ID: 1163809408

View in Genome Browser
Species Human (GRCh38)
Location 19:19421252-19421274
Sequence GCCAGGGAGGTGAGGGCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 791
Summary {0: 1, 1: 1, 2: 6, 3: 83, 4: 700}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163809408 Original CRISPR GCCAGGGAGGTGAGGGCAGT AGG Intronic
900082160 1:866574-866596 GTCAGGGATGTGAGTGCAGGGGG - Intergenic
900082173 1:866623-866645 GTCAGGGATGTGAGTGCAGAGGG - Intergenic
900082184 1:866672-866694 GTCAGGGATGTGAGTGCAGGGGG - Intergenic
900082197 1:866721-866743 GTCAGGGATGTGAGTGCAGAGGG - Intergenic
900082208 1:866770-866792 GTCAGGGATGTGAGTGCAGGGGG - Intergenic
900082221 1:866819-866841 GTCAGGGATGTGAGTGCAGGGGG - Intergenic
900082234 1:866868-866890 GTCAGGGATGTGAGTGCAGGGGG - Intergenic
900082247 1:866917-866939 GTCAGGGATGTGAGTGCAGAGGG - Intergenic
900082258 1:866966-866988 GTCAGGGATGTGAGTGCAGGGGG - Intergenic
900082269 1:867015-867037 GTCAGGGATGTGAGTGCAGGGGG - Intergenic
900082294 1:867113-867135 GTCAGGGATGTGAGTGCAGGGGG - Intergenic
900292260 1:1928534-1928556 GCTCTGGAGGTGGGGGCAGTAGG - Intronic
900300286 1:1973624-1973646 GCCACGCAGGTGGGGGCCGTGGG + Intronic
900478430 1:2886971-2886993 GGCTGGGAGGTCAGGGCACTGGG - Intergenic
900531033 1:3153267-3153289 GCCAGGCAGGTGAGGAACGTGGG + Intronic
900566046 1:3332376-3332398 GTCGGGGTGGTGTGGGCAGTGGG + Intronic
901167186 1:7229303-7229325 GCCGGGAAAGTGAGGGCAGATGG + Intronic
901210234 1:7520429-7520451 GGCAGGGAGGTGGGGCCAGCAGG + Intronic
901218902 1:7571046-7571068 TCCATGAAGGTGAAGGCAGTTGG - Intronic
902364370 1:15961794-15961816 ACCAGGGAGGTGGGGGGAATGGG + Intronic
902571791 1:17351932-17351954 GTCAGGGAGGTGATGGGAGGTGG + Intronic
902571826 1:17352047-17352069 GTCAGGGAGGTGATGGGAGGTGG + Intronic
902571835 1:17352081-17352103 GTCAGGGAGGTGATGGGAGGTGG + Intronic
902882844 1:19384242-19384264 GGCAGTGAGGGGAGGGCAGTGGG - Intronic
903258081 1:22115938-22115960 GCAACTGAGGTGAGGGCATTTGG + Intergenic
903320879 1:22542554-22542576 GCCGGGGTAGGGAGGGCAGTGGG + Intergenic
903778717 1:25808781-25808803 GGCAAGGAGGTGAGGACAGCTGG + Exonic
903801681 1:25973536-25973558 GGAAAGGAGGTGAGGCCAGTTGG - Intronic
904058310 1:27686660-27686682 GCCAGGCAGGTGAGAGGAGCTGG + Intergenic
904472726 1:30746030-30746052 GCCAGGGAAGGGTGGGCAGATGG - Intronic
904826351 1:33276184-33276206 GCCAAGGAGGGTAGGGCAGCCGG - Intronic
904830286 1:33302010-33302032 GCCTGGGAGGTCAGGGCTGTGGG + Intergenic
905386634 1:37608952-37608974 GCCTGGGAGGTGAGGAAGGTGGG - Intergenic
906110963 1:43321707-43321729 GCCAGGAAGGTGAGGAGACTGGG + Exonic
907326021 1:53638957-53638979 GGCAGGGAGTGGAGGGCAGAAGG + Intronic
910649989 1:89556282-89556304 GCAAGGTATTTGAGGGCAGTGGG - Intronic
911964645 1:104350863-104350885 GCCAGGGTGGTGGGGGAAGCAGG - Intergenic
912451576 1:109770656-109770678 TCCAGGGCTGTCAGGGCAGTGGG - Intronic
912669829 1:111615413-111615435 GCTAGAGAGGTGGGGGCAGCTGG + Intronic
913609479 1:120496205-120496227 GCCATGGAGGTGAGTGGAGATGG + Intergenic
913961955 1:143346419-143346441 GCCCGGGAAGGGAGGGCATTTGG + Intergenic
913985980 1:143566483-143566505 GCCATGGAGGTGAGTGGAGATGG - Intergenic
914056310 1:144171993-144172015 GCCCGGGAAGGGAGGGCATTTGG + Intergenic
914122836 1:144794369-144794391 GCCCGGGAAGGGAGGGCATTTGG - Intergenic
914204344 1:145514311-145514333 GCCATGGAGGTGAGTGGAGATGG - Intergenic
914483466 1:148087499-148087521 GCCATGGAGGTGAGTGGAGATGG - Intergenic
914581711 1:149025634-149025656 GCCATGGAGGTGAGTGGAGATGG - Intronic
915634745 1:157178257-157178279 TCCTGGGAAGGGAGGGCAGTTGG + Intergenic
915656684 1:157366575-157366597 GGCAGGGAGGGGAGAGCAGTGGG + Intergenic
915660480 1:157401014-157401036 CCCTGGGAAGGGAGGGCAGTTGG + Intergenic
915672281 1:157499665-157499687 GGCAGGGAGGGGAGAGCAGCAGG - Intergenic
915812724 1:158931869-158931891 GGCAGTGGGGTGAGGGCAGTAGG + Intronic
915858904 1:159421767-159421789 GCCTGGGTGGTGATGGCAGTGGG + Intergenic
916746769 1:167690896-167690918 GCACGGGAGGTGAGGGCTCTGGG - Intronic
916807080 1:168269531-168269553 GCCTGGGAGCTGAAGGCACTCGG + Intergenic
916840910 1:168599798-168599820 GCAAGAGAGGGCAGGGCAGTAGG - Intergenic
917492340 1:175508120-175508142 GCAAGGGAAGGGAGGGCATTAGG + Intronic
917513590 1:175688565-175688587 CCCAGGAAGCAGAGGGCAGTGGG + Intronic
918394917 1:184103766-184103788 GGCTGGGAGGAGAGGACAGTGGG - Intergenic
919753474 1:201052710-201052732 GTCAGGCAGGAGAAGGCAGTGGG - Intronic
919773419 1:201177437-201177459 GATAGGGAGGAGAGGGCAGGAGG + Intergenic
919938035 1:202267947-202267969 GGGAGGGATGTGGGGGCAGTAGG + Intronic
920046519 1:203136307-203136329 GGCAGGGAGATGGGGGCAGCTGG + Intronic
920172763 1:204081951-204081973 GCAGGTGGGGTGAGGGCAGTGGG + Intronic
920179548 1:204123941-204123963 GCTGGGGATGTGAGGGCAGCTGG + Intronic
920214087 1:204349764-204349786 ACCTGGAAGGTGAGAGCAGTGGG + Intronic
920528611 1:206685679-206685701 GTCAGGGAGGCGAGGGCGCTGGG - Intronic
921166681 1:212513117-212513139 CGCAGGTAGGTGAGGACAGTTGG - Intergenic
921570989 1:216777948-216777970 ACCAGGTAGGTGAAGGCAGGTGG - Intronic
922118058 1:222633816-222633838 GCCAGGGAAGCGTGGGTAGTTGG + Intronic
922605786 1:226889061-226889083 GCAAGGCTGGTGGGGGCAGTGGG + Intronic
922718186 1:227887578-227887600 GCCAGGGAGGTGAGGGCCAAAGG - Intergenic
923033381 1:230267405-230267427 AACATGGAGGTGAGGGCAGCCGG - Intronic
923158761 1:231300067-231300089 GCCAGGGAGGTAAGCTAAGTCGG - Intergenic
923256241 1:232223933-232223955 GGGAGCGAGGAGAGGGCAGTGGG - Intergenic
923368783 1:233289553-233289575 TTCAGGCAGGTGAGGGCAGGAGG + Intronic
923573705 1:235139989-235140011 CCCAGGGAGTGGAGGTCAGTGGG - Intronic
923914343 1:238485587-238485609 GGCAGGGAAGGGAGGGCGGTGGG + Intergenic
924636599 1:245793651-245793673 AGCATAGAGGTGAGGGCAGTTGG - Intronic
1063091683 10:2871043-2871065 GCGGGGGTGGTGAGGGCAGTGGG - Intergenic
1063364326 10:5480659-5480681 TCCAGGGAGGGGAAGGCAGGAGG - Intergenic
1063438858 10:6055834-6055856 GGGAGGGAGGTGGGGGGAGTCGG - Intronic
1063540404 10:6927958-6927980 GACAAGGAGGTGAAGGCAGGCGG - Intergenic
1063567113 10:7180629-7180651 GGAAGGGAGGGGAAGGCAGTGGG - Intronic
1063957131 10:11277414-11277436 TCCAGGGAGGTGAGGGCAGAGGG - Intronic
1063963047 10:11323112-11323134 GCGAGTAAGTTGAGGGCAGTGGG - Intronic
1064128978 10:12690785-12690807 GTCAGGCAGTTGGGGGCAGTTGG + Intronic
1066374400 10:34844326-34844348 TCCAGGGAGGAGAGGGCATCTGG + Intergenic
1067570503 10:47368021-47368043 CCCAGGGAGGTGAGGGTGGGTGG + Exonic
1068754295 10:60633661-60633683 GGCAGGGAGGTCAGGACATTGGG + Intronic
1068866777 10:61903178-61903200 GCGGGGGAGGGGAGGGCAGAGGG + Intronic
1069072037 10:63998914-63998936 GGCAGGGGGGTGGGAGCAGTGGG - Intergenic
1069754033 10:70762294-70762316 CCCAGGGAGGGGAGGGCAACAGG - Exonic
1069838399 10:71324000-71324022 TCCAGAGAGGTGGGGGCAGTAGG + Intronic
1069896229 10:71681870-71681892 GCCAGGGAGGACCAGGCAGTGGG - Intronic
1069906634 10:71736036-71736058 GGCTGGGAGGAGAGGCCAGTGGG + Intronic
