATGAAAATATATTATGCTTGG - Intergenic
1132780957 16:1625193-1625215 CCATGAAAAGTTTTTATCTGTGG + Intronic
1133479511 16:6156400-6156422 GCAAGGAAATGTTTTATTGTTGG - Intronic
1133529004 16:6635757-6635779 GCATCAAAATAGTTTATGTTGGG - Intronic
1133625615 16:7567963-7567985 GCATTTTAATGTTTTTTCTTGGG - Intronic
1133630526 16:7616010-7616032 TCATGTAAATGTTTCATCTTTGG + Intronic
1136929234 16:34404075-34404097 GCATGTTTATATTTTATCTTTGG - Intergenic
1136975340 16:35007729-35007751 GCATGTTTATATTTTATCTTTGG + Intergenic
1137534564 16:49308694-49308716 CCATAAAGATGTTGTATCTTTGG - Intergenic
1137900749 16:52266103-52266125 TCATGAAAATGGTTTGTGTTTGG - Intergenic
1138609018 16:58108324-58108346 GAATAAAAATGTTATCTCTTGGG + Intergenic
1140339544 16:74143467-74143489 GCTTTGAAATATTTTATCTTTGG - Intergenic
1144255866 17:13466566-13466588 GCATGAACATGTGTTGGCTTTGG - Intergenic
1147357980 17:39912409-39912431 GCCTGAAATTGTTATTTCTTTGG + Exonic
1149018743 17:51938581-51938603 ACATTAAAATGATTTTTCTTTGG - Intronic
1149911954 17:60574840-60574862 GGATGTAAATATTTTATTTTAGG - Intronic
1150040675 17:61857324-61857346 CCCTAAAAATCTTTTATCTTAGG - Intronic
1154504023 18:15016514-15016536 GCAGGAAGATATTTTTTCTTGGG + Intergenic
1154531870 18:15354362-15354384 TTAAGGAAATGTTTTATCTTGGG + Intergenic
1156065159 18:33133223-33133245 GCAGAAAAATATTTTATATTTGG + Intronic
1156397713 18:36714442-36714464 ACATGAAACTGTTTGAACTTGGG + Intronic
1156833659 18:41526599-41526621 CCAAGAAAATTTCTTATCTTGGG + Intergenic
1157000451 18:43516840-43516862 GCATGTACATATTTTATGTTAGG + Intergenic
1158278592 18:55795601-55795623 TAATGAAAATGTTTTTTCTGCGG - Intergenic
1159078553 18:63709124-63709146 GCTGGAATATGTGTTATCTTAGG - Intronic
1159246773 18:65815969-65815991 GCAGCAAAATATTTTATCCTTGG - Intronic
1159411724 18:68085389-68085411 GCATGAAAATGGTTTTGTTTAGG + Intergenic
1160616186 18:80131024-80131046 GCTTGTAATTGTTTTGTCTTAGG + Intronic
1163805358 19:19393489-19393511 GCATGAAAATGTTTTATCTTAGG - Intronic
1163965093 19:20738870-20738892 ACATGACAATGTCTTATTTTGGG + Intronic
1164167458 19:22694590-22694612 GTATGATAATCTTTTATCTCAGG - Intergenic
925215255 2:2088913-2088935 GCAGGAAAATGTTTTTTGGTAGG - Intronic
925661149 2:6204308-6204330 GCATGAAAATATTTAGCCTTGGG - Intergenic
926640792 2:15234356-15234378 CCATGAAAATGTTTCATTGTTGG - Intronic
926877336 2:17496048-17496070 GCCTGAAAATTTATTATCTTTGG - Intergenic
927416624 2:22886988-22887010 GAATGAAAATGGGTTGTCTTAGG + Intergenic
927950357 2:27164025-27164047 GCATGCAAATGAATTATTTTAGG - Intergenic
930698488 2:54435322-54435344 ATATGAAAATGTTTTATTATTGG + Intergenic
931853255 2:66275218-66275240 GTATAAAAATGTTTTCACTTTGG + Intergenic
932884734 2:75539216-75539238 GATAGAAAATGTTTTATCTTGGG + Intronic
933162176 2:79037671-79037693 ACAGGGAAATGTTTTAACTTGGG - Intergenic
