ID: 1163811927

View in Genome Browser
Species Human (GRCh38)
Location 19:19438485-19438507
Sequence CTGCCCTCAAACAATGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 211}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163811927_1163811933 10 Left 1163811927 19:19438485-19438507 CCCAGGGCATTGTTTGAGGGCAG 0: 1
1: 0
2: 0
3: 11
4: 211
Right 1163811933 19:19438518-19438540 TGTAGTTTCTCCTAGGCCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 177
1163811927_1163811934 14 Left 1163811927 19:19438485-19438507 CCCAGGGCATTGTTTGAGGGCAG 0: 1
1: 0
2: 0
3: 11
4: 211
Right 1163811934 19:19438522-19438544 GTTTCTCCTAGGCCCCAGGCTGG 0: 1
1: 0
2: 1
3: 30
4: 268
1163811927_1163811935 15 Left 1163811927 19:19438485-19438507 CCCAGGGCATTGTTTGAGGGCAG 0: 1
1: 0
2: 0
3: 11
4: 211
Right 1163811935 19:19438523-19438545 TTTCTCCTAGGCCCCAGGCTGGG 0: 1
1: 1
2: 1
3: 27
4: 268
1163811927_1163811932 3 Left 1163811927 19:19438485-19438507 CCCAGGGCATTGTTTGAGGGCAG 0: 1
1: 0
2: 0
3: 11
4: 211
Right 1163811932 19:19438511-19438533 GGCTGGCTGTAGTTTCTCCTAGG 0: 1
1: 0
2: 3
3: 74
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163811927 Original CRISPR CTGCCCTCAAACAATGCCCT GGG (reversed) Intronic
900644434 1:3702616-3702638 CTGCCCCGCAACAAGGCCCTGGG + Intronic
901256430 1:7831888-7831910 CTGGCCTCAAAAAATGAGCTAGG + Intronic
901563917 1:10096388-10096410 CTCCCCTCAAGCAGTGGCCTCGG + Intronic
904482919 1:30805390-30805412 CTGCCCCCAACCTTTGCCCTGGG - Intergenic
904880450 1:33692665-33692687 ATGCCTTCAATCCATGCCCTCGG + Intronic
908530265 1:65027394-65027416 CTGCCCTCCTCCAATTCCCTTGG + Intergenic
908688606 1:66752420-66752442 GTGACCTCAAACAGAGCCCTCGG - Intergenic
910064557 1:83137865-83137887 CTGGCCTCATACAATGCGTTAGG + Intergenic
912565664 1:110585550-110585572 TTGGCCTCACACCATGCCCTGGG - Intergenic
914808692 1:151010310-151010332 CTGGACTCAAACAATCCCCCTGG + Intronic
916322246 1:163517772-163517794 CTGGCCTCATACAATGAGCTTGG - Intergenic
920060089 1:203221403-203221425 CTGCCCTCAATCAATCCTCCTGG - Intronic
921062155 1:211594351-211594373 CTGCCCTCAAAAAGTGTCCAGGG - Intergenic
921569927 1:216765584-216765606 CTTCCCTCAGAGAATGCCTTTGG - Intronic
921686937 1:218100533-218100555 CTGCCCTCATACAATGAATTGGG - Intergenic
921751634 1:218800945-218800967 CTGCCCTCATAGAATGACTTAGG + Intergenic
924620434 1:245655589-245655611 CTGCCCTCAAACAGTCCAATGGG + Intronic
1065441772 10:25760075-25760097 CTGTCCTCAATCAATTCCCAAGG - Intergenic
1067494956 10:46753548-46753570 CTGCTCAAAAACACTGCCCTAGG + Intergenic
1067599700 10:47586848-47586870 CTGCTCAAAAACACTGCCCTAGG - Intergenic
1069255088 10:66322846-66322868 CTGCTCCCTCACAATGCCCTGGG - Intronic
1071384295 10:85104158-85104180 CTGCCCTCAGACAAAAGCCTGGG - Intergenic
1072880052 10:99217812-99217834 CTGGCCTCAAACAATCCTCTTGG + Intronic