1069924414 10:71838345-71838367 GCCAGGGAGGGGAGGGCCTGGGG + Intronic
1070652479 10:78247863-78247885 GGCAGGGAGGTGAGGTCTGCTGG - Intergenic
1070657640 10:78282289-78282311 GCCAGGAAGGTGTGGGTATTTGG + Intergenic
1071554626 10:86592757-86592779 GTGGGGCAGGTGAGGGCAGTAGG - Intergenic
1072241191 10:93496768-93496790 GCCAGGGAGGGCAGGTCAGTGGG + Exonic
1072283942 10:93894872-93894894 CCCAGGAAGGTGAGGGCTTTTGG + Intronic
1072764109 10:98082156-98082178 GCTAGAGAGGAGAGGGCAGGAGG - Intergenic
1073027188 10:100496600-100496622 GCTTGGGAGGTGAGGCCAGGTGG - Intronic
1073122461 10:101131180-101131202 GCGAGGGAGGGGAGGGGAGGGGG - Exonic
1073300040 10:102465632-102465654 GCCAGGGAGGTGGGTGGAGTTGG + Intronic
1073444693 10:103573748-103573770 GGTGGGCAGGTGAGGGCAGTGGG + Intronic
1073858110 10:107701246-107701268 TCCAGAGAGGTGAGGGGAGAGGG - Intergenic
1074863573 10:117531928-117531950 GCCATTGGGGTGAGGGGAGTGGG + Intergenic
1074991288 10:118710639-118710661 GTGAGGGAAGTGAGTGCAGTGGG - Intronic
1075003933 10:118817342-118817364 GCCAGTGAGGTGTGGACAGTGGG + Intergenic
1075017684 10:118922545-118922567 GCCAGGGAGGTCACAGCAGTTGG + Intergenic
1075469612 10:122678217-122678239 CACAGGGAGGAGAGGGAAGTAGG + Intergenic
1076426279 10:130369799-130369821 GCTAGGGACGGGAGGGCAGCGGG - Intergenic
1076605781 10:131689141-131689163 GCCTGGGAGGTGGGGGCAGGTGG - Intergenic
1076923358 10:133467019-133467041 GCCAGGGATGGGAGGGCACTGGG + Intergenic
1077051691 11:569459-569481 GCCAGGGAGCTGAGGGGAGACGG - Intergenic
1077067061 11:646355-646377 GCCCGGGAGGGGCGGGCGGTGGG - Intronic
1077096245 11:800315-800337 GCCAGGTGGGCGAGGGGAGTGGG - Exonic
1077176965 11:1195443-1195465 GCCGGGGAGGGGTGGGCAGTGGG + Intronic
1077207107 11:1349985-1350007 GGCAGGTAGGGGAGGGCAGCAGG - Intergenic
1077343194 11:2035139-2035161 GCCAGGGGACTGAGGGCTGTAGG - Intergenic
1077384758 11:2263615-2263637 GGCTGGGAGGGCAGGGCAGTAGG - Intergenic
1077423326 11:2463025-2463047 CCCAGGGAAGTGGGGCCAGTCGG + Intronic
1077548910 11:3190744-3190766 GGAAGGGAGGGGAGGGCAGAAGG + Intergenic
1077854466 11:6108640-6108662 GCCAGGGGGTTGAGTGCAGGGGG - Exonic
1078088678 11:8250574-8250596 TCCAGGGAGCAGTGGGCAGTGGG - Intronic
1078093058 11:8279468-8279490 ACCAGGGAGCTAAGGGCAGGTGG + Intergenic
1078360181 11:10661885-10661907 CCCTGGGAGGATAGGGCAGTAGG - Intronic
1078459023 11:11499396-11499418 GTCAGGGGTGGGAGGGCAGTGGG - Intronic
1078528603 11:12119505-12119527 GCCAAGGAGGTGAAGGCAACTGG + Intronic
1078999626 11:16740477-16740499 GCCAGGGAGGTGGAGGCTGCAGG - Intronic
1080249188 11:30213937-30213959 GGGAGGGAGGTGAGGGCCCTTGG + Intergenic
1080641779 11:34162575-34162597 ACCATGGAGCTGAGGGCACTGGG - Exonic
1081621510 11:44621688-44621710 GCCAGGGAAGTCAGGCCAGGTGG - Intergenic
1081854467 11:46295105-46295127 GCCAGGGACCTGAGGGAAGAGGG + Intronic
1081869344 11:46376265-46376287 GCCAGGGAGGGAAGGGAACTTGG - Intronic
1083162664 11:60864926-60864948 GCCAGGCAGGAGCGGGGAGTGGG - Intergenic
1083443042 11:62689598-62689620 ACCAGGGAGGTGGGGGGAGGAGG - Exonic
1083571076 11:63762745-63762767 GCCGGGGAGGTAAGCGCAGCTGG + Exonic
1083648452 11:64186402-64186424 GGCGGGGAGGTGAGGGCCGCGGG + Intronic
1083677183 11:64332631-64332653 GCCAAGGAGGCCAGGGCAGGTGG - Intergenic
1083697028 11:64449816-64449838 GCCCAGGATGTGAGGGCAGAGGG - Intronic
1083802355 11:65053884-65053906 GCCTGGGAGGAGAGGGCACCTGG + Intronic
1083851621 11:65371007-65371029 GGCTGGGAGCTGAGGGCAGCAGG + Intergenic
1084150341 11:67285204-67285226 GCCAGGGATGGGAGGGCCGAGGG + Intronic
1084267982 11:68014711-68014733 CCCAGGGAGGCCAGGCCAGTGGG - Intronic
1084439278 11:69162190-69162212 GTCAGGGAGGTAAGGGTAGTGGG + Intergenic
1084593951 11:70106155-70106177 GGCAGGCAGGTGTGGGCAGGAGG + Intronic
1085044157 11:73343643-73343665 GGCAGGGAGAGGATGGCAGTGGG - Intronic
1085201669 11:74705776-74705798 GCCTGGGTGGGGAGGGCAGCAGG + Intronic
1085392602 11:76190067-76190089 GCCCGGGAGGGGAGGGGAGAGGG + Intronic
1085772854 11:79340307-79340329 CCCAGGGAGGTGGGGTCAGGGGG + Intronic
1086350698 11:85941210-85941232 GCCAGGGAGCCGAAGGCACTTGG - Intergenic
1086879565 11:92137621-92137643 GCCAGGGAGTTCAGGGGAATTGG + Intergenic
1087093940 11:94302679-94302701 GACAAGGAGGGCAGGGCAGTAGG - Intergenic
1087208365 11:95420304-95420326 TCCAGGGAGGTGAGAGGAGCTGG - Intergenic
1087307253 11:96501663-96501685 TCCAAGGCGGTGATGGCAGTGGG - Intronic
1087736940 11:101844703-101844725 GGGAGGGAGGGGAGGGGAGTGGG + Intronic
1088352782 11:108909178-108909200 TCCAGGGAGGTGGGGGGAATAGG - Intronic
1088844309 11:113652041-113652063 GGCAGTGAGATGGGGGCAGTGGG - Intergenic
1089296175 11:117469693-117469715 ACCAGGGAGGAGAGGGAAGTGGG + Intronic
1089671766 11:120061935-120061957 GGCCGGGAGGTAAGCGCAGTGGG - Intergenic
1090002908 11:122977623-122977645 GCCAGGCTGGGGAGGGTAGTAGG - Exonic
1090362350 11:126182345-126182367 GCATTGGAGTTGAGGGCAGTAGG - Intergenic
1091238564 11:134037388-134037410 GCCGCGGAGGGGAGGGCGGTGGG + Intergenic
1091278815 11:134370453-134370475 GGCAGGGAGGTGAGTGCTGGGGG + Intronic
1091361038 11:134978599-134978621 GCGAGGGAGGGAAGGGCAGAGGG + Intergenic
1202826180 11_KI270721v1_random:90328-90350 GCCAGGGGACTGAGGGCTGTAGG - Intergenic
1091602184 12:1924651-1924673 GCCCGGGAGCAGAGGGCAGCGGG + Intergenic
1091635141 12:2191154-2191176 GCCAGGGAGATGTGGGGTGTGGG + Intronic
1091664546 12:2409888-2409910 GTCAGGGAGGAGAGGGAAGTAGG + Intronic
1091748761 12:3009948-3009970 CCCGGGGAGGTGAGGGGAGTGGG - Intronic
1093779910 12:23123023-23123045 GCCAGGGAGGTGGAAGTAGTTGG + Intergenic
1093897352 12:24589291-24589313 GCCCGGAAGGTGAAGGCTGTAGG + Intergenic
1096122387 12:49096805-49096827 GCCAGGGAGGATAGGGCTGAAGG + Exonic
1096656553 12:53096217-53096239 GGCAGGGAGGAGAGGGTTGTGGG - Intergenic
1096982914 12:55738570-55738592 GCCAGGGAGACTAGGACAGTGGG + Intergenic
1097040577 12:56153753-56153775 GCCAGGGGAGTGAGGGCAGGCGG + Intronic
1097168571 12:57099216-57099238 GGCAGGGAGAGGAGGGCAGCGGG + Intronic
1097250347 12:57629034-57629056 CCCAGGGAGGTGAGGCTGGTAGG - Exonic
1098236294 12:68421556-68421578 GCAAGGGAAGTGAAGGCATTAGG + Intergenic
1100583098 12:95954489-95954511 GCCTGGGAGGTCAAGGCTGTAGG + Intronic
1100603220 12:96130122-96130144 GCTCTGGAGGTGAGGCCAGTAGG - Intergenic
1101428139 12:104604524-104604546 GCCAGGGAGTTGAGGAGAGAAGG + Intronic
1101964376 12:109272441-109272463 GGCTGGGAGGGGAGGGGAGTGGG - Intergenic
1102012702 12:109628476-109628498 GCCAGGGAGGTGATGGGGGTAGG + Intergenic
1102373066 12:112398788-112398810 GTCAGGGAGTTGAGGGCAAGGGG + Intergenic
1102503585 12:113369761-113369783 GCCAGGGACTTGGGGGGAGTGGG + Intronic
1103736556 12:123064455-123064477 GCAGGGGAGCTGAGGGGAGTAGG + Intronic
1103745727 12:123122132-123122154 CCCAGGGAGCTGGGGGCAGGAGG - Intronic
1103937641 12:124484980-124485002 TCCAGGGAGGTGAGCACAGAGGG - Intronic
1104088520 12:125495171-125495193 GCCAGGGAGGAGGGGGAAGAGGG - Intronic
1104856566 12:131905004-131905026 GGCAGGCAGGTGAGGCCAGGCGG + Intronic