935390335 2:102545168-102545190 GCATGAAAATGTGATATTTGAGG - Intergenic
935546745 2:104407592-104407614 ACATTAAAAATTTTTATCTTGGG - Intergenic
937000501 2:118462080-118462102 GCATGTAGATATTATATCTTTGG - Intergenic
937754444 2:125518662-125518684 GTATGTAAAAGTTTTTTCTTAGG - Intergenic
938530969 2:132185598-132185620 TTAAGGAAATGTTTTATCTTGGG + Intronic
939783587 2:146480320-146480342 GCATGGAAATATTCTATATTTGG + Intergenic
940220913 2:151350395-151350417 CCAGGAAAATGTTTGATCTTAGG - Intergenic
941425281 2:165336886-165336908 ACATGAATATGTTTAATATTGGG - Intronic
942728668 2:179039168-179039190 ACAGGAAAATATTTTTTCTTTGG + Intronic
942729690 2:179050728-179050750 GCAAGAAAATGTTTTCTGTGTGG + Intergenic
942900052 2:181104939-181104961 GCATGAAAACGTTAACTCTTCGG + Intergenic
943122891 2:183759511-183759533 GCATGAAAGTGTTATAAGTTTGG - Intergenic
943124930 2:183784288-183784310 GCATGAGAATGATTAATATTAGG - Intergenic
943137601 2:183934984-183935006 AAATGAAAATGTTTCATTTTTGG - Intergenic
944480087 2:200148276-200148298 GCATAAAACTGATTTATCTCAGG - Intergenic
1169854971 20:10092469-10092491 GCAAGAAACTGTTTTATTCTTGG - Intergenic
1170239983 20:14154273-14154295 GAATGATAATTTTTTATCTAAGG + Intronic
1173272582 20:41551400-41551422 TGTTGAAAATGTTTTATTTTGGG - Intronic
1173466649 20:43288258-43288280 GCATGAGAATCTTTGAACTTGGG - Intergenic
1173890451 20:46504743-46504765 GAAAGAAAATGTTTAATCTTGGG + Intronic
1174752068 20:53121714-53121736 GCTGGAAAATGTGTTTTCTTTGG - Intronic
1175637642 20:60598982-60599004 GCATCAGAATGTTTGAGCTTTGG - Intergenic
1176765491 21:13013811-13013833 TTAAGGAAATGTTTTATCTTGGG - Intergenic
1177620126 21:23579784-23579806 GCATTAAACTTTTTGATCTTTGG + Intergenic
1177958626 21:27633401-27633423 GCATGATCCTGTTTTGTCTTTGG - Intergenic
1179360801 21:40706369-40706391 GCAAGAAAATATCTTATGTTAGG + Intronic
1180430069 22:15240298-15240320 TTAAGGAAATGTTTTATCTTGGG - Intergenic
1180829278 22:18891141-18891163 GCATAACAATGTTTGGTCTTGGG - Intergenic
1181772785 22:25138914-25138936 TCAGGAAGATGTTTTGTCTTTGG + Intronic
1182055486 22:27350776-27350798 GCATGAAAATCATTTATCAATGG - Intergenic
1182078315 22:27510530-27510552 GCATGAAGCTGTTTTGTCATTGG - Intergenic
1182114840 22:27750241-27750263 GAATGAAAATATATTTTCTTAGG + Exonic
1182384030 22:29920792-29920814 GCAGCAAAATCTTTTATATTTGG - Intronic
1203279370 22_KI270734v1_random:117179-117201 GCATAACAATGTTTGGTCTTGGG - Intergenic
950510983 3:13426693-13426715 TCAAAAAAATGTTTTATTTTAGG + Intergenic
950578129 3:13845233-13845255 GCCTGAAAATGTCTTAGCTGCGG - Intronic
950962648 3:17121741-17121763 TCATGAAAAGCGTTTATCTTTGG - Intergenic
951301077 3:20997231-20997253 GAATCAATATGCTTTATCTTCGG + Intergenic
951452240 3:22852556-22852578 CCATGAAACTATTTTCTCTTAGG + Intergenic
951764402 3:26181389-26181411 GCATCAACATGTTTTAGCTGGGG - Intergenic
954512754 3:51141629-51141651 GCATGAAAAGGTTTTAAGCTGGG + Intronic