1073173925 10:101538743-101538765 GTGCCTTCAAAAAGTGCCCTGGG + Intronic
1073278595 10:102334468-102334490 GTGGCCTCAAGCACTGCCCTTGG - Intronic
1073708048 10:106009715-106009737 ATGACCTCAAAAAATGCACTGGG - Intergenic
1074833231 10:117264251-117264273 CTGGCCTGCAACAGTGCCCTGGG - Intronic
1075937248 10:126352883-126352905 CTGCACTGAAACCATTCCCTGGG - Intronic
1075993163 10:126855058-126855080 CTGCCTTAAAACAGTGCTCTGGG - Intergenic
1076175681 10:128366195-128366217 CTTCCCTGAAACAAAGCCGTGGG + Intergenic
1076440698 10:130479417-130479439 CTGCCTTCCCCCAATGCCCTGGG - Intergenic
1076825961 10:132968369-132968391 CTGCCTTCAAACACTGGCCTCGG + Intergenic
1076992882 11:284763-284785 CTGAGCTCAAACACTGACCTGGG + Intronic
1077247134 11:1545122-1545144 CTGCCCTCCAGCAATGCCTGGGG - Intergenic
1077300478 11:1844300-1844322 CTGCCCACAACCCCTGCCCTGGG - Intergenic
1077445026 11:2586861-2586883 ATGTCCTCATACAAGGCCCTGGG + Intronic
1078104866 11:8352075-8352097 CTGCCGTCAAAGCATCCCCTGGG + Intergenic
1080642727 11:34167128-34167150 CTGGCCTCAAGCAGTGCCTTTGG + Intronic
1084946400 11:72641250-72641272 CTGCCCTCAGGCGATGCCCAGGG - Intronic
1086201352 11:84206381-84206403 CTGGCCTCAAAAAATGACTTGGG - Intronic
1087725539 11:101712015-101712037 CTGACTTCAAACAATACCATAGG + Intronic
1089718205 11:120384655-120384677 CAGGTCTCAAACTATGCCCTAGG - Intronic
1089962893 11:122631360-122631382 CTGTGCTCAAGCAATCCCCTTGG + Intergenic
1092109386 12:5948276-5948298 GTGGCCTCAAACAAGCCCCTTGG - Intergenic
1092228810 12:6765984-6766006 CTGACCCCAAAAAAAGCCCTGGG - Intronic
1095951403 12:47783804-47783826 CTGCCCGCCCACCATGCCCTTGG - Exonic
1096282071 12:50264681-50264703 CTGACCTCAAGCAATGTGCTGGG - Intronic
1096436808 12:51598295-51598317 CTCCCCTCCAACAATTCCTTTGG + Intronic
1097624704 12:61985975-61985997 CAGCCCACAACCATTGCCCTTGG + Intronic
1102131758 12:110536475-110536497 CTGCTCTAAAACATTGCTCTGGG - Exonic
1105702370 13:22943094-22943116 CTGGCATCAAACACTGCTCTGGG + Intergenic
1105854993 13:24364878-24364900 CTGGCATCAAACACTGCTCTGGG + Intergenic
1105998507 13:25696126-25696148 CTGCTCACTAACAATGCACTGGG - Intronic
1106502222 13:30339918-30339940 CTGCCCTCCAACTGTGACCTTGG + Intergenic
1109144486 13:58760862-58760884 CTGCCCCAAATCACTGCCCTAGG - Intergenic
1111905239 13:94248056-94248078 CTGGCCTCAAAAAATGTGCTAGG + Intronic
1111997087 13:95175858-95175880 CTGCCCTCACAAAATGCCACAGG - Intronic
1116423889 14:44766272-44766294 CAGCTCTAAAACAAAGCCCTTGG - Intergenic
1117692790 14:58325511-58325533 CTGGGCTCAGACAATGGCCTTGG + Intronic
1117936276 14:60910829-60910851 CTGGCCTCATACAATGCATTAGG + Intronic
1119521827 14:75292136-75292158 ATGCCCTCAAACTAGACCCTTGG - Intergenic
1120606650 14:86586708-86586730 CTGCCCTCATAAAATGCATTGGG - Intergenic