1105251581 13:18703489-18703511 GCCAGTGGGGTGAGCGCAGCTGG + Intergenic
1105668973 13:22590950-22590972 GCAAGGGAAGGGAGGGCATTAGG + Intergenic
1105758673 13:23493326-23493348 GCCAGGCAGTTGAGGGAAGGTGG - Intergenic
1105831884 13:24169816-24169838 GCCAGGCAGGAGAGGAGAGTGGG - Intronic
1106160070 13:27193531-27193553 GCCCGGGAGCTGAAGGCAGGAGG + Intergenic
1106415778 13:29544761-29544783 GGCATGGCGGCGAGGGCAGTGGG + Intronic
1106547630 13:30744273-30744295 GCCAGGGAGGTGAGGAAGGTTGG + Intronic
1107061539 13:36164722-36164744 CCCAGGGATGTGAGTGCTGTAGG + Intergenic
1108453291 13:50588208-50588230 GCCAGGGAGGAAAGGACAGGAGG + Intronic
1108601972 13:52002564-52002586 GGCAGGGAGGCGAGGGGAGAGGG + Intronic
1112098291 13:96159077-96159099 GCCAGGAAGGAGGGAGCAGTTGG + Intronic
1112359965 13:98708543-98708565 GCCCTGGAGCTGTGGGCAGTGGG - Intronic
1113279112 13:108769286-108769308 GCCAGAGAGGTTGGGGCAGAAGG + Intronic
1113416550 13:110132786-110132808 GCCAGGGAGGCCAGGGCACAGGG + Intergenic
1113895490 13:113761411-113761433 GCCAGGAAGGGGAGAGCAGGTGG + Intronic
1114692589 14:24598518-24598540 GCAAGGGCAGTGAGAGCAGTAGG - Intergenic
1115448234 14:33516829-33516851 GCCAGGCAGGGCAGGGCAATTGG - Intronic
1116821179 14:49629353-49629375 GCCAGGGAGGTCAAGGCTGCAGG - Intronic
1117546048 14:56795343-56795365 GCCAGGGAGGAGAGGGTCATTGG + Intergenic
1117916265 14:60681194-60681216 CCCAGGGAGGTCAAGGCTGTAGG + Intergenic
1118161093 14:63291189-63291211 GGCAGGGAGGTCGTGGCAGTGGG - Exonic
1118177091 14:63451543-63451565 GCCAGGGAGTTGAAGGTGGTGGG + Intronic
1118455627 14:65943669-65943691 GCCAGGAATGTGATGGCTGTTGG - Intergenic
1118969120 14:70617647-70617669 GCCAAGGAATTGAGAGCAGTGGG + Intergenic
1119776552 14:77252774-77252796 GGCTGGGCGGAGAGGGCAGTGGG - Intronic
1120325890 14:83025741-83025763 GGCAGGGAGGGGAGGGAAGGAGG + Intergenic
1120834820 14:89030103-89030125 GCCAGGGAGCAGAGAGCAGGTGG - Intergenic
1120852562 14:89184653-89184675 CCCAGGAAGGTGAAGGCACTAGG - Intronic
1120994887 14:90409580-90409602 GGCAGAGAGTTGAGGGCAGTGGG - Intergenic
1121078664 14:91090122-91090144 GCCAGTGAGGAGAGGGGAATGGG - Intronic
1121273592 14:92653097-92653119 GGCAGGGAGGAGAGGGCGGTGGG + Intronic
1121599178 14:95190503-95190525 GGCAGGGAGGAGAGAGCAGAGGG + Exonic
1121994765 14:98593338-98593360 GGCAGGGAGGAGAGGGAAGGAGG - Intergenic
1122082289 14:99274301-99274323 CCCAGGAAGGTGAGGGTCGTGGG - Intergenic
1122107692 14:99470901-99470923 GCCAGGGGGCTGAGGGAAGGTGG - Intronic
1122140532 14:99660415-99660437 GCCAGGGGCGCGAGGGCACTAGG - Intronic
1122362395 14:101175153-101175175 GCCTGGCAGGTGTGGGCAGGAGG + Intergenic
1122366582 14:101198106-101198128 GCCAGTGAGGAGAGGGCAGGTGG + Intergenic
1122444654 14:101760662-101760684 ACCAGGGAGGGGCGGGCTGTCGG + Intergenic
1122631713 14:103110255-103110277 GGCAGGGAGCTGTGGTCAGTGGG + Exonic
1122856037 14:104560726-104560748 GGCAGGGGGGTGAGGGCGGCTGG - Intronic
1122873350 14:104651364-104651386 GCCAGGGAGGTGAGGGCTGTGGG - Intergenic
1122971401 14:105153708-105153730 GCCTGGTGGGTGGGGGCAGTAGG - Intronic
1123172569 14:106388537-106388559 ACCTGGGAGGTGAGGGAAATTGG + Intergenic
1124322579 15:28726141-28726163 CCCAGGGAGGTGGAGGCAGGTGG - Intronic
1124463969 15:29919708-29919730 GCCAGGCTGATGAGGGCAGCTGG - Intronic
1124497477 15:30195554-30195576 TCAAGGGAGGAGGGGGCAGTCGG + Intergenic
1124600828 15:31131761-31131783 GCCAGGGGAGTCAGGGCACTTGG + Intronic
1124746096 15:32343111-32343133 TCAAGGGAGGAGGGGGCAGTCGG - Intergenic
1126634099 15:50765352-50765374 GCCGCGGAGGTGCGGGCAGAGGG + Intronic
1126668602 15:51095425-51095447 GCCAGCGAGGGCAGGGCAGGTGG + Intronic
1126901063 15:53314695-53314717 GCCAGGCAGCTGAGGCCAGAAGG - Intergenic
1127506350 15:59601527-59601549 GGCAGGGAGGTTAGGGGAATGGG + Intronic
1128306623 15:66603241-66603263 GCCAGGGAGGTCAAGGCTGCAGG + Intronic
1128669083 15:69560855-69560877 GTCAGGGAGGTGAAGACAGAAGG + Intergenic
1128685484 15:69681333-69681355 GTCTGTGAGGTGGGGGCAGTGGG + Intergenic
1129091521 15:73156512-73156534 GCCAGGGTGGTATGGGCAATGGG + Intronic
1129167546 15:73787300-73787322 GCCTGGGAGGTGAGGGGCATGGG + Intergenic
1129269779 15:74413539-74413561 GCCAGGGATGGCAGGGCACTGGG - Intronic
1130132723 15:81157727-81157749 GACTGGGAGGTGAGGGAAATGGG + Intergenic
1130303948 15:82700324-82700346 GCCAAGGATGTGAGAGCAGTTGG - Intronic
1130655295 15:85788362-85788384 GACAGGGAGGTGTGGGAAGATGG - Intronic
1130733406 15:86522951-86522973 GCCAGGAAGGTGGAGGCAGAAGG - Intronic
1131234103 15:90681551-90681573 GTCTGGGAGGTGAGGGATGTGGG - Intergenic
1131510863 15:93048806-93048828 GCCAGGGTGGTCTGGGCCGTGGG + Intronic
1131529723 15:93180937-93180959 GCCTGGAAGGTGAGGACAGCAGG - Intergenic
1132514832 16:361405-361427 GCCAGGCAGGTGAGGTAAGCCGG - Intergenic
1132535340 16:476433-476455 GGGAGGGAGGTCCGGGCAGTGGG - Intronic
1132771617 16:1566842-1566864 GCCAGGGAGGTGGGGCCACTGGG - Intronic
1133026809 16:2992163-2992185 CCCAGCCAGGTGAGGGCAGCTGG + Intergenic
1133027869 16:2996523-2996545 TCCAGCCAGGTGAGGGCAGCTGG + Intergenic
1133056384 16:3147497-3147519 CCGAGGAAAGTGAGGGCAGTAGG - Intronic
1133687659 16:8181419-8181441 ACCACAGAGGTGATGGCAGTGGG + Intergenic
1134092745 16:11400169-11400191 GACAGGGAGATGAGGTCAGATGG - Intronic
1134229865 16:12420428-12420450 GCCTGGGAGGTGAGGGTGGTGGG + Intronic
1134610178 16:15601684-15601706 GTCAGGGCGGTCAGGGCAGTGGG - Intronic
1135060423 16:19266850-19266872 GCCAGAGGGTTGAGGGCAGGAGG - Intronic
1135097906 16:19579707-19579729 CTCAGGGAGGTGACTGCAGTTGG - Intronic
1135114654 16:19714494-19714516 GCCAGGGAGGCCAGGGATGTTGG - Exonic
1135131937 16:19860295-19860317 GCAGGGGAGGGGCGGGCAGTCGG + Exonic
1135880282 16:26249008-26249030 GCCGGGGAGTTGAGGGGAGAGGG - Intergenic
1136227801 16:28870758-28870780 GCCAGGGAGGTCAAGGCTGCAGG - Intronic
1136240902 16:28943213-28943235 GCCACAGTGGTGGGGGCAGTGGG - Intergenic
1136374302 16:29856273-29856295 TCCAGGGAGGTTGGGGGAGTGGG - Intergenic
1136417570 16:30113157-30113179 GCTGGGGAGGTGAGGCCAGAGGG - Intronic
1137055702 16:35745895-35745917 GCCAGAGAGTCGGGGGCAGTTGG - Intergenic
1137718155 16:50611472-50611494 GCCAGTGGGGAGAGGGCAGCAGG - Intronic
1137724867 16:50650419-50650441 GTCAGGGAGCACAGGGCAGTGGG - Intergenic
1137732408 16:50698363-50698385 GGGAGGGAGGTGAGGGCCCTAGG + Intronic
1137766869 16:50984572-50984594 GCCAGTGAGGTGACAACAGTGGG + Intergenic
1138442030 16:57040949-57040971 GTCAGGGAGCTAAGGGGAGTGGG - Intronic
1139390934 16:66605779-66605801 GCCAGGAGGGTGGGGGCAGGAGG + Intronic
1139615114 16:68084307-68084329 GACAGGGACGTGAGAGAAGTAGG - Intergenic
1139835387 16:69834239-69834261 GGCAGGGAGGCCAGGGCAGCTGG - Intronic
1140887472 16:79257518-79257540 GCTTGGTGGGTGAGGGCAGTGGG + Intergenic
1141730215 16:85817362-85817384 GCCAGGGGGGCCAGGGCAGAAGG - Intergenic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1142314127 16:89332743-89332765 ACTAGGGAGGTCAGGGCAGCGGG - Intronic
1142501497 17:335738-335760 ACCTGGGAGGGGAGGGGAGTGGG - Intronic
