ID: 1163812087

View in Genome Browser
Species Human (GRCh38)
Location 19:19439550-19439572
Sequence TAGCAAAAGGACAAGTGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163812087 Original CRISPR TAGCAAAAGGACAAGTGGTC AGG Intronic
902318410 1:15641597-15641619 TTGCAAAAGGACAATTGTTCTGG - Intronic
905374777 1:37512893-37512915 TAGAAAAAAGAAAAGTGGCCAGG + Intronic
908411225 1:63867739-63867761 AGGATAAAGGACAAGTGGTCAGG - Intronic
910165642 1:84324945-84324967 TAATAAAATGAGAAGTGGTCCGG + Intronic
913086340 1:115440641-115440663 TGGCAAAAAGTCAAGTGGTTTGG + Intergenic
917481572 1:175416453-175416475 TAGCAAAAGGTCAGGTGCTTAGG - Intronic
918189893 1:182163964-182163986 CAGCAGCAGGACAAGAGGTCAGG + Intergenic
919335697 1:196229752-196229774 TGGCAAAAGTATGAGTGGTCTGG + Intronic
920561041 1:206938838-206938860 TATCAGAAGGACAAGTTTTCTGG - Intronic
921362744 1:214344989-214345011 TAGCTAATGGAAAAGTGGTTTGG - Intergenic
1065320536 10:24505004-24505026 TAGCAAAAATACCAGTGCTCAGG + Intronic
1067525481 10:47035940-47035962 GAGCCTAAGGACAAGTGGGCAGG - Intergenic
1069834183 10:71298188-71298210 TGGCAAAAGGGCAGCTGGTCTGG - Intronic
1073252091 10:102126834-102126856 TAGCAAATGGACAAGAGGGGAGG - Intergenic
1074223368 10:111460181-111460203 TAGAAAGAGGACAAGGAGTCTGG - Intergenic
1078749189 11:14143660-14143682 TAGCCAAAGGACAGGAGCTCAGG + Intronic
1079487447 11:20950226-20950248 TAGCATGTGGACAAGTGGGCTGG - Intronic
1079588583 11:22155246-22155268 TACCAACATGACAAGTGTTCTGG + Intergenic
1081704908 11:45177012-45177034 TACCAAAAGGACATGAGGTTAGG - Intronic
1082556880 11:54573823-54573845 AAGAAAAAGCACAAGGGGTCAGG + Intergenic
1083565533 11:63712245-63712267 TAGTAAAAAGGCATGTGGTCTGG + Intronic
1092844074 12:12567827-12567849 TGGCAACAGGGGAAGTGGTCAGG + Intergenic
1093768696 12:22995635-22995657 TAGCAAAAAGACCAGAGCTCGGG + Intergenic
1096031089 12:48415759-48415781 TAGAAAATGGTCAAATGGTCAGG - Intergenic
1097429622 12:59489083-59489105 TAGCAAAAGTAAAAATAGTCAGG - Intergenic
1098779583 12:74669768-74669790 TAGCAAAAGCACAAGTGCAGTGG + Intergenic
1102101838 12:110284794-110284816 TAGCAAAAGAATAAGTGTTTAGG + Intronic
1102551226 12:113693681-113693703 TACCCAAAGGATAAGTGGTTGGG + Intergenic
1104836292 12:131794004-131794026 TAGGAACAGGACAGCTGGTCAGG - Intronic
1107052244 13:36063612-36063634 TAGCAAAAAGGTGAGTGGTCTGG - Intronic
1112167251 13:96932596-96932618 TAGGTAAAGGAAAAGAGGTCAGG + Intergenic
1113156472 13:107328211-107328233 TAGGAAAAGGAAAAGTAGCCAGG - Intronic
1115014729 14:28596596-28596618 TGGCAAAAGGAAAATAGGTCTGG + Intergenic