1122018458 14:98817086-98817108 CTGTCCTCCCACAGTGCCCTTGG + Intergenic
1122353653 14:101111361-101111383 CTGCCCACACACAGGGCCCTGGG - Intergenic
1122536737 14:102470097-102470119 CTGGCCTCATAGAATGCACTGGG + Intronic
1124250100 15:28101420-28101442 CTGCCGTCAATCAGTCCCCTTGG + Intergenic
1125721098 15:41845550-41845572 CTGCCCTAAAGCAAAACCCTGGG + Intronic
1126315530 15:47365350-47365372 CTGCCCTACAACAGTGCCCAGGG + Intronic
1126886075 15:53152022-53152044 CTGCCCACTGACAATGCACTTGG + Intergenic
1127390208 15:58499236-58499258 CTGCCTCTAAACAATGCCTTTGG + Intronic
1127859122 15:62978536-62978558 ATGAGCTCAAACAATGCCCCAGG + Intergenic
1129034042 15:72639231-72639253 CTGCCCTGAAACTCTGCACTAGG + Intergenic
1129215840 15:74097985-74098007 CTGCCCTGAAACTCTGCACTAGG - Intergenic
1129408966 15:75338470-75338492 CTGCCCTGAAACTCTGCACTAGG + Intronic
1130050579 15:80480474-80480496 GTGACCTCAAGCACTGCCCTGGG + Intronic
1130915907 15:88304362-88304384 TGGCCCTCAAATAATGCCATGGG + Intergenic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1135031741 16:19044261-19044283 CTGGGCTCAAACAATCCTCTGGG + Intronic
1139014641 16:62675524-62675546 CTGTCCTCAAACAATACTCAAGG + Intergenic
1140475423 16:75237371-75237393 CTGCCCTCAAACCAGCCCTTAGG + Intronic
1141431663 16:83973349-83973371 CTGCCCTCCCACCATGCCCAAGG - Intronic
1142325796 16:89413800-89413822 CTGCACTCCCACAACGCCCTAGG + Intronic
1144922258 17:18773845-18773867 CTGCCCTCAAACTTTGCACTCGG - Intronic
1148931729 17:51132419-51132441 CTACCCTAAAACAAAACCCTAGG + Intergenic
1149563360 17:57625219-57625241 CTGGCCCCCAACCATGCCCTTGG - Intronic
1152635706 17:81429764-81429786 CTACCCTCAACGAAAGCCCTGGG - Intronic
1153916624 18:9751429-9751451 GTGCCTTTAAACAATGACCTTGG + Intronic
1155170982 18:23266793-23266815 CTGCCCTCAAACGTGGCCCTTGG + Intronic
1155741442 18:29293554-29293576 CTGGCCTCAAAGAATGACTTAGG - Intergenic
1155918720 18:31581292-31581314 CTTTCCTCAAACAAGGCCTTTGG - Intergenic
1156073368 18:33240839-33240861 CTGGCCTCATAGAATGACCTAGG - Intronic
1159932294 18:74326108-74326130 CTGACCTCAAACATGGCCCCAGG - Intronic
1160086875 18:75784407-75784429 TTTCTCTCACACAATGCCCTGGG - Intergenic
1160311230 18:77792379-77792401 CAGACCTCAAGAAATGCCCTAGG - Intergenic
1160406588 18:78650901-78650923 CTGCCTTCTGCCAATGCCCTGGG + Intergenic
1160577498 18:79864691-79864713 CAGCCCTGAAACAATGCGGTTGG - Intronic
1160718912 19:589214-589236 CACCCCTCAAACAGTGCCCTGGG - Intergenic
1162932174 19:13962687-13962709 CTGCCCTCCAGCTAAGCCCTTGG - Exonic
1163811927 19:19438485-19438507 CTGCCCTCAAACAATGCCCTGGG - Intronic
1167877412 19:52425869-52425891 ATGCCGTCAAACTACGCCCTTGG - Intergenic
927826198 2:26311710-26311732 CTGCCCTCAAACTATGGACAAGG - Exonic
928750483 2:34465252-34465274 CTGAAATTAAACAATGCCCTTGG - Intergenic
932449399 2:71799907-71799929 CTGCCTTCAAAGGATGCCTTGGG + Intergenic
