ID: 1163805366

View in Genome Browser
Species Human (GRCh38)
Location 19:19393532-19393554
Sequence GTGAGCAGGACTGACACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163805358_1163805366 20 Left 1163805358 19:19393489-19393511 CCTAAGATAAAACATTTTCATGC 0: 1
1: 0
2: 1
3: 32
4: 342
Right 1163805366 19:19393532-19393554 GTGAGCAGGACTGACACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163805366 Original CRISPR GTGAGCAGGACTGACACAGC TGG Intronic
No off target data available for this crispr