1115801520 14:36999551-36999573 TAACAAATGTACAAGTGGGCAGG + Intronic
1115805546 14:37046957-37046979 TATGAAAAGGACAAATGTTCCGG - Intronic
1116790765 14:49337519-49337541 AAGCAAAGGAAGAAGTGGTCAGG - Intergenic
1118028776 14:61799370-61799392 TAGCAAAGGGGAAAGTGGGCAGG - Intergenic
1118255372 14:64200901-64200923 TGGAAGAAGGACATGTGGTCTGG - Intronic
1119856273 14:77903581-77903603 TGGAAACAGGACAAGTGGTAGGG + Intronic
1123462242 15:20483743-20483765 AAGAAAAATGACACGTGGTCGGG + Intergenic
1123655817 15:22516628-22516650 AAGAAAAATGACACGTGGTCAGG - Intergenic
1124272929 15:28299754-28299776 AAGAAAAATGACACGTGGTCGGG + Intronic
1124675895 15:31685693-31685715 CAGCAAAAAGACAAATGATCTGG - Intronic
1130236403 15:82138690-82138712 CAGGAAGAGGACAAGTGGCCTGG - Exonic
1130686532 15:86042460-86042482 GAGAAAAAGGACAAGGTGTCTGG - Intergenic
1132149286 15:99447966-99447988 AAGCCAAAGGACAGGTGCTCAGG - Intergenic
1135163846 16:20121525-20121547 AAGCAAAGGGACAAGTCTTCAGG - Intergenic
1138317559 16:56083164-56083186 TAGCATAGGGACATGTGGACTGG - Intergenic
1138452071 16:57099117-57099139 TAGCAGTAGGACACGTGGACGGG - Intronic
1139508568 16:67412735-67412757 TAGCAAAAGGACAAGATGCATGG - Intronic
1143623412 17:8094272-8094294 GAGCAAAGGGAGAAGTGGTTTGG + Intergenic
1144431356 17:15194916-15194938 TAGCTTAAAGACAACTGGTCAGG - Intergenic
1148153188 17:45408553-45408575 TAGAGAAAGGACAAGTGGGGTGG - Intronic
1148207719 17:45790024-45790046 CATCAAAAGGAGAAGTGGTGAGG + Intronic
1150361301 17:64536787-64536809 TGCCACAAGGGCAAGTGGTCAGG - Intronic
1150569865 17:66376305-66376327 TAGTAAAAGAACAGGTGGTCTGG + Intronic
1151993284 17:77592191-77592213 TTGCAAAAGGACAACAGGTCTGG - Intergenic
1153302676 18:3605153-3605175 TAACTAAAGGAAAAGTGGTCAGG - Intronic
1153352908 18:4100968-4100990 TAGAAAAAGTTCGAGTGGTCTGG - Intronic
1154000323 18:10477134-10477156 TAGCAGAAAGAAAAGTGGTATGG - Intronic
1156776722 18:40798490-40798512 TATCCAAAGGAAAAGAGGTCAGG - Intergenic
1158498825 18:57982154-57982176 CGGCAAATAGACAAGTGGTCAGG + Intergenic
1163087104 19:14989574-14989596 AAGAAAAAAGATAAGTGGTCAGG + Intronic
1163812087 19:19439550-19439572 TAGCAAAAGGACAAGTGGTCAGG + Intronic
1166345598 19:42163382-42163404 TATCAATAGGTTAAGTGGTCAGG - Intronic
1166661660 19:44651161-44651183 TAGAAAATGGACAAGGGGCCAGG - Intronic
928609407 2:32977107-32977129 TAGAAGAAGGACCAGTGGACTGG + Intronic
928981320 2:37138552-37138574 TAGCAAAAGAACCAGAGGACAGG + Exonic
929595528 2:43173311-43173333 TAAAAAAAGGACAAATGGGCTGG - Intergenic
931877204 2:66526931-66526953 TACCAAAATGACAGGTGCTCAGG + Intronic