954964434 3:54597796-54597818 GCATGACAATTTTTAGTCTTTGG + Intronic
955094482 3:55783565-55783587 GCAGGAAAGTTTTTTATTTTAGG - Intronic
955245701 3:57222622-57222644 TCATGAAAATCTTTTAACTTTGG + Intronic
955258491 3:57359851-57359873 CCCTGAAGATGTTTTTTCTTAGG + Intronic
956174311 3:66458714-66458736 GAAAGAAAATGTTTTATATCAGG + Intronic
956328849 3:68082473-68082495 GCTAGAAAATGTTATATTTTAGG - Intronic
956369864 3:68547675-68547697 GCATAAAAATTGTTTATCTGAGG + Intergenic
956496018 3:69826882-69826904 GCCTGCACATGCTTTATCTTTGG + Intronic
956909139 3:73799107-73799129 GCATGAAAATATTTTAGAATAGG + Intergenic
957491921 3:80938703-80938725 TCATGAGACTGTTTTATCATTGG + Intergenic
957671642 3:83312489-83312511 GCAAGAATGTGTTTTATTTTTGG + Intergenic
957802346 3:85101526-85101548 GCATGAACATGTTTCACCTTAGG + Intronic
957811963 3:85233602-85233624 CCATGAAAATATTTCATCATTGG - Intronic
958949014 3:100397511-100397533 GCTTTAAAATGATTTATTTTTGG - Intronic
962062177 3:131940908-131940930 GCATGAAGCTATTTTGTCTTTGG + Intronic
963620785 3:147602929-147602951 GCATTAAATTGTTTTATTTATGG + Intergenic
963789525 3:149569214-149569236 GAATAAAAATGATTTATTTTGGG - Intronic
965111816 3:164434240-164434262 TCATGAAAATATATTATTTTTGG + Intergenic
965229385 3:166030261-166030283 GCATGGAAAAGTTTTCTCTCAGG - Intergenic
965455351 3:168893022-168893044 GAATGAATATATTTTATCTCGGG + Intergenic
965716393 3:171608812-171608834 ACAAGTAAATGTTTAATCTTAGG + Intronic
965965132 3:174479874-174479896 TCTTGAGAATGGTTTATCTTGGG + Intronic
966021097 3:175211742-175211764 ACATCACAATGTGTTATCTTTGG - Intronic
969441324 4:7218429-7218451 GCCTGAAAAGTTTTTTTCTTGGG + Intronic
969941673 4:10738204-10738226 ACATGAAAATGTAATTTCTTGGG + Intergenic
971003069 4:22344138-22344160 GCATGGAAATTTTTCATTTTTGG - Intergenic
971038438 4:22722001-22722023 GGCTTAAAATGTTTTCTCTTGGG + Intergenic
971747456 4:30602170-30602192 TCATTAAAATGTTGTATTTTGGG - Intergenic
972831377 4:42817758-42817780 ACATGAAAATGCTTTCTCCTGGG - Intergenic
973911663 4:55587892-55587914 GCAAAAAAATGTTTTAAATTTGG + Intronic
974126253 4:57699904-57699926 TTATAAAAATGTGTTATCTTAGG + Intergenic
974563079 4:63547278-63547300 TCATGAAAATGATTTCACTTGGG + Intergenic
977810570 4:101350532-101350554 GCATGAGAATACTTTATATTTGG + Intergenic
977855309 4:101883556-101883578 GCATGAAGATGCTTTAGTTTGGG - Intronic
979298140 4:119056034-119056056 GCATGGTAATGTTTTTTGTTAGG + Intronic
980162211 4:129179255-129179277 TCATGTAAATATTTTATTTTTGG - Intergenic
980462200 4:133129158-133129180 GCAAAAGAAGGTTTTATCTTTGG + Intergenic
981277471 4:142918192-142918214 TCAAGTAAATGTTTTATTTTGGG - Intergenic
981590816 4:146358477-146358499 ACTAGAAAATGTTTTATATTTGG - Intronic
981753457 4:148116585-148116607 ACATGAAAATTTTTCATCTCAGG - Intronic
982014120 4:151135851-151135873 TTATTGAAATGTTTTATCTTGGG - Intronic
