ID: 1163813129

View in Genome Browser
Species Human (GRCh38)
Location 19:19447163-19447185
Sequence CCCTCCACACATGCCCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 288}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163813129_1163813135 17 Left 1163813129 19:19447163-19447185 CCCTGGGGGGCATGTGTGGAGGG 0: 1
1: 0
2: 1
3: 26
4: 288
Right 1163813135 19:19447203-19447225 GCATTATCAGCTGAGACCTGGGG 0: 1
1: 0
2: 0
3: 12
4: 165
1163813129_1163813133 15 Left 1163813129 19:19447163-19447185 CCCTGGGGGGCATGTGTGGAGGG 0: 1
1: 0
2: 1
3: 26
4: 288
Right 1163813133 19:19447201-19447223 TTGCATTATCAGCTGAGACCTGG 0: 1
1: 0
2: 0
3: 27
4: 862
1163813129_1163813134 16 Left 1163813129 19:19447163-19447185 CCCTGGGGGGCATGTGTGGAGGG 0: 1
1: 0
2: 1
3: 26
4: 288
Right 1163813134 19:19447202-19447224 TGCATTATCAGCTGAGACCTGGG 0: 1
1: 0
2: 1
3: 8
4: 145
1163813129_1163813136 18 Left 1163813129 19:19447163-19447185 CCCTGGGGGGCATGTGTGGAGGG 0: 1
1: 0
2: 1
3: 26
4: 288
Right 1163813136 19:19447204-19447226 CATTATCAGCTGAGACCTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 173
1163813129_1163813137 23 Left 1163813129 19:19447163-19447185 CCCTGGGGGGCATGTGTGGAGGG 0: 1
1: 0
2: 1
3: 26
4: 288
Right 1163813137 19:19447209-19447231 TCAGCTGAGACCTGGGGGAGTGG 0: 1
1: 0
2: 4
3: 78
4: 499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163813129 Original CRISPR CCCTCCACACATGCCCCCCA GGG (reversed) Intronic
900331110 1:2135074-2135096 CCCTCCTCACATGATCCTCATGG - Intronic
901402878 1:9026300-9026322 CCCTCCACCCATTCCATCCAGGG - Exonic
901654578 1:10762099-10762121 CCCTCCCCTCCTGCCTCCCAAGG + Intronic
901866988 1:12112801-12112823 CCCTGCCCACATGCCCCTCGGGG - Intronic
903331102 1:22597644-22597666 CCCTCCACACCTGCCCCTCTCGG + Intronic
903535409 1:24063315-24063337 CCCACAGCACCTGCCCCCCAGGG - Intronic
905174081 1:36125368-36125390 CCCTCCACACACGCGCTCCCGGG + Intergenic
905284391 1:36869849-36869871 CCCTCCCCACATCCCCACCCAGG + Intronic
905858240 1:41329306-41329328 CCATCAGCACATGCCCACCATGG - Intergenic
905858270 1:41329501-41329523 CCATCAGCACATGCCCACCATGG - Intergenic
906030676 1:42717697-42717719 CTCTCCACAAATGCCCCTAAAGG - Intergenic
906580322 1:46930433-46930455 CCCTGCACACATACAGCCCATGG + Intronic
907410879 1:54282510-54282532 GCCTCAACAAATGCCTCCCAGGG + Intronic
907424213 1:54368947-54368969 ACCTCCCCTCATGCCCCCAAGGG - Intronic
907441408 1:54480723-54480745 CCCTCCCCACATGCTGCCTATGG - Intergenic
908774338 1:67625805-67625827 CCCTCCCCTCAAGCCCACCATGG + Intergenic
909148503 1:71969606-71969628 CTTTCCACACCTGCCCCCAATGG - Intronic
911973987 1:104468102-104468124 CCCTCCAGAGATGCTCCACAGGG + Intergenic
912152511 1:106878028-106878050 CTCTCCACACAGTCACCCCAGGG + Intergenic
915168852 1:153963762-153963784 TCCTCCACAGATGCGCCCCAGGG - Intronic
915325934 1:155081088-155081110 CCCTCCCCACGTGACCCCAAGGG - Intronic
915728616 1:158036931-158036953 CACTCCAGACCTGCCCGCCAAGG - Intronic
917901642 1:179548688-179548710 CCATCCAGACATGGTCCCCAAGG + Intronic
919749617 1:201028971-201028993 CCCTCCTCCCCTGCCCCACAGGG - Intergenic
920350802 1:205336749-205336771 CCCATCACACATGCCCATCAAGG + Exonic
924652235 1:245940066-245940088 CCCTCCTCACCTTCCCCTCAGGG + Intronic
1063118509 10:3087740-3087762 CCCTCCCCACCTGCCCCAGAAGG + Intronic
1065002256 10:21347753-21347775 CCTTCCACACATGACTTCCAAGG + Intergenic
1066006511 10:31150825-31150847 ACCTCCACACAGGCCTGCCAGGG - Intergenic
1066295124 10:34047458-34047480 CCCTTCACACAAACCCCCAAGGG + Intergenic
1067382195 10:45785037-45785059 TCCTCCACACACGCTCCCCTCGG - Intronic
1067430633 10:46241186-46241208 CACTCCACACATGCTGCCAAGGG + Intergenic
1073192651 10:101662784-101662806 ACTTCACCACATGCCCCCCATGG + Intronic
1073424084 10:103445849-103445871 CCCTCTACTCTTGCTCCCCAGGG - Exonic
1074681629 10:115913306-115913328 CCATCCACACCAGCCCCCAAAGG + Intronic
1075781121 10:125017862-125