ID: 1163813129

View in Genome Browser
Species Human (GRCh38)
Location 19:19447163-19447185
Sequence CCCTCCACACATGCCCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163813129_1163813134 16 Left 1163813129 19:19447163-19447185 CCCTGGGGGGCATGTGTGGAGGG No data
Right 1163813134 19:19447202-19447224 TGCATTATCAGCTGAGACCTGGG No data
1163813129_1163813133 15 Left 1163813129 19:19447163-19447185 CCCTGGGGGGCATGTGTGGAGGG No data
Right 1163813133 19:19447201-19447223 TTGCATTATCAGCTGAGACCTGG No data
1163813129_1163813135 17 Left 1163813129 19:19447163-19447185 CCCTGGGGGGCATGTGTGGAGGG No data
Right 1163813135 19:19447203-19447225 GCATTATCAGCTGAGACCTGGGG No data
1163813129_1163813136 18 Left 1163813129 19:19447163-19447185 CCCTGGGGGGCATGTGTGGAGGG No data
Right 1163813136 19:19447204-19447226 CATTATCAGCTGAGACCTGGGGG No data
1163813129_1163813137 23 Left 1163813129 19:19447163-19447185 CCCTGGGGGGCATGTGTGGAGGG No data
Right 1163813137 19:19447209-19447231 TCAGCTGAGACCTGGGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163813129 Original CRISPR CCCTCCACACATGCCCCCCA GGG (reversed) Intronic