982700065 4:158650674-158650696 GCATGAGAATGCTTGAACTTGGG + Intronic
982803549 4:159734579-159734601 TCATGAAAATATTTTTGCTTAGG + Intergenic
983421390 4:167522429-167522451 GTCTGGAAATGTTTTATCTGAGG + Intergenic
984488310 4:180400835-180400857 GCAAGAAAAAAATTTATCTTAGG - Intergenic
986961797 5:13221908-13221930 ACATGAAAATATTTTCTTTTAGG - Intergenic
987349558 5:17009758-17009780 GAATGAAATTGTTTAAGCTTTGG + Intergenic
987967910 5:24900162-24900184 ACATGAACATGTTTTAGCCTCGG - Intergenic
988119040 5:26936006-26936028 GAATGAAAATGTATGATATTTGG - Intronic
988125859 5:27035406-27035428 GAAAGAAATTGCTTTATCTTAGG + Intronic
988880931 5:35501336-35501358 GCATGAAAATGTTGTACTTTTGG - Intergenic
989810578 5:45668101-45668123 GCATAAAAAAGTTTGATTTTGGG - Intronic
990517954 5:56548115-56548137 GCTTGAAAATGTTTTCCCTCTGG + Intronic
990601653 5:57365017-57365039 GAATGAAAATATTTTGTCCTGGG + Intergenic
990612829 5:57475799-57475821 GAATCAAAATATTATATCTTTGG - Intergenic
992892864 5:81220149-81220171 CCAGGAAAATGTTTTATGTAAGG - Intronic
992901283 5:81299738-81299760 TCATGAAGAGGTTTTATCTTTGG - Intergenic
993205522 5:84873347-84873369 ACATGAAAATCTTTTCTCTTAGG + Intergenic
993581530 5:89667651-89667673 TCAGGAATATGTCTTATCTTTGG - Intergenic
993794128 5:92245796-92245818 TCATGAGAATGTTTTATTTTTGG + Intergenic
994009613 5:94885569-94885591 GCGGGAAAATATTTTTTCTTTGG - Intronic
994128380 5:96195759-96195781 GCATGAACATGTTATCTGTTTGG - Intergenic
996126931 5:119736640-119736662 GAAAGACAAAGTTTTATCTTAGG + Intergenic
997917886 5:137947386-137947408 TTATGCAAATGTATTATCTTTGG - Intronic
998891682 5:146752886-146752908 GTATGAAAGTGTATTATCTGGGG + Intronic
1000736171 5:164903261-164903283 GCCTGAAATAGTTTTATATTCGG + Intergenic
1001005815 5:168048855-168048877 GCATGAAAAAGTTTTATCTGAGG + Intronic
1001921055 5:175600094-175600116 ACATTAAAATGATTTATTTTGGG - Intergenic
1004425569 6:15504746-15504768 GCAGCCAAATGTTTTAACTTAGG + Intronic
1006671846 6:35734460-35734482 GAATTAAAATGTATTTTCTTAGG - Intergenic
1010331794 6:74631399-74631421 GCATGAAAAAGTTATAGCTCTGG + Intergenic
1010791473 6:80070068-80070090 CCAGGAGAATGTTTCATCTTTGG + Intergenic
1011129474 6:84038442-84038464 GAATTAAAATGTCTAATCTTTGG - Intronic
1011923261 6:92609142-92609164 GTAAAAAAATATTTTATCTTGGG + Intergenic
1011983990 6:93419345-93419367 GCATGAGCAGGTTTTATTTTAGG + Exonic
1012174541 6:96063744-96063766 GAAGCAAAAAGTTTTATCTTTGG + Intronic
1012905714 6:105062817-105062839 AAATGAAAATGTTTTGTCATAGG - Intronic
1013994250 6:116289411-116289433 GCATGAAATTGCTTAATCTTAGG - Intronic
1014996413 6:128150843-128150865 GGATGAAAATGTTCTTTTTTGGG + Intronic
1015376374 6:132514607-132514629 ACATGGAAATGATTTATTTTGGG - Intergenic
1016080742 6:139852249-139852271 GCATAGGAATGTTTTATCCTTGG - Intergenic
1016143342 6:140640892-140640914 GCATGGTAATATTTTATCTTAGG - Intergenic