932106692 2:68949713-68949735 CAGAAAAAGAACAATTGGTCAGG - Intronic
934810766 2:97275108-97275130 TTTCAAAAGGACAAGGGGGCAGG + Intergenic
934826926 2:97432831-97432853 TTTCAAAAGGACAAGGGGGCAGG - Intergenic
936538881 2:113334080-113334102 TAGGAGAAGGACAAGGGGTCAGG + Intergenic
936589289 2:113787843-113787865 TAGAAAAGTGACAAATGGTCGGG - Intergenic
937179008 2:119972616-119972638 TAGGAAGAAGACAAGTGTTCTGG - Intronic
942007845 2:171724796-171724818 TAGCAAAAGAAAAGGTGGGCAGG + Intronic
943774624 2:191751403-191751425 TAGCAAAAGCCCAAGTTGTTTGG - Intergenic
944474541 2:200090192-200090214 TAGTTGAAGGACAAGTGCTCTGG + Intergenic
946334947 2:219030219-219030241 AAGCAGAAGGACAAAGGGTCAGG + Intronic
946416419 2:219542214-219542236 TATCAAAAGGACAACGGGGCGGG + Intronic
946522544 2:220482311-220482333 TAGCAAAAGCAACAGTGGCCAGG - Intergenic
948220579 2:236266163-236266185 TGGCATAAAGACAAGAGGTCTGG - Intergenic
948923371 2:241078087-241078109 TAACGAAAGGAAAAGTGGCCGGG + Intronic
949027217 2:241771909-241771931 AAGCAGAAGGGCAAGTGGTTGGG + Intergenic
1169978319 20:11355467-11355489 TAGCACCAGGTCAAGTGGACTGG + Intergenic
1170875490 20:20246303-20246325 TTGGAAAAGGAGAAGTGGTGGGG + Intronic
1170970254 20:21109046-21109068 TTGCAAAAGAACACGTGGGCTGG - Intergenic
1172305278 20:33876180-33876202 TAGCCCAAGGGCAAGTGGGCAGG - Intergenic
1174907295 20:54564911-54564933 TAGCAAAGTGACAAGTGGCATGG - Intronic
1176112554 20:63417202-63417224 CAACAAAAGCACAGGTGGTCGGG + Intronic
1177674489 21:24278929-24278951 GAGCAAAAGGAGAAGTATTCTGG + Intergenic
1177886627 21:26754941-26754963 CAGCAAAGAGACAAGTGGTCTGG + Intergenic
1180824736 22:18854642-18854664 AAGCAGAAGGACAGGTGGCCTGG - Intronic
1181125154 22:20697793-20697815 AAGCAGAAGGACAGGTGGCCTGG - Intergenic
1181187994 22:21119905-21119927 AAGCAGAAGGACAGGTGGCCTGG + Intergenic
1181211204 22:21290588-21290610 AAGCAGAAGGACAGGTGGCCTGG - Intergenic
1181398300 22:22636300-22636322 AAGCAGAAGGACAGGTGGCCTGG + Intergenic
1181602185 22:23959215-23959237 CAGGAAAAGGACAAGAGGTCAGG - Intronic
1181606324 22:23982092-23982114 CAGGAAAAGGACAAGAGGTCAGG + Intronic
1181651114 22:24259760-24259782 AAGCAGAAGGACAGGTGGCCTGG - Intergenic
1181706266 22:24650979-24651001 AAGCAGAAGGACAGGTGGCCTGG + Intergenic
1182738355 22:32547278-32547300 AAGCAAAAGGAAGAGTGGCCGGG - Intronic
1182961004 22:34475194-34475216 TAGCAAAATGAGAAATGGTGTGG + Intergenic
1203215745 22_KI270731v1_random:4843-4865 AAGCAGAAGGACAGGTGGCCTGG + Intergenic
1203274882 22_KI270734v1_random:80548-80570 AAGCAGAAGGACAGGTGGCCTGG - Intergenic