1142747822 17:1968735-1968757 GCCAGGCAGGTGCGGGAAGGAGG - Intronic
1143331672 17:6141386-6141408 GCCAGGGAGCAGAGGTCAGAAGG + Intergenic
1143711760 17:8740627-8740649 GCCACTGAGTTGAGGGCAGAGGG + Intronic
1144830323 17:18127471-18127493 ACCAGGAAGGTGAGGCCAGGTGG - Intronic
1144948454 17:18981644-18981666 GGCAGGCAGGTGTGGGCCGTGGG + Intronic
1145276773 17:21436410-21436432 GGCAGGGAGGGGAGGCCAGGAGG - Intergenic
1145314609 17:21722303-21722325 GGCAGGGAGGGGAGGCCAGGAGG - Intergenic
1146057969 17:29590440-29590462 GCAAGGCAGGTGAGGGACGTGGG + Intronic
1146437927 17:32868602-32868624 GGTAGGGAGGTGAGGCCATTCGG + Intronic
1146644437 17:34567761-34567783 GCAGGGGAGGCCAGGGCAGTAGG - Intergenic
1147162230 17:38574912-38574934 GCCATGGAGGTGGGAGCAGAGGG + Intronic
1147314393 17:39612658-39612680 GGCGGGGAGGAGGGGGCAGTGGG - Intergenic
1147443675 17:40462314-40462336 GGTAGGGAGGTGAGGGCAGCGGG - Intergenic
1148652010 17:49257073-49257095 TCCAGGGAGGTCATGGCAGGTGG - Intergenic
1148747562 17:49927163-49927185 CCCAGAGAGGTGAGGACAGGAGG - Intergenic
1148755674 17:49971856-49971878 GCGGGGGAGGTGACGGCAGCTGG + Intronic
1148858324 17:50591222-50591244 GGCAGGGAGGAGAGGGCGGAGGG + Intronic
1149315128 17:55431853-55431875 GGAAGGGAGGGGAGGGCAGGGGG + Intergenic
1149363036 17:55913923-55913945 GGCAGGGTGGTGGGGGGAGTAGG + Intergenic
1149647033 17:58248428-58248450 GGCAGGGAGGTGAGGGAATCTGG - Intronic
1149684459 17:58527427-58527449 GGCAGGGACATGAGGGAAGTAGG + Intronic
1150207010 17:63416785-63416807 TCCAGGGTGCTGAGGGAAGTGGG + Intronic
1150653652 17:67025582-67025604 GCCAGGAGGGTTGGGGCAGTCGG - Intronic
1151557616 17:74854574-74854596 GGCAGGGAGGTGGGGGCTGAGGG - Intronic
1151577551 17:74960296-74960318 GCCAGAGAGGTGTGGCCAGGGGG - Intronic
1151624258 17:75266837-75266859 GCCAGGGAGCTGAGGCCAGTTGG + Exonic
1151895886 17:76980716-76980738 GCCATGTAGGTGATGGGAGTGGG - Intergenic
1152157360 17:78643660-78643682 GCAAGGGAAATGAGGGCAGAAGG - Intergenic
1152247402 17:79192216-79192238 GGCAAGGAGGTGTGGGAAGTTGG + Intronic
1152274849 17:79350158-79350180 GCCAGGGAGGACAGAGCTGTTGG - Intronic
1152302798 17:79505289-79505311 CCCAGGCAGGTGCTGGCAGTGGG - Intronic
1152371910 17:79893477-79893499 GGCAGGGAGGTGACTGGAGTGGG + Intergenic
1152584787 17:81184108-81184130 GCCAGGGTGGTGCGGGCAGTGGG - Intergenic
1152855360 17:82662519-82662541 GGGAGGGAGGTGAGGGCAGGTGG + Intronic
1152946417 17:83200055-83200077 TCCAGGGAAGTGGGGACAGTCGG + Intergenic
1153931790 18:9885593-9885615 GCCTGGGAGGTGGGGGAGGTGGG + Intergenic
1155297434 18:24397942-24397964 GCCAGGCAGGGGCGGGGAGTGGG - Intergenic
1155558098 18:27043959-27043981 GCCAGAGAGATGAAGGTAGTGGG - Intronic
1156084594 18:33383065-33383087 GCTAAGGAGATGAGGACAGTTGG + Intronic
1156394906 18:36690631-36690653 GCCAGAGTGGTGAAGGCGGTGGG - Intronic
1157098918 18:44711992-44712014 GGTGGGGAGGTGAGGGAAGTTGG - Intronic
1157404066 18:47408956-47408978 TCCAGAGAGGTGAGGGAACTTGG + Intergenic
1157555624 18:48611144-48611166 GCCACGCAGGTGAGGACACTGGG - Intronic
1158880114 18:61769920-61769942 GCCAGGGAGATGAAGGCAATTGG - Intergenic
1159887007 18:73918600-73918622 GCCAGGGTGGCTGGGGCAGTGGG - Intergenic
1160425114 18:78773921-78773943 CCCAGGCAGGTGAGGGCCGTGGG - Intergenic
1160506880 18:79432322-79432344 GCCTGTGTGGTGAGGACAGTCGG + Intronic
1160545178 18:79648621-79648643 GCTAGAGGGGGGAGGGCAGTGGG - Intergenic
1160620780 18:80169179-80169201 GGTAGGGAGGTGTGGGCAGAGGG - Exonic
1160674141 19:379856-379878 GGGAGGGAGGTGGGGGCAGAAGG + Intergenic
1160674906 19:384870-384892 GGGAGGGAGGTGGGGGCAGAAGG + Intergenic
1160674916 19:384912-384934 GAGAGGGAGGTGGGGGCAGAAGG + Intergenic
1160674929 19:384954-384976 GGGAGGGAGGTGGGGGCAGAAGG + Intergenic
1160674941 19:384996-385018 GGGAGGGAGGTGGGGGCAGAAGG + Intergenic
1160674953 19:385038-385060 GGGAGGGAGGTGGGGGCAGAAGG + Intergenic
1160821773 19:1062330-1062352 CCCTGGGAGGTGAGAGCGGTGGG - Intronic
1160917317 19:1503446-1503468 GACAGGGGAGGGAGGGCAGTGGG + Intergenic
1161954101 19:7483287-7483309 GCCAGGCAGATGAGGGAAGCTGG - Intronic
1162109525 19:8392482-8392504 GCCAGTGTGGGGAGGGCAGCAGG - Intronic
1162156396 19:8680967-8680989 GGCAGGGAGGTGATGGAAGCAGG + Intergenic
1162931424 19:13959669-13959691 TCCAGGTGGGTGTGGGCAGTGGG + Exonic
1163555473 19:17989935-17989957 GCCAGGGACGGGTGGTCAGTTGG + Intronic
1163737017 19:18987842-18987864 GCCAGGGAGGGGTGGGCAAGGGG + Intergenic
1163758703 19:19121420-19121442 ACCTGGGGGGTGAGGGCAGGAGG + Exonic
1163790075 19:19301393-19301415 TCCAGGCAGACGAGGGCAGTGGG - Intronic
1163809408 19:19421252-19421274 GCCAGGGAGGTGAGGGCAGTAGG + Intronic
1163860243 19:19738997-19739019 GGCAGAGAGCTGAGGGCAGAGGG - Intergenic
1164542499 19:29131372-29131394 GGCAAGGAGGAGAAGGCAGTAGG + Intergenic
1164683199 19:30149701-30149723 GGCAGGGAGAGGAGGGTAGTGGG - Intergenic
1164719777 19:30423834-30423856 GTCAGGGAGGTGGGGGCAGGTGG + Intronic
1165072407 19:33263254-33263276 GAGAGGGAGGGGAGGGCAGCGGG - Intergenic
1165164552 19:33842345-33842367 GGCAGGGAGGTAGGGACAGTGGG + Intergenic
1165309743 19:35022929-35022951 TGCAGGGAGGGGAGGGCAGGGGG - Intronic
1165766477 19:38354633-38354655 GCCAGGGAAATGTGGGCAGGGGG + Intronic
1165785629 19:38460148-38460170 GCCAGGGAGTTGAGAGCGGGAGG - Intronic
1165862021 19:38914264-38914286 GTCAGGGAGGAGAGAACAGTAGG + Intergenic
1166047510 19:40238137-40238159 GCTGGGAAGGTGAGGGCAGGTGG - Intronic
1166338093 19:42121372-42121394 GTCAGGGGGGAGGGGGCAGTCGG - Intronic
1166349851 19:42191457-42191479 ACAAGGGAGGTGAAGGCAGCAGG - Intronic
1166373163 19:42313544-42313566 GCAAGGGAGGCGAGGGGAGCGGG + Intronic
1166540976 19:43605693-43605715 GCCAAGGAGGCGAGAGCTGTAGG - Intronic
1166949543 19:46417288-46417310 GCCCGGGAGGTCAGGGCTGCAGG + Intergenic
1167220109 19:48193851-48193873 GAAAGGGAGGTTAGGGAAGTTGG + Intronic
1167220427 19:48195435-48195457 GCCAGGGAGGGGAGCCCAGGGGG + Exonic
1167257039 19:48436850-48436872 GCTTGGGAGATGAGGGCAGATGG + Intronic
1167328711 19:48840937-48840959 GGCAGTGAGGGGAGGACAGTGGG - Intronic
1167426596 19:49432783-49432805 GCCCAGGAGGAGAGGGCAGGGGG - Intronic
1167684807 19:50949756-50949778 GTCATGGAGGTGAGGGCTGGTGG - Intronic
1168105020 19:54161214-54161236 GCCCGGAAGGTGCGGGCAGCCGG + Exonic
1168260240 19:55189469-55189491 GTGAGGAAGGGGAGGGCAGTGGG - Intronic
1168267422 19:55230421-55230443 GTCAGGGTGATGAGGGCAATGGG + Exonic
1168337978 19:55607087-55607109 GCTTTGGAGGTGAGGGCACTGGG + Intronic
1168453302 19:56483118-56483140 AGAAGGGAGGTGAGGCCAGTGGG + Intergenic
925005691 2:441463-441485 GTCAGGGTGGTGAGGGAAGCAGG - Intergenic
925749884 2:7078529-7078551 CCCAGGGAGGGGAGGAGAGTAGG - Intergenic
925878516 2:8331794-8331816 GGCTTGGAGGTGGGGGCAGTGGG - Intergenic
927519491 2:23690370-23690392 GGCAGGGAGCTGGGGGCACTGGG - Intronic
928100977 2:28437212-28437234 GGCAGAGAGGACAGGGCAGTTGG - Intergenic
928168603 2:28988918-28988940 GCCAGGGAGGCCAGGGGAGTTGG - Intronic