1016429420 6:143966892-143966914 GTAAGAAAATGTATTATCTAAGG - Intronic
1016560445 6:145390485-145390507 GCAGGAAAATTTCTTTTCTTGGG + Intergenic
1017582817 6:155885481-155885503 CCATAAAAATTTTATATCTTTGG - Intergenic
1019566265 7:1680645-1680667 GCATGAAAATGTTTTATAGCTGG - Intergenic
1019762002 7:2819887-2819909 GTGTGAACATGTTTTCTCTTGGG - Intronic
1019876765 7:3819188-3819210 CCATGAAAATGCTACATCTTTGG - Intronic
1020420881 7:8003517-8003539 CCATGGAAATGTTTTCTATTTGG + Intronic
1020718570 7:11711640-11711662 GCATGGCAATGTTTTCTCTAGGG + Intronic
1021128970 7:16887745-16887767 GCCTGAAACTGTCGTATCTTAGG + Intergenic
1021136494 7:16971036-16971058 ACAGAAAATTGTTTTATCTTTGG - Intergenic
1023893762 7:44414747-44414769 GCAGGAAAACGTTTTATTATAGG - Intronic
1025601236 7:62999350-62999372 GTATGAAAATATTTTGTTTTGGG - Intergenic
1025888679 7:65624034-65624056 GCTTGAAGATGTTCTATCTCTGG - Intergenic
1026430364 7:70340693-70340715 TCTTGAAAACTTTTTATCTTGGG + Intronic
1027750161 7:82133733-82133755 GCATAATCATTTTTTATCTTGGG - Intronic
1028580221 7:92402164-92402186 GCATGAAAAATTTTTTCCTTTGG - Intergenic
1029601705 7:101567637-101567659 GCAAACAAATGTTTGATCTTGGG + Intergenic
1030345933 7:108433018-108433040 GGTTGAAATTATTTTATCTTTGG - Intronic
1030970917 7:116053666-116053688 GCATGCAAATGTGCTATCTTAGG - Intronic
1031053049 7:116964906-116964928 GAAAGAAAAAGTTTTCTCTTAGG - Intronic
1031447874 7:121876614-121876636 GCATGAATATTTTTTATATGTGG - Intronic
1031853767 7:126897922-126897944 GCTTGAAGATGTTCTATCTCTGG + Intronic
1032271183 7:130408150-130408172 ACATGTAAATGTTTTATTTCTGG - Intronic
1032742785 7:134755833-134755855 ACAGGAAAATGTTTTACTTTGGG - Intronic
1033548011 7:142420105-142420127 ACATGAAAATAGTTTCTCTTTGG + Intergenic
1033672770 7:143509066-143509088 GAATGAAACAGTTTTATCTATGG - Intergenic
1037163858 8:15802959-15802981 GCATAAAAAGGATTTATTTTAGG + Intergenic
1037287634 8:17318226-17318248 GCATGATAATTCCTTATCTTGGG - Intronic
1037362308 8:18086285-18086307 GCATGAAATGGTTTAATTTTAGG - Intergenic
1039252047 8:35676894-35676916 TCATGAATATGTTTTTTTTTTGG + Intronic
1039413629 8:37375695-37375717 CCATTAAAGTGTTTTATGTTGGG - Intergenic
1040497221 8:47976897-47976919 GCATAAAAATTTTCTAACTTGGG + Exonic
1042054913 8:64754392-64754414 GCTTGGGAATGTTTTATCATTGG + Intronic
1042057638 8:64782824-64782846 ACAACAAAATGTTTTATTTTAGG + Intronic
1043171309 8:76970458-76970480 TTGTGAAGATGTTTTATCTTTGG + Intergenic
1044141526 8:88659522-88659544 ACATGAAAATATTTTATGCTTGG + Intergenic
1044301988 8:90595396-90595418 GCTTAAAAATTTTTTATTTTGGG - Intergenic
1044671812 8:94689411-94689433 GAATGGAATTGTTTTATTTTTGG + Intronic
1045576950 8:103433115-103433137 GCCTGAAAATGTTTAACATTTGG + Intronic
1045691848 8:104767444-104767466 GCATAAAAATGTTTTATGTGAGG + Intronic
1046442659 8:114278945-114278967 GGTTAAAAATGTTTTTTCTTTGG + Intergenic