936080757 2:109430940-109430962 CTGCCCTCATTCAATGACCTTGG - Intronic
937356790 2:121202813-121202835 CTCCCCTCAACCACTTCCCTGGG - Intergenic
940770141 2:157830799-157830821 ATGCCCCCATACAATTCCCTTGG + Intronic
941327700 2:164137769-164137791 CTTTCCTCTAACCATGCCCTGGG + Intergenic
946928935 2:224653935-224653957 CTGGCCTCAAGCAATCCCCCTGG - Intergenic
947119592 2:226800429-226800451 CTGCCCCCAGTCACTGCCCTTGG - Intergenic
948786908 2:240357415-240357437 CTCCCCTCAAGCAATGCATTGGG - Intergenic
949067708 2:242003421-242003443 CTGCACTCACAGAATGTCCTCGG + Intergenic
949067730 2:242003557-242003579 CTGCACTCACAGAATGTCCTCGG + Intergenic
949067786 2:242003859-242003881 CTGCACTCACAGAATGTCCTCGG + Intergenic
949067802 2:242003945-242003967 CTGCACTCACAGAATGTCCTCGG + Intergenic
949067835 2:242004117-242004139 CTGCACTCACAGAATGTCCTCGG + Intergenic
949067851 2:242004203-242004225 CTGCACTCACAGAATGTCCTCGG + Intergenic
949067875 2:242004331-242004353 CTGCACTCACAGAATGTCCTCGG + Intergenic
1172839168 20:37891733-37891755 TTGGCCCTAAACAATGCCCTTGG + Intergenic
1173249861 20:41358665-41358687 CTGCCACCAAACGATGGCCTTGG - Intronic
1175294603 20:57899810-57899832 CTGCCATAAAAGAATGCCATAGG + Intergenic
1175777817 20:61664037-61664059 CAGCCCCCACACAATGCCCTTGG - Intronic
1176908135 21:14529209-14529231 CTGCCCTCGAAGAATGGGCTGGG - Intronic
1180181193 21:46119360-46119382 CAGCCCTCACAGGATGCCCTGGG - Intronic
1180257003 21:46636215-46636237 CTGCCCTCCTAAGATGCCCTCGG - Exonic
1182459688 22:30475036-30475058 CTGCCTTGAAACAAAGGCCTTGG + Intergenic
1182740593 22:32564531-32564553 CTGCACCCAAACAATGCTCCCGG + Intronic
1182740705 22:32565150-32565172 CTGCACCCAAACAGTGCTCTCGG + Intronic
1182740708 22:32565174-32565196 CTGCACCCAAACAGTGCTCTCGG + Intronic
1183758984 22:39798788-39798810 CTGCCATCACACACTGCCCAGGG - Intronic
1185310740 22:50152881-50152903 CTGCCCCCAGACCAAGCCCTTGG - Intronic
953251887 3:41251669-41251691 CTGCCATCACAGAATGGCCTGGG - Intronic
953491484 3:43356024-43356046 CTGGCCTCAAAGAATGAGCTAGG - Intronic
954607846 3:51927882-51927904 TTACCCTAAAACAATCCCCTTGG - Intergenic
955074887 3:55604249-55604271 CTCCCCTCAAACTGTGTCCTAGG + Intronic
960956666 3:123036914-123036936 GTGAGCTCATACAATGCCCTAGG - Intergenic
962255626 3:133868200-133868222 CTGCCCTCAACAACTGCCCGGGG + Intronic
962444336 3:135451337-135451359 CTGCACTGAAAAAATGCCCTAGG + Intergenic
964078233 3:152718965-152718987 CTGCAATCCAACATTGCCCTAGG + Intergenic
965083909 3:164069562-164069584 GTGCCCTCAAAACATGCGCTTGG - Intergenic
968174957 3:196541418-196541440 CTGGCCTCAAACAATCCTCTGGG - Intergenic
968390076 4:184516-184538 CTGGCCTCATAGAATGCCTTAGG + Intergenic
968401100 4:298464-298486 CTCCCCTCAAAGAATCTCCTTGG - Intronic
969010887 4:4061086-4061108 GTGCCCACAAACACTGCCCATGG + Intergenic