949500872 3:4678982-4679004 TAACATAAGAACAAGTGGTTAGG + Intronic
950007627 3:9701694-9701716 AAGCACAAGGACAGGTGGTATGG + Intronic
952869482 3:37885701-37885723 TAGCAAAGGGACAAGGGGTCTGG + Intronic
962379334 3:134884671-134884693 TAACCAAAGGAAATGTGGTCTGG - Intronic
962427754 3:135287379-135287401 TAGGAAAAAGACAAGTAATCTGG - Intergenic
962723231 3:138195836-138195858 CAACAAAATGACAAGTGGTGGGG - Intronic
963049198 3:141127293-141127315 TGTCAAAAGAACAAGGGGTCTGG - Intronic
964265618 3:154891809-154891831 GAGCAACAGGACAAGGGCTCTGG + Intergenic
965226433 3:165998409-165998431 TAACAAAAGAACAAGGGGCCGGG + Intergenic
965362905 3:167763259-167763281 TTGCAAAGGAATAAGTGGTCTGG + Intronic
966099384 3:176248196-176248218 TAGCAAAAGGACAATTTGGTAGG - Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
969677476 4:8622008-8622030 TAGCAAAATGACAAGGGGCCGGG - Intergenic
969678431 4:8627649-8627671 TAGCAAAATGACAAGGGGCCGGG - Intergenic
969679387 4:8633283-8633305 TAGCAAAATGACAAGGGGCCGGG - Intergenic
969956833 4:10899141-10899163 TAGCATAAAGAGAAATGGTCAGG + Intergenic
969993606 4:11289746-11289768 TAGCAACAGTACAAATGCTCAGG - Intergenic
971394164 4:26213418-26213440 TAGGAAAATGAGAAGGGGTCAGG + Intronic
974468041 4:62282871-62282893 TATCAGAAGGACAAGTGTTGAGG + Intergenic
975596810 4:76055068-76055090 TAGAAAAATGACAAGAGGCCAGG - Intronic
976286100 4:83372660-83372682 TAGCAGAAGAAAAAGTGGCCAGG - Intergenic
978717325 4:111861265-111861287 AAGCAACAGAACTAGTGGTCAGG + Intergenic
979382889 4:120029429-120029451 TAGCAAAAGAACTAGTTGCCAGG + Intergenic
987238258 5:15965609-15965631 TAGTAAAAGTAAAAGTGGGCCGG + Intergenic
991315889 5:65305910-65305932 GAGTAAAAGAACAAGTGATCAGG - Intronic
994263835 5:97691156-97691178 TAGCAAGAGTACCAGTTGTCAGG + Intergenic
995485224 5:112633507-112633529 TAGACAAAGGACAAGAGCTCAGG + Intergenic
999017604 5:148125396-148125418 TGACAAAAGGACAATTGCTCAGG - Intronic
999546535 5:152635088-152635110 TAGCAAAAAGTCAAGGAGTCAGG + Intergenic
1001040237 5:168329426-168329448 TACCAAAAGGAAGTGTGGTCTGG - Intronic
1004521612 6:16366238-16366260 CTCCAAGAGGACAAGTGGTCAGG - Intronic
1004892183 6:20111649-20111671 AAACTAAAGAACAAGTGGTCAGG - Intronic
1005507124 6:26479122-26479144 TAACAGAAAGACAAGGGGTCGGG + Intergenic
1005747815 6:28855304-28855326 TAGAAAAAGGACAATTGGCTGGG - Intergenic
1006575030 6:35038779-35038801 CAGAAAAAGGAAAAGTGGCCAGG - Intronic
1009865251 6:69389980-69390002 TAGCAAAAGGAAAAGGGGAGTGG + Intergenic
1010749639 6:79603791-79603813 AAGAAAAAAGAAAAGTGGTCTGG - Intergenic