1046857738 8:119053153-119053175 GCATAAAACTGCTTTATATTGGG + Intronic
1048978274 8:139687149-139687171 GCATGCACATGTGTTTTCTTTGG - Intronic
1053019678 9:34686222-34686244 TCATGAAACTGTTATATCTAAGG + Intergenic
1053337867 9:37293189-37293211 GCCTGAACATGTTTGATCTAAGG + Intronic
1053484263 9:38439981-38440003 GCCTGAATATGTTTCCTCTTTGG + Intergenic
1054941803 9:70751227-70751249 GCATGAAAATGTCCTATATTGGG + Intronic
1055473767 9:76641224-76641246 AAATGAAAATGTGTTATTTTGGG + Intronic
1056029409 9:82536888-82536910 GAATGACAAGGTTTTGTCTTTGG - Intergenic
1056234456 9:84578720-84578742 GTCTGAAAATGTCTTAACTTTGG - Intergenic
1057536160 9:95908888-95908910 GCATTAAAATGATTTAGCATAGG + Intronic
1058126526 9:101201399-101201421 GCTTCAAAGTGTTTCATCTTAGG - Intronic
1058759416 9:108116517-108116539 GAATGAAAACCTTTTAACTTCGG - Intergenic
1059083493 9:111274836-111274858 GCCAGAAAATGTTTTCACTTGGG - Intergenic
1059782196 9:117541653-117541675 GCAATAAAATGTTTTAATTTGGG + Intergenic
1061338329 9:129958606-129958628 GGATGAAAATGTTTCCTCCTGGG - Intronic
1187371952 X:18716686-18716708 AAATGAAAATCTTTCATCTTTGG + Intronic
1187905044 X:24057921-24057943 GCATGTAAGTATTTTAACTTAGG - Intronic
1188302524 X:28522725-28522747 TCATTAAAATTTTTTATCTGTGG - Intergenic
1188464899 X:30468608-30468630 GCAGGAAAATGTGTTATTATAGG - Intergenic
1188838922 X:34991118-34991140 GCATGCAAATGATTTTCCTTTGG + Intergenic
1192388427 X:70698375-70698397 GCAGGAAAATATATTGTCTTTGG + Intronic
1193818605 X:86133729-86133751 GCATGTTAATGTTTTACTTTGGG - Intergenic
1193918927 X:87401621-87401643 GAATCAAAATGTTTGATCATGGG + Intergenic
1194504622 X:94717416-94717438 GGCTGAAAGTTTTTTATCTTAGG + Intergenic
1195903260 X:109820057-109820079 GGATGAGAATGTTTGGTCTTGGG - Intergenic
1195959474 X:110370810-110370832 GCCTGAAAATATTTTTTGTTTGG - Intronic
1196346041 X:114660299-114660321 AAATAAAAATGTTTTATGTTTGG - Intronic
1196378031 X:115056500-115056522 ACATGAAAATGTTGTCTCTAAGG + Intergenic
1196856815 X:119991928-119991950 GCATTAAAATTATTAATCTTCGG + Intergenic
1198013473 X:132584434-132584456 ACATGGAAATGTTTGAACTTGGG + Intergenic
1198591626 X:138189487-138189509 GCAAGAAAGTGTTTTCTCCTAGG - Intergenic
1198658921 X:138945314-138945336 TCATTAAGATGATTTATCTTAGG + Intronic
1199268866 X:145859247-145859269 ACATGAAAGTGTTTTAATTTGGG - Intergenic
1199502597 X:148524545-148524567 TTATGAAAATGTTTTAAATTGGG - Intronic
1200362522 X:155624166-155624188 GCAGCAAAATGGTTTATTTTTGG + Intronic
1201790769 Y:17838463-17838485 GCATAAAGATGTTTTATCATGGG + Intergenic
1201810785 Y:18067526-18067548 GCATAAAGATGTTTTATCATGGG - Intergenic
1201910578 Y:19129561-19129583 ACAAGAAGATGTTTTATCTCTGG + Intergenic
1202352386 Y:24008114-24008136 GCATAAAGATGTTTTATCATGGG + Intergenic
1202518393 Y:25662001-25662023 GCATAAAGATGTTTTATCATGGG - Intergenic