928177321 2:29043587-29043609 GTCAGGTAGGTGAGGGCAGGTGG - Intronic
928317988 2:30260539-30260561 GGCAGGGAGCAGAGGGGAGTTGG + Intronic
928904830 2:36357009-36357031 GCCAGTGCGGGGAGGGCGGTAGG - Intronic
928965168 2:36968520-36968542 GCCTGGGAGTTGTGGGCAGGAGG + Intronic
929053232 2:37855524-37855546 GCCAGGGAAGTGAAAGCAGCTGG + Intergenic
929131918 2:38584136-38584158 GCCTGGGAAGTCAGGGCTGTAGG - Intronic
929218305 2:39437889-39437911 GCGAGGGAGGTGTGTGCAGTGGG + Intergenic
929552644 2:42904287-42904309 GCCAGGGGGGTGAGGAAACTTGG + Intergenic
929825539 2:45306816-45306838 CCCAGGGAGGGGAGAGGAGTTGG - Intergenic
930124321 2:47783834-47783856 GCCTGGGAGGTGGGAGCACTGGG + Intronic
930355083 2:50308254-50308276 GTCAGGGAGGTGGGGGGAGATGG - Intronic
930742332 2:54844256-54844278 GTCAGAGAGGTGACGGCGGTAGG - Intronic
931186715 2:59959577-59959599 TCCAGGGATGGGAGGGCAGAGGG - Intergenic
931670084 2:64639911-64639933 GCCTGGAAGGGGAGGGCAGAGGG + Intronic
931712768 2:65003428-65003450 GCCAGGGATGTGAGGCAAGATGG - Intronic
932089819 2:68796856-68796878 GCGAGGATGGTGGGGGCAGTGGG + Intronic
932305117 2:70696432-70696454 GCAAGGAAGGGGAGGGCAGATGG - Intronic
932404620 2:71504913-71504935 GCCAGGGAAGAGAAGGCAGCAGG - Intronic
932411737 2:71551582-71551604 GCCAGGGAGGTCAGGTCACAAGG - Intronic
932468498 2:71939115-71939137 ACCAGGAATGTGAGGGTAGTGGG - Intergenic
933652543 2:84860971-84860993 GAAAGGGAGGTGGGAGCAGTGGG + Intronic
933652563 2:84861110-84861132 TACAGGGAGGTGAGGCCAATAGG + Intronic
933691484 2:85182373-85182395 GCCAGGGAGCTGAGGGTAGAAGG + Intronic
933695923 2:85217117-85217139 GCCAATGTGGTGAGGGCAGGAGG - Intronic
934276955 2:91581718-91581740 GCCCGGGAAGGGAGGGCATTTGG + Intergenic
934715284 2:96539454-96539476 GGCAGGAAGGTGAAGGCAGTCGG - Intronic
935432489 2:102991023-102991045 GACTGGGAGTTGAGGGCTGTGGG + Intergenic
936027402 2:109043937-109043959 GCCTGGGAGGGCAGGGCAGCAGG + Intergenic
936038539 2:109130571-109130593 GCTAAGGAGGGGAGGGCAGAAGG + Intronic
936043380 2:109167052-109167074 ACCATGGAGGTCAGGCCAGTGGG + Intronic
936752477 2:115662022-115662044 GCCAAGGAGCTGAGGGGAGGGGG - Intronic
936839684 2:116754502-116754524 GGCAGGGAGGGGAGAGCGGTGGG - Intergenic
937006562 2:118521699-118521721 GAGAGGGAGGTGAGGAAAGTAGG + Intergenic
937253634 2:120539941-120539963 GCCAGGGAGGACAGGGCAGTGGG + Intergenic
937291608 2:120785370-120785392 GCCAGGGTGGTGCTGGCTGTTGG + Intronic
937509808 2:122582958-122582980 ACCAGGGAGGGGAGGGGAGGTGG + Intergenic
938096967 2:128470619-128470641 GCCAGGCTGGTGTGGGCTGTTGG + Intergenic
938149044 2:128865432-128865454 TCCAGGGAGATGAAAGCAGTTGG - Intergenic
939341745 2:140905201-140905223 GCGGTGGAGGTGAGGGCAGCAGG - Intronic
939628759 2:144510359-144510381 ACCAGAGAGGTGAGGGCCCTGGG - Intronic
942502945 2:176611134-176611156 CCCTGGGAGGTGAGGTGAGTAGG + Intergenic
942593528 2:177570777-177570799 GCAAGGGATGAGAGGGAAGTGGG - Intergenic
943116564 2:183679200-183679222 GCCAGGGGGCTGATGGCACTAGG - Intergenic
943367866 2:186982623-186982645 GCCAGGGAGGTAAGCTAAGTTGG - Intergenic
943731553 2:191308016-191308038 TCCAGGGAGGGGAGGGGAGCTGG - Intronic
945025559 2:205616598-205616620 GGGAGGAAGGTGAGGGCCGTGGG - Intronic
945063676 2:205930231-205930253 TCCGGGGAGGAGAGGCCAGTTGG - Intergenic
946141122 2:217691575-217691597 GCCAGGGAAGTGAAGGCTCTAGG + Intronic
946334960 2:219030298-219030320 GCCAAGGGGGTGGGGGCAGCTGG + Intronic
947092433 2:226527390-226527412 GCCAGGGAGGAGAAGGAGGTGGG - Intergenic
947670429 2:231932283-231932305 GGCAGGGTGGTGGTGGCAGTAGG + Intergenic
947851969 2:233295494-233295516 GGCAGGGAAGAGAGGGCAGGTGG - Exonic
948371787 2:237494264-237494286 GCCAGAGAGTGGAGGGCAGAGGG + Intronic
948457572 2:238113917-238113939 GCCTGGGGGGTGAGGGGTGTCGG - Intronic
948473737 2:238203452-238203474 GCCAGGGAAGGGAGAGCAGGCGG - Intronic
948699610 2:239751560-239751582 GCCAGGGAGGAGGGGGCCGTTGG + Intergenic
948742724 2:240058114-240058136 GCAAGAGAGGAGAAGGCAGTGGG + Intergenic
948915626 2:241033871-241033893 CCCAGGTAGGCGAGTGCAGTCGG + Exonic
1168804156 20:662910-662932 GCTAGAGAGGTGAGGGCAGCTGG + Exonic
1168846655 20:949783-949805 GGCAAGGAGGAGAGGGCAGGAGG + Intergenic
1169235625 20:3927719-3927741 GCCTGGGAGGGAAGGGCAGATGG + Intronic
1169317807 20:4607955-4607977 GATGGGGAGGTGAGGCCAGTGGG - Intergenic
1169414540 20:5404795-5404817 GACAGGAGGGTGGGGGCAGTAGG + Intergenic
1170651417 20:18245970-18245992 AGCAAGGAGGTGAGGGCAGACGG - Intergenic
1170652777 20:18257720-18257742 GTCATGGGGGTGAGGGCTGTAGG + Intergenic
1170963319 20:21044467-21044489 GCAAGGGTGGTGAGGGCAAGGGG + Intergenic
1171101995 20:22393171-22393193 GCCAGGCAGGTGAGGACACTTGG - Intergenic
1171363003 20:24603390-24603412 AGCAGGGAGGTGAGGGCTGGAGG + Intronic
1171986559 20:31665203-31665225 GCCAGGGAGGGGAAGGGACTAGG + Exonic
1172096741 20:32464109-32464131 GCCAGGGAGGCGTGGACAGTAGG + Intronic
1172132335 20:32664176-32664198 ACCTGGGAGGTGAGGGCCCTGGG + Intergenic
1172518357 20:35551559-35551581 ACCCTGGAGGTGAGGGCAGATGG + Intronic
1172645597 20:36467336-36467358 TCCAGGGAGGTGGGTGCAGAGGG + Intronic
1173250659 20:41362676-41362698 GCCAGGGAGGTGAGCGGGGATGG + Exonic
1173551229 20:43934418-43934440 GCTTGAGAGGTGAGGGCACTGGG + Intronic
1173932917 20:46836815-46836837 TTCAGGGAGGTGATGGGAGTAGG + Intergenic
1173975507 20:47183803-47183825 GCCCGTGAGGAGAGGGCAGGGGG + Intronic
1174064042 20:47851976-47851998 GCCTGGGTGGAGTGGGCAGTAGG + Intergenic
1174414847 20:50359882-50359904 GCCAGGGAGGTGAGGAGATGTGG + Intergenic
1174670606 20:52304325-52304347 ACCAGGGTGGTGGGGGCAGGGGG + Intergenic
1175118976 20:56703726-56703748 GGCAGTGAGGTGGGGCCAGTGGG - Intergenic
1175138329 20:56841569-56841591 CCCTGGGAAGTGAGGGCAGCAGG - Intergenic
1175169479 20:57070150-57070172 GCCAGGAGGGGGAGGGGAGTGGG - Intergenic
1175235756 20:57509900-57509922 GCCAGGCAGGTCATGGCCGTGGG - Intronic
1175534826 20:59702254-59702276 GACAGGGAGGTGATGACAGTGGG - Intronic
1175547879 20:59791019-59791041 ACCAGGGAGGTGAGGGTAGAAGG + Intronic
1176008001 20:62876650-62876672 CCCAGGGAGGAGGCGGCAGTGGG - Intergenic
1176139187 20:63537691-63537713 GGCAGGAAGGTGAGGGCTGCAGG + Intergenic
1176511511 21:7751914-7751936 GCCTGGGAGGTCAGGGCTGTGGG + Intronic
1176837109 21:13803376-13803398 GCCAGTGGGGTGAGCGCAGCTGG + Intergenic
1178645625 21:34382443-34382465 GCCTGGGAGGTCAGGGCTGTGGG + Intronic
1179133501 21:38660325-38660347 CCCAGGGAGGCGCGTGCAGTCGG - Intronic
1179709547 21:43205363-43205385 GGGAGGGAGGTGATGGCTGTGGG - Intergenic
1180004325 21:45013125-45013147 CCCAGGGAGGTGAAAGCAGATGG + Intergenic
1180038699 21:45264707-45264729 GCGAGGGAGGGGTGGCCAGTGGG + Exonic
1180131711 21:45830919-45830941 GCCCGGGAGAGGAGGGCAGAGGG - Intronic
1180258305 21:46649356-46649378 GTCCGGGAGGTGGGGGCAGTTGG + Intronic
1180694872 22:17745301-17745323 GCCAAGGAGTTGGGGGGAGTTGG - Intronic
1180723004 22:17923337-17923359 CCCAGAGAGGTCATGGCAGTTGG - Intronic
1180877325 22:19180650-19180672 CCCAGCCAGGTAAGGGCAGTGGG + Intronic
1181058697 22:20271806-20271828 GCCAGGGAGCTGGGGGGTGTTGG + Intronic
1181842445 22:25675559-25675581 GCCAGGCATGTTAGAGCAGTGGG + Intronic
1182352483 22:29706662-29706684 GCCAGAGAGGCGTGGGGAGTGGG - Intergenic
1182358121 22:29731421-29731443 GCCAGGGTGGTGAGGCAGGTGGG - Exonic
1182522103 22:30890558-30890580 GCCAGGGAGGTGATGGCTTGGGG + Intronic
1182524226 22:30905757-30905779 GCCAGGCAGGGGAGGGCGGCCGG + Intronic
1183023076 22:35043027-35043049 GCCAAGGTGGTGTGGGAAGTGGG + Intergenic
1183255035 22:36756616-36756638 GACAGGGAGGAGTGGGGAGTAGG + Intergenic
1183306222 22:37084570-37084592 GCCAGGGTGGAGAGGGCTGTGGG - Intronic
1183653370 22:39171614-39171636 GCAAGGGAGGAGAGGGGAGCTGG - Intergenic
1183975516 22:41509733-41509755 GCCAGGAACGCGAGGGCTGTGGG + Intronic
1184035737 22:41917274-41917296 GCCAGGACGGTGGGGGCAGGAGG - Intergenic
1184281552 22:43440406-43440428 GCCAGGGTGCTGAGGGCAGGAGG + Intronic
1184342565 22:43893954-43893976 GTCATGGCGGTGAGGGCAGGTGG + Intergenic
1184656050 22:45942541-45942563 GCCAGGCAGGCGAGGGCTCTGGG - Intronic
1184675597 22:46041010-46041032 GCCAGGGAGGGGAAAGGAGTCGG - Intergenic
1185066425 22:48634025-48634047 ACCGGGCAGCTGAGGGCAGTGGG - Intronic
1185226839 22:49658136-49658158 GCCAGGGAGGAGATGGCAGAGGG - Intergenic
1185238780 22:49729666-49729688 TCCAGGGAGGTTAAGGCTGTGGG - Intergenic
1185341564 22:50293484-50293506 GGCTGGGAGGGGAGGGCAGCAGG - Intronic
1185410294 22:50678201-50678223 GCCAGGCAGGTCGGGGCAGCAGG + Intergenic
949287135 3:2420327-2420349 ACCAGAGAGGTGAGAGAAGTTGG - Intronic
949628378 3:5893778-5893800 GGCTGGGAGGTGAGGGAAATGGG - Intergenic
950454376 3:13083975-13083997 CCCAGGGAGGTGAGGGGAAGGGG + Intergenic
951509710 3:23487123-23487145 GCCAAGGTGGTGGGGGCAGGGGG + Intronic
952889706 3:38031711-38031733 CCCTGGGAGTTGAGGGCAGAGGG - Intergenic
952901972 3:38116700-38116722 GCCACTGAGGTGTGGCCAGTAGG + Intronic
953670212 3:44956153-44956175 CCCATGTATGTGAGGGCAGTGGG + Intronic
954238734 3:49277064-49277086 GCCAGGAAGCTGTGGGAAGTGGG - Exonic
954463962 3:50643877-50643899 GCCTGGCAGATGAGGGCAGTAGG - Intronic
954608281 3:51930443-51930465 ATCAGGGAGGTGAAGGCAATAGG - Intergenic
954654922 3:52188512-52188534 TCCAGATAGGTGAGGACAGTGGG - Intergenic
954698454 3:52439777-52439799 GCCAGGGAGGAGGGGTCAGCGGG + Intronic
954712490 3:52512103-52512125 GCGAGGGAGCTCAGGGCTGTGGG - Intronic
954733564 3:52685867-52685889 GTAAGGGAGGTGAGGGCGGCGGG - Intronic
955490243 3:59474809-59474831 GCCAGGGAGGTCAAGGCTGCAGG - Intergenic
955608313 3:60730708-60730730 GCCAGGTAGGCGAAGGCAGTAGG - Intronic
955671768 3:61409830-61409852 GACAGGAAGGGGAGGGCTGTCGG + Intergenic
955719770 3:61868424-61868446 GCCAGGGAGCTGGGGGCAGGGGG - Intronic
957939912 3:86991201-86991223 GACAGGGAGGCGGGGGCAGAGGG + Intergenic
957991047 3:87627804-87627826 GGCAGTTTGGTGAGGGCAGTCGG + Intergenic
961133682 3:124491274-124491296 GCGGGGAAGGGGAGGGCAGTGGG - Intronic
961644547 3:128385754-128385776 GCTAGGGAGCTGAGGGCTGCGGG - Intronic
961827933 3:129608280-129608302 GCGAGGGTGTTGAGGGAAGTGGG - Intergenic
962808809 3:138945371-138945393 GTCAGGGAGGTGAGCACAGGAGG + Exonic
962886383 3:139631811-139631833 AGCATGGTGGTGAGGGCAGTAGG - Intronic
964621521 3:158724094-158724116 GCTAGAGAGGAGAGGGCAGGTGG + Intronic
964627384 3:158772437-158772459 GCAGGGGAGGTAAGGGCTGTGGG + Intronic
966861490 3:184233324-184233346 GCCAGCGGGGTGAGCACAGTGGG - Exonic
967015655 3:185479290-185479312 GACAGGGAGGTGAGGGATGGAGG + Intronic
967702374 3:192608146-192608168 GGAAGGGTGGTGGGGGCAGTGGG + Intronic
967827608 3:193890675-193890697 GGCAGGGAGGAGAGGACAGCAGG - Intergenic
968583744 4:1406481-1406503 GCCAGGGATGGGAGCCCAGTAGG - Intergenic
968616286 4:1579177-1579199 GCCAGGGCAGGGAGGGCAGGGGG - Intergenic
968652792 4:1766840-1766862 GCCAGGAGGGTGAGGGCAGGCGG - Intergenic
968911029 4:3477080-3477102 GCCAGGGGAGTGAGGGAAATCGG + Intronic
968914672 4:3492241-3492263 GCCAGCATGGTGAGGGCAGGGGG + Intronic
969142885 4:5095112-5095134 GACTGGGAGGAGAGGGCTGTAGG + Intronic
970431805 4:15995635-15995657 GGCAGGGAGGTAGGGGCAGTAGG - Intronic
973017239 4:45155859-45155881 ACCAGGGAAGTCAGGGCAATGGG + Intergenic
973847307 4:54926158-54926180 GCCAGGGAGGGGTGGGGTGTTGG - Intergenic
974196261 4:58579768-58579790 GTCAGGGAGTTGGGGGCAGGGGG - Intergenic
975067077 4:70079115-70079137 GCCAGGTAGGTGAGCACAATTGG + Intergenic
975648893 4:76572515-76572537 GCCAGGGAGGTGAGGGACAGAGG + Intronic
976603627 4:86962077-86962099 GCCAGGGAGTTGAGAGCAAAGGG + Intronic
977910291 4:102526341-102526363 GTGAGGGATGGGAGGGCAGTGGG + Intronic
977995243 4:103492961-103492983 GCCAGGGAGGTTAGGCCTGATGG + Intergenic
978917785 4:114147502-114147524 AGCAGGGAGGGGAGGGCGGTGGG + Intergenic
980724568 4:136741955-136741977 GCCAGCAAGGAGAGGGGAGTGGG + Intergenic
982358286 4:154491963-154491985 GGCAGGGAGGGGAAGGCAGGCGG - Intergenic
984233517 4:177129706-177129728 GCCCTGGTGGTGACGGCAGTAGG + Intergenic
984710835 4:182882864-182882886 GCCCGGGAGGTGGAGGCTGTGGG + Intergenic
985537696 5:473979-474001 CCCACGGAGCTGAGGGCACTAGG - Intronic
985758601 5:1733458-1733480 GTCAGGGAGGAGAGGGCAAGCGG - Intergenic
985770410 5:1806426-1806448 GCCAGGCAGGTGAGGCCACAGGG - Intronic
986044078 5:4020857-4020879 GCCAGGGAGGAGCTGGCATTTGG + Intergenic
986196965 5:5546218-5546240 ACCAGGGAGGAGAGGGCTGGTGG - Intergenic
986437224 5:7746076-7746098 TCCAGGGACGGGAGGGCAGGAGG - Intronic
986580841 5:9264322-9264344 GCCAGGAAGGTGAGGGAAAGTGG + Intronic
987018298 5:13843676-13843698 GCAAGGGAGGTGTGGGCGCTCGG - Intronic
987247138 5:16060421-16060443 GACAGGGAGCTCAGGGCAGCAGG - Intergenic
987335368 5:16893947-16893969 GCCAGGCAGTGGAGTGCAGTGGG + Intronic
987520051 5:18970164-18970186 AGCAGTGAGGTGAGGGCAGAGGG + Intergenic
988099988 5:26662839-26662861 GTCAGAGAGGGGATGGCAGTAGG + Intergenic
989391476 5:40905209-40905231 CCAAGGGAGGTGAGGGCAAATGG + Intergenic
990407960 5:55510974-55510996 GCAGGGGTTGTGAGGGCAGTAGG - Intronic
992869248 5:80990031-80990053 GCCAAGGTGGAGAGGGCAGATGG + Intronic
993701851 5:91128081-91128103 GAGAGGGAGGGGAGGGCATTGGG - Intronic
994060491 5:95471607-95471629 GCCTGGGAGCTGAGGGGAATTGG - Intronic
994069937 5:95589423-95589445 GCCAGGGAAGGGAGAGCATTAGG - Intronic
994251609 5:97542403-97542425 GCGAGGGCTGTGAGGGCTGTCGG + Intergenic
994590111 5:101761348-101761370 GCCAGGGAGCTGAAGGAACTTGG + Intergenic
994926619 5:106124038-106124060 GCCATAGACGTGAGGGCAGAGGG - Intergenic
995228015 5:109725321-109725343 GCCTGGGAGGAGAAGGCAGCTGG - Intronic
996457248 5:123698962-123698984 GTCAGGGAGGTGAGGGCAGGGGG - Intergenic
996735661 5:126755879-126755901 GCCAGGGAGGTGTGTCCAGGAGG - Intergenic
996790641 5:127290231-127290253 GGCGGGGAGGTGAAGGCAGAGGG - Intergenic
997364937 5:133319607-133319629 GACAGGCAGGAGAGGGCAGTGGG + Intronic
997565937 5:134886470-134886492 GCTATGGAGGTGAGTGGAGTTGG + Intronic
997590090 5:135067092-135067114 GCCAGGGAGGACAGAGCACTGGG - Intronic
997645352 5:135477963-135477985 GCCAGGGAGGAGTGGACAGAGGG - Intergenic
997823905 5:137089476-137089498 GCCAGTGACCTGAGGGCAGTGGG + Intronic
998733300 5:145106215-145106237 GACAGGGAGTATAGGGCAGTGGG - Intergenic
999328321 5:150656895-150656917 GCCTGGGAGGCGCGGGCAGCGGG - Intronic
999444487 5:151628364-151628386 GGCAGGAAGGAGAGGGCTGTGGG + Intergenic
1000171061 5:158703786-158703808 GCCAGGGAGATGGGGGCAAGGGG - Intronic
1001083256 5:168682171-168682193 ACCAGGCAGGTTAGGACAGTTGG - Intronic
1001084177 5:168688316-168688338 GGCAGGGAGGTGAGGGTTGGGGG + Intronic
1001088764 5:168721516-168721538 GCCAGGCAGGCGAGGAGAGTGGG + Intronic
1001121056 5:168980214-168980236 GCCAGGGAGGAGAGGGCGTGGGG - Intronic
1001234072 5:170014728-170014750 GCCCTGGAGGAGTGGGCAGTAGG + Intronic
1001277230 5:170359732-170359754 GCAAGGGTGGTGAGGCCAGTAGG - Intronic
1001423020 5:171601237-171601259 GCCAGGGCGGAGGGGGCAGGAGG + Intergenic
1001740949 5:174052268-174052290 TTCAGGGAGGAGAGGGTAGTGGG + Intronic
1002040840 5:176513017-176513039 GACAGGCAGGGGAGGGCAGAAGG - Intergenic
1002931686 6:1639324-1639346 GCCAGTGAAGTGAGGGCTCTTGG + Intronic
1003324771 6:5083981-5084003 GCTAGGGAGCTGGGAGCAGTGGG + Intergenic
1003838823 6:10099250-10099272 CCCAAGGAGGTGACGGCAGGTGG - Intronic
1003961340 6:11211898-11211920 GCCAGGATGGGGAGGGCAGGAGG + Intronic
1003975165 6:11336078-11336100 CTGAGGGAGGTGAGGGCAGGAGG - Intronic
1004193544 6:13485674-13485696 GCCTGGGAGTTGAGGGGAGCAGG + Intronic
1005112224 6:22294674-22294696 ATCAGGCAGCTGAGGGCAGTGGG - Intronic
1005348587 6:24912773-24912795 GTCAGGAAGGTGATGGGAGTGGG - Intronic
1005771841 6:29081701-29081723 GCCTGGGAGGTTAAGGCAGCAGG - Intergenic
1006079896 6:31559124-31559146 GCCAGGGAGGGGAGGGAAACTGG - Intergenic
1006103473 6:31701773-31701795 GCCAGGGAGGACAGGTCACTGGG + Intronic
1006285637 6:33092082-33092104 GCCAAGGCCGTGAGGGCAGAGGG + Intergenic
1006392079 6:33764398-33764420 CCCAGGCTGGGGAGGGCAGTGGG - Intergenic
1006415559 6:33901767-33901789 GGGAGGGAGGTGAGGGCAGAAGG + Intergenic
1006423047 6:33947458-33947480 GGCTGGGAGGAGAGGGCAGTGGG + Intergenic
1006981861 6:38153813-38153835 TCCAGGTGGGTGAGGGCAGGAGG + Exonic
1007241790 6:40431875-40431897 GCCGGGGAGGTGGAGGCAGTGGG - Exonic
1007701536 6:43769122-43769144 GCCAGGGAACTGAGGCCAGGGGG - Intergenic
1008087854 6:47263068-47263090 GCCATGGAGGTGATGGGAGGTGG + Intronic
1009289633 6:61867494-61867516 GCTAGGGAGGTGTGGTCATTTGG + Intronic
1009515272 6:64608349-64608371 GGAAGGGAGGTGAGAGTAGTTGG + Intronic
1010034182 6:71302932-71302954 GGCAAGGAGGTGAGGACAGCAGG - Exonic
1010752416 6:79630854-79630876 GCTTGGGAGGTGTGGGCGGTGGG - Intergenic
1010779039 6:79922254-79922276 GAGAGGGAGGTGAGGGGAGAGGG - Intronic
1011410180 6:87059633-87059655 GCCAGGGAGGTGGGGGGAGGGGG + Intergenic
1011441873 6:87395920-87395942 GCCAGGGAGGTTAGGTGTGTGGG + Intronic
1011772631 6:90691857-90691879 GTCAGAGAAATGAGGGCAGTGGG + Intergenic
1012984962 6:105865944-105865966 GCCAGGGAGGTGAGGGCTGATGG - Intergenic
1013036323 6:106387484-106387506 GACAGGGAGGTGACAGCAGGAGG - Intergenic
1013121106 6:107141869-107141891 GACAGTGAGGTGAGGGGACTAGG + Intergenic
1013602856 6:111721158-111721180 GCCTGGAAGGGCAGGGCAGTCGG - Intronic
1013832125 6:114285665-114285687 GTCAGGGTGGGGAGGGCGGTGGG + Intronic
1014440230 6:121465372-121465394 GGCAGGGAGGTGAGTACAGCAGG + Intergenic
1014535756 6:122611011-122611033 GCCAGTGAGGTGAGGTGACTTGG - Intronic
1014569898 6:122996345-122996367 GCCGGGGAGGTGGGCGCAGCGGG - Exonic
1014994627 6:128126197-128126219 GCAAGGGAGGGGAGAGCATTAGG - Intronic
1015159431 6:130136085-130136107 ACCAGGGTGGTGGTGGCAGTAGG - Intronic
1016923388 6:149317630-149317652 GCGAGGGGGGTGGGGGCAGAGGG + Intronic
1016997299 6:149969728-149969750 GCCAGGGAGGGGAGGGCCTCAGG - Intronic
1017774552 6:157670640-157670662 GCGGGGGAGGGGAGGGGAGTAGG - Intronic
1018330912 6:162727271-162727293 GCCAGTGAGGTGAGGGGCGAAGG + Exonic
1018589937 6:165408742-165408764 GCCAGGGAGAAGAGGGAAGAAGG + Intronic
1019295462 7:271866-271888 GCCTGGGAGGAGAGGGGAATGGG - Intergenic
1019356588 7:583050-583072 GCCAGGGCCGGGAGGGCAGGGGG + Intronic
1019376019 7:692571-692593 GCCAGGGAGTTGAGAGAGGTTGG + Intronic
1019525321 7:1478065-1478087 GCCAGAGAGGAGAGTGCAGCCGG + Intronic
1019552650 7:1610757-1610779 GCCTGGGGGGTGGGGGCAGCGGG + Intergenic
1019614594 7:1953396-1953418 GCCAGGGAGGAGCAGGCAGGTGG + Intronic
1019692798 7:2426100-2426122 GCCAGTGAGAAGAGGGCAGCTGG + Intronic
1019729746 7:2623348-2623370 GCCAGGGAGGGGCTGGCAGGGGG + Intergenic
1019771630 7:2886923-2886945 GCCAGGGTGGAGAGGACAGTCGG + Intergenic
1020014173 7:4821263-4821285 CCCACAGATGTGAGGGCAGTGGG + Intronic
1020273215 7:6609196-6609218 GCCAGGCAGCTGAGGTCAGCAGG + Intergenic
1020947753 7:14635721-14635743 GACAGGGATCTGAGGGAAGTTGG + Intronic
1021277592 7:18673169-18673191 ACCTGGGAGGTTAGGGCAGGAGG + Intronic
1022210158 7:28200804-28200826 GTCAGGGTGGTGGGGGCAGAGGG + Intergenic
1022241895 7:28520466-28520488 GCCAGGGAGTTGCAGGAAGTGGG - Intronic
1022924801 7:35046248-35046270 TCCAGGGAAGAGAGGGCATTGGG - Intergenic
1023125374 7:36949701-36949723 GCCATGGGGATGAGGGGAGTTGG - Intronic
1023483599 7:40660856-40660878 GACAGAGAGGTGAGGGCACAAGG - Intronic
1023596063 7:41830366-41830388 GCCAGTGAGGTGAGGCCCTTTGG + Intergenic
1023815971 7:43950298-43950320 GACAAGGATGGGAGGGCAGTTGG + Intronic
1023931693 7:44710024-44710046 GCCTGGGAGGTCAGGGCTGCAGG + Intergenic
1023941558 7:44771566-44771588 GCCAGGGACATCAGTGCAGTCGG + Intergenic
1023983166 7:45081262-45081284 GCCTGGGAGTAGAGGGCAGAGGG + Exonic
1023984978 7:45088988-45089010 GGCCGGGCGGTGGGGGCAGTGGG + Intergenic
1024367322 7:48535775-48535797 GCCAGGGAAGTGGGGTAAGTCGG + Intronic
1025255637 7:57382316-57382338 GCCAGGGAGGTGAGGAGATGTGG - Intergenic
1027164202 7:75823143-75823165 TGCAGGGGGGAGAGGGCAGTGGG + Intronic
1027190578 7:75993798-75993820 GCCAGGGAGGAGGAGGCTGTTGG - Intronic
1027265720 7:76494239-76494261 GCCAGAGAGGTGGGGGCAGGAGG + Intronic
1027317091 7:76992356-76992378 GCCAGAGAGGTGGGGGCAGGAGG + Intergenic
1028424982 7:90676453-90676475 GTGAGGGAGGAGAGGGTAGTAGG + Intronic
1028730224 7:94139016-94139038 GGCAGGGCGATGAGGTCAGTAGG + Intergenic
1029270580 7:99374773-99374795 GCGCGGGAGGTGAGGGCCGTGGG + Exonic
1029446417 7:100615291-100615313 GTCAGGGAGGAGTGGGGAGTAGG - Exonic
1029472025 7:100760619-100760641 GCCAGGGATGGAAGGGGAGTGGG - Intronic
1030895214 7:115051245-115051267 GCCAAGGAGGTGATGACAATGGG + Intergenic
1031550034 7:123098618-123098640 GCTGGGGGGGTGAGGGAAGTGGG + Intergenic
1031991842 7:128203533-128203555 GCAAGGGAGGGTAGGGGAGTTGG - Intergenic
1032077977 7:128845109-128845131 GCCAGGGAAGGCAGGGCTGTAGG - Exonic
1033653682 7:143360171-143360193 CACAGGGAGGTGAGGGCCGGCGG - Intronic
1034178254 7:149117396-149117418 GGAAGGGAGGAGAGAGCAGTGGG - Intronic
1034397634 7:150839258-150839280 GGGAGGGAGGACAGGGCAGTGGG - Intronic
1034487924 7:151377628-151377650 AGCAGGAAGGTCAGGGCAGTGGG - Exonic