970270169 4:14338122-14338144 CTGCCTTCAAGCATTGCTCTGGG + Intergenic
972285711 4:37645960-37645982 CTGCCCTCAGGCCCTGCCCTGGG - Intronic
972355401 4:38275795-38275817 CAGCCCTCACACAAATCCCTGGG - Intergenic
973948940 4:55990729-55990751 CTGGCCTCAAGCAATCCTCTTGG + Intronic
974298645 4:60036527-60036549 CTGCCCTCCAACAGAGCTCTTGG + Intergenic
977222146 4:94350547-94350569 CTGCCCACCAACAAATCCCTTGG + Intergenic
979244509 4:118485198-118485220 CTGCCCTACAATAATGTCCTCGG + Intergenic
984002970 4:174273071-174273093 CTGTCCTCAAGCAATCCTCTTGG - Intronic
985952305 5:3231658-3231680 CTGCCCTCAAGCACTTCTCTAGG + Intergenic
993459896 5:88170520-88170542 CTGCCCTCATAAAATGACTTAGG + Intergenic
994082413 5:95722043-95722065 CTGCCCTCACACAATACATTTGG - Intronic
997406906 5:133656353-133656375 CAGCCCTCAAACAATGAAATGGG - Intergenic
999177205 5:149639947-149639969 CTGCACTGACACAGTGCCCTTGG - Intergenic
999876604 5:155813547-155813569 CTGTCCTCCAACAGTGACCTGGG - Intergenic
1002369914 5:178743264-178743286 CTGCCTTCAAACTATGCTATAGG + Intergenic
1002755417 6:155126-155148 TTGTCCTCAAAGAATGGCCTTGG - Intergenic
1003605665 6:7558342-7558364 CTGCCTTCAAAGGAAGCCCTGGG - Intronic
1003773348 6:9332430-9332452 CTGACTCCAAAAAATGCCCTGGG - Intergenic
1003861856 6:10329750-10329772 CTGTCCTCCAACAAGGCTCTGGG - Intergenic
1005072054 6:21870997-21871019 TTGCCTTAAAACTATGCCCTGGG - Intergenic
1010209670 6:73353329-73353351 ATGCCCTCGAACTAGGCCCTTGG - Exonic
1010303320 6:74286822-74286844 CTGCCTACAAACAATGAACTTGG - Intergenic
1010662922 6:78592066-78592088 CTGCCCTCAAAATATGGCCAGGG - Intergenic
1010689735 6:78895353-78895375 CTGACCTCAAAGAATGAGCTAGG - Intronic
1017756041 6:157530376-157530398 CTCACCTAAAACAATGCCCGTGG - Intronic
1017998998 6:159561688-159561710 CTGACCTCAAACAATGGGTTGGG - Intergenic
1018787733 6:167121437-167121459 GTGCCCTCTAACACTGCCCTTGG - Intergenic
1020141225 7:5612971-5612993 CTACCCTCAGTCACTGCCCTGGG - Intergenic
1020436685 7:8171147-8171169 CTGCCCTCATAAAATGAACTGGG + Intronic
1022973413 7:35537027-35537049 CTGGCCCCAAACAAGGCCCAAGG + Intergenic
1024821065 7:53330472-53330494 CTGGCCTCATACAATGAGCTAGG + Intergenic
1024981856 7:55163897-55163919 CTGCCCACACAGGATGCCCTGGG - Intronic
1027279552 7:76596883-76596905 CTGGCCTCATACAATGCGTTAGG - Intergenic
1031473340 7:122192894-122192916 CTGTGCTAAATCAATGCCCTTGG - Intergenic
1031547168 7:123065011-123065033 CTGCCCTCATAGAATGAGCTGGG + Intergenic
1032755596 7:134887953-134887975 CTACCTTGAAACAATTCCCTAGG - Intronic
1034546575 7:151793584-151793606 CTGCCCTCAGTCACTGCCCGGGG + Intronic
1035073181 7:156159565-156159587 CTGCCATCAAAGAGTGCCCAAGG - Intergenic
1035350045 7:158239133-158239155 CTGGCCTCAGAGAAGGCCCTCGG - Intronic
1035600129 8:892468-892490 CTCCACTCATACAATGCCCCTGG + Intergenic