1013971911 6:116030297-116030319 TGGCAAAACCACGAGTGGTCAGG - Intronic
1015112337 6:129607478-129607500 AAGCACAAGGAGAAGTGGTAGGG - Intronic
1016559059 6:145374022-145374044 TAGCACAAACACAAGAGGTCAGG + Intergenic
1016986710 6:149900814-149900836 CAGCAAAAGGAGAAGCAGTCTGG - Intergenic
1018174356 6:161166176-161166198 GAGCAAAAAGACAAGTGGTGGGG + Intronic
1019377472 7:700889-700911 CACCAAAAGGACAGGTGGGCAGG + Intronic
1025032377 7:55568373-55568395 TAGAAAAAGGAACAGTTGTCAGG - Intronic
1025302164 7:57826604-57826626 TATCAAAAGGAGATGTGCTCGGG + Intergenic
1026719309 7:72817105-72817127 TAGAAAAAGGACAGGTTGGCCGG + Intronic
1032767833 7:135016575-135016597 TAGCTAAAGGAGAAGTGGCAGGG + Intronic
1033666302 7:143443846-143443868 TGGCTAAAGCACAAGTTGTCTGG + Exonic
1035140432 7:156753846-156753868 TAGCCAAACGACAGGTGCTCTGG + Intronic
1036632607 8:10525858-10525880 GAGAGAAAGGACAAGTGGTTTGG - Intronic
1041055006 8:53975780-53975802 TTGCAAGAGGAAAAGTGTTCCGG + Intronic
1043582063 8:81725582-81725604 TGGCAAAAGGAGAAATGGTAAGG - Intronic
1044245457 8:89939371-89939393 TAGCAAAAAGAGAAGTGATTTGG + Intronic
1046257297 8:111718307-111718329 TAGCAAAAGTAGAAGTGATGAGG + Intergenic
1046787080 8:118279205-118279227 TAGCAAAGGGAAAAATTGTCAGG - Intronic
1048953675 8:139516580-139516602 TTTCAAAAGAACATGTGGTCAGG + Intergenic
1050109615 9:2200975-2200997 TAGCAAAAAGACTAGTGGCTTGG - Intergenic
1050629296 9:7541879-7541901 TAGCTAAGGGACAAATGGGCAGG - Intergenic
1051422815 9:16905486-16905508 TAAGAAAAGGGCAAGAGGTCGGG - Intergenic
1051444286 9:17124096-17124118 CAGCAAGAGGAGAAGAGGTCTGG + Intergenic
1051707671 9:19897926-19897948 CAGCAAAAGGAAAAGTGGGATGG - Intergenic
1051745532 9:20291613-20291635 GAGCAAATGCACAAGTGGTGGGG - Intergenic
1052254438 9:26437603-26437625 AAGCAATAGGACAAGAGGGCTGG + Intergenic
1055927669 9:81527317-81527339 TATCTAAAGGAAAAGTGGCCGGG + Intergenic
1056116903 9:83449379-83449401 TAGAAGAAGGACATCTGGTCTGG + Intronic
1057537202 9:95923268-95923290 TATCAAAAGGATATGTGATCAGG + Exonic
1057682729 9:97205347-97205369 AAGCACAAGCACAAGGGGTCAGG + Intergenic
1059798922 9:117730040-117730062 TAGCCAGAGGACAAGGGGACAGG + Intergenic
1060347533 9:122829648-122829670 TAGAAAAAGGACATGGGGCCGGG + Intergenic
1062444134 9:136586297-136586319 TAGGAAAAGGACAGGGGGTGGGG + Intergenic
1196327882 X:114429454-114429476 TATCAAAAGGACAAGAGGCCGGG - Intergenic
1199419949 X:147633721-147633743 TAGAAATAGGTCATGTGGTCTGG + Intergenic
1201860551 Y:18593016-18593038 TAGCAAAAGGGCACTTGGTAGGG + Intergenic
1201872772 Y:18727365-18727387 TAGCAAAAGGGCACTTGGTAGGG - Intergenic