1034497619 7:151431921-151431943 GCCAGGGAGGGGAGAGTGGTGGG - Intronic
1035100087 7:156389289-156389311 GTGAGGGCGGTGAGGACAGTGGG + Intergenic
1035180939 7:157089254-157089276 GCCAGGGAGCGGAGGACAGATGG + Intergenic
1035376648 7:158411055-158411077 GCCAGGGAGGAGAGGGCCCCGGG - Intronic
1035459589 7:159030788-159030810 ACCTGGGAGGTGAGGGCAGCGGG + Exonic
1035471089 7:159109343-159109365 GGCAGGGAGGTTGGGGGAGTGGG + Intronic
1035523101 8:290979-291001 GTCAGGGATGTGAGTGCAGAGGG + Intergenic
1035523114 8:291028-291050 GTCAGGGATGTGAGTGCAGGGGG + Intergenic
1035839561 8:2795707-2795729 TCCTGGGAGGGGAGGGCAGAGGG + Intergenic
1036132445 8:6128419-6128441 GGCAGGGATGTGAGGGCAGAGGG + Intergenic
1036686476 8:10914842-10914864 GCCAGGGAGGAGAGAGGAGGGGG - Intronic
1037244483 8:16817288-16817310 GCCAGGGAGGTCAAGGCTGCAGG - Intergenic
1037632293 8:20669186-20669208 TCCAGGCAGGTGAGGGGAGTAGG - Intergenic
1037662028 8:20936128-20936150 GAAAGGGAGGTGAGGACAGAAGG - Intergenic
1038634420 8:29273857-29273879 GCCAATGTGGTGGGGGCAGTGGG + Intergenic
1038838425 8:31155410-31155432 GCCAGGGATTTGAGACCAGTTGG + Intronic
1039411378 8:37357971-37357993 GCCAGGCAGAGGAGGGAAGTAGG - Intergenic
1039612876 8:38932987-38933009 GCCAGGGAGGCCAGGACAGAGGG + Intronic
1040585436 8:48736179-48736201 GGAAGTGAGATGAGGGCAGTGGG - Intergenic
1041780391 8:61572639-61572661 GCCATGGAGATGAGGGAAGTGGG - Intronic
1042224629 8:66505546-66505568 CCCAGGGAGGTGCGGGGAGCTGG - Intronic
1042959458 8:74288163-74288185 GCCATGGAGAAGAGGGCAGATGG + Intronic
1043491007 8:80749136-80749158 ACTAGGGAGGTGAAGGCTGTTGG - Intronic
1043641179 8:82452256-82452278 GCAAGGGAGGAGAGGACAGTGGG + Intergenic
1043914606 8:85906966-85906988 GCCTGGGAGGAGAAGACAGTGGG - Intergenic
1045317094 8:101052555-101052577 GCCAGGCAGGTGAGAGAAGCTGG - Intergenic
1046645735 8:116783628-116783650 GCCAGGGAGGGGAGAGAAGCTGG + Intronic
1047045482 8:121048025-121048047 CCCAGGGAGTTGAGTTCAGTTGG - Intergenic
1047250999 8:123182213-123182235 GGCAGGGAGGGGTGGGCACTTGG + Exonic
1047314517 8:123720195-123720217 GCCAGGGAGCAGAGGGCAGAGGG + Intronic
1047704935 8:127488681-127488703 GGTAGGGAGGTGAGGGGTGTGGG + Intergenic
1049266335 8:141669866-141669888 GCCAGGGAGCAGTGGGCAGTGGG - Intergenic
1049499410 8:142953526-142953548 GCCTGGGATGGGAGGGGAGTGGG - Intergenic
1049654372 8:143791329-143791351 GGCAGTGAGCTGAGGGCAGCTGG + Intronic
1049783447 8:144439381-144439403 GCCAGGCAGCTGTGGGAAGTTGG - Intronic
1049786224 8:144452094-144452116 GCCAGGGTGGCGAGGACAGGTGG + Intronic
1050380321 9:5021168-5021190 GCAAGGAAGGAGAGGGAAGTGGG - Intronic
1051171516 9:14322531-14322553 GCCAGGGAGGCGACTGCAGGAGG - Intronic
1051240460 9:15050101-15050123 GCGGGGGAGGTGAGGGGAGAGGG + Intergenic
1052524452 9:29595868-29595890 GCCATGGAGGGGAGGGAAGGAGG + Intergenic
1053143544 9:35697115-35697137 GCCAGGGAGGTGAGGATAACAGG + Exonic
1053272760 9:36761562-36761584 GCCAGGGAGGAGAGGGCGGGTGG + Intergenic
1053617124 9:39779858-39779880 GCCAGGGATTTGAGGGAAGCAGG - Intergenic
1053897335 9:42755407-42755429 GCCAGGGATTTGAGGGAAGCAGG + Intergenic
1054236393 9:62562500-62562522 GCCAGGGATTTGAGGGAAGCAGG + Intergenic
1054267044 9:62927579-62927601 GCCAGGGATTTGAGGGAAGCAGG + Intergenic
1054550535 9:66597030-66597052 GCCAGGGATTTGAGGGAAGCAGG + Intergenic
1055539100 9:77282687-77282709 CCCAGGGAGGTGAGCGCTGTGGG + Intronic
1056521070 9:87402202-87402224 ACCAGGGAGGTCAAGGCAGGAGG + Intergenic
1057627036 9:96686959-96686981 GCCAGCGCGGGGCGGGCAGTAGG - Intergenic
1057695910 9:97322994-97323016 GCTGGGGAGGGGAAGGCAGTGGG - Intronic
1057873305 9:98734020-98734042 GTCAGGGAGGAGGGGTCAGTTGG - Exonic
1057951044 9:99369330-99369352 GGCTGGGAGGAGAGGGCACTGGG - Intergenic
1058028240 9:100166444-100166466 GCCTGGGAGGTCAGGGCTGCTGG + Intronic
1058425690 9:104873999-104874021 GGCAGGGAGTTGAGGGAAGTGGG - Intronic
1058820011 9:108721229-108721251 ACCAGGGAGGTGATGGTAGAAGG - Intergenic
1058867680 9:109176533-109176555 GCCAGGTAGGTCAGGTCAGCAGG - Exonic
1058951780 9:109910731-109910753 AGCAGGGCGGTGAGGGCAGAGGG + Intronic
1059436864 9:114282384-114282406 TCCAGGGAGGGGAGGGATGTGGG - Intronic
1060973630 9:127752958-127752980 ACCAGGGTGGAGAGGGCAGGTGG + Intronic
1061144322 9:128788257-128788279 GTGAGGGAGCTGAGGGCTGTGGG + Intronic
1061295441 9:129674462-129674484 GCCAAGGAGCTGAGGCCTGTAGG + Intronic
1061330740 9:129890643-129890665 CCCTGGGAGGGGAGGGTAGTGGG + Intronic
1061971388 9:134047324-134047346 CCCAGGGACGTGCAGGCAGTTGG - Intronic
1062004342 9:134231787-134231809 GCCAGGGTTATGGGGGCAGTGGG + Intergenic
1062208169 9:135348635-135348657 GCCAGGGAGGGGGGGGCGGGAGG - Intergenic
1062216169 9:135390898-135390920 GGAAGGCAGGTGAGGGCACTAGG + Intergenic
1062344584 9:136109046-136109068 GGCAGGGCGGGGAGGGCAGAGGG - Intergenic
1062387738 9:136319948-136319970 GCCAGTCAGGTGAGGGCGGTGGG - Intergenic
1062441334 9:136571042-136571064 GCGAGGGAGGGGAGGGTTGTGGG - Intergenic
1062443825 9:136585109-136585131 GACAGGGAGATGGGGCCAGTGGG + Intergenic
1062540808 9:137040891-137040913 CCCAGGGAGGTGTGGGGCGTGGG + Exonic
1186517205 X:10174828-10174850 GGCAGGGAGGTGAGGGGACTGGG - Intronic
1186596290 X:10985116-10985138 GCCATGGAGGTAATGGCAGGAGG + Intergenic
1187257730 X:17657065-17657087 GCCAGAGAGGTGGGGGCGATGGG - Intronic
1187733266 X:22278253-22278275 GCAGGAGAGGTGAGGGAAGTAGG + Intergenic
1189228309 X:39432133-39432155 GCCAGGGAGGGGAGGCCTCTGGG + Intergenic
1189262140 X:39686730-39686752 GGCAGGCCGGTGAGGGCAGGTGG + Intergenic
1189742807 X:44138248-44138270 GCCAGGGGGCTGAGGGCAAGAGG + Intergenic
1189783960 X:44542865-44542887 GCCAGGGAGAGGAGGGCGGGTGG - Exonic
1190303439 X:49069146-49069168 GCCAGGGCAGTTGGGGCAGTGGG + Intronic
1190325585 X:49205084-49205106 GCTGGGGAGGGGAGGGCAGGAGG + Exonic
1190605543 X:52139003-52139025 GCCAGGGACCTGAGGCCACTGGG - Intergenic
1191714727 X:64186530-64186552 GCCTGGGGGCTGAGGGCAGGTGG + Exonic
1192139869 X:68638362-68638384 GGCAGGGGGGTGGGGGCAGGTGG - Intergenic
1192446515 X:71215282-71215304 GACAGGGAGGTGAGGAGACTGGG + Exonic
1192633063 X:72791808-72791830 GACAGGGAGGTGAGGTCAGAAGG - Intronic
1192648646 X:72928993-72929015 GACAGGGAGGTGAGGTCAGAAGG + Intronic
1192891674 X:75398096-75398118 GCCATGGAAGTGAGGCCTGTGGG - Intronic
1193508629 X:82372587-82372609 GCCAGGGAGCCGAAGGCACTTGG + Intergenic
1194125260 X:90008623-90008645 CCCAGGGTGATGAGGGCAGAGGG + Intergenic
1196098857 X:111827930-111827952 CCAAGGGAGGAGAGGGAAGTAGG - Intronic
1196594098 X:117522893-117522915 GACAGAGAGGTGGGGGCTGTGGG + Intergenic
1198479364 X:137026985-137027007 GTGAGGCAGGTGAAGGCAGTGGG + Intergenic
1199761210 X:150905450-150905472 GTCAGGGAGGTGACGGTTGTGGG - Intergenic
1199813874 X:151379293-151379315 GCCAGTGAGGTGAGGGCCTCAGG - Intergenic
1200079929 X:153571284-153571306 TCCTGGGAGCTGAGGGCAGCAGG + Intronic
1200094387 X:153650373-153650395 GCAAGGGAGGGGAGGGCAGGAGG + Exonic
1202045953 Y:20737663-20737685 GGCAGGGAGAGGTGGGCAGTAGG - Intergenic