1036893470 8:12611452-12611474 GTGCCCACAAACACTGCCCATGG + Intergenic
1038186802 8:25282628-25282650 CTGGACTCAAACAATCCCCCAGG - Intronic
1040516149 8:48136650-48136672 CTGCCCTGCGACAATGCCCAGGG - Intergenic
1040782151 8:51122065-51122087 CAACCCTCAGACACTGCCCTGGG + Intergenic
1041407032 8:57510875-57510897 CTGCCCCAAAACAATCCACTTGG - Intergenic
1042225482 8:66511661-66511683 CTGGCTTCAGACAGTGCCCTTGG + Intronic
1042865997 8:73357221-73357243 CAGGCCTGAAAAAATGCCCTTGG - Intergenic
1044493175 8:92844897-92844919 CGGACCTCAAACCATGGCCTAGG + Intergenic
1046331061 8:112715560-112715582 CTGGCCTCAAAAAATGCATTAGG - Intronic
1047863993 8:129001443-129001465 CTGTCCTCAGACAGTGCCTTGGG - Intergenic
1048384198 8:133896261-133896283 ATGTCCTCAGACATTGCCCTAGG - Intergenic
1049495641 8:142930567-142930589 TTGCCTTCAAAAAATGCCCTTGG - Intergenic
1049541335 8:143210532-143210554 CTGCCCTTCAACGGTGCCCTGGG + Intergenic
1050425198 9:5505659-5505681 CTGGCCTCATAGAATGACCTGGG - Intergenic
1050859736 9:10412552-10412574 CTGCCCTCATAAAATGAGCTGGG - Intronic
1051336582 9:16071161-16071183 CAGGTCTCAAACAATGCCATCGG - Intergenic
1051709871 9:19920642-19920664 CAGCTCTCAACCAATGCCCAGGG - Intergenic
1052534139 9:29726459-29726481 CTGCCCTCTAGAAATCCCCTAGG - Intergenic
1052818695 9:33122216-33122238 ATGCCCTCAAAAGATGACCTGGG + Intronic
1055028488 9:71747775-71747797 CTGAGCTCTCACAATGCCCTAGG + Intronic
1055203103 9:73692117-73692139 GTTCACACAAACAATGCCCTGGG - Intergenic
1056136982 9:83640181-83640203 CTCCCCTCAAAAAAGGCCCCAGG + Intronic
1056953981 9:91067775-91067797 CTGCCCTGAAACCCTGGCCTGGG + Intergenic
1057498461 9:95578397-95578419 CTGCCCTCCACCAATGGCCATGG + Intergenic
1058326701 9:103707334-103707356 CCTTCCTCAATCAATGCCCTTGG + Intergenic
1061723387 9:132567585-132567607 CAGCCCTCAAGCCATTCCCTGGG - Intronic
1061797830 9:133098581-133098603 ATGCCCTCAGAAGATGCCCTTGG + Exonic
1061962372 9:133994537-133994559 CCGCCCGCCAACAATGCCATGGG + Intergenic
1188089464 X:25945351-25945373 CTGGCCTCATAAAATGACCTTGG - Intergenic
1188835622 X:34950822-34950844 CTGGCCTCAAACAATGAGTTAGG - Intergenic
1189423995 X:40881955-40881977 CTGCACTCAATCATTGCCCGGGG + Intergenic
1189495577 X:41505488-41505510 CTGGTCTCAAGCAATGCCCCTGG + Intergenic
1196055251 X:111348558-111348580 CTGCCCTTCCACAAGGCCCTGGG + Intronic
1196350940 X:114728111-114728133 CTGTCTTCTAACAATGTCCTAGG + Intronic
1196646536 X:118124002-118124024 CTCCCCTCACACAACACCCTAGG + Intergenic
1197710610 X:129664381-129664403 CTGGCCTCAAGCAATCCCCCTGG + Intergenic
1199272113 X:145896498-145896520 CTGGCCTCAAAGAATGAGCTAGG + Intergenic
1199540807 X:148956066-148956088 CTGCCCACAAACCAGCCCCTAGG + Exonic
1199743439 X:150757013-150757035 ATGCTATTAAACAATGCCCTGGG - Intronic
1201378978 Y:13352047-13352069 GTGCCCTCAAACAATGACGATGG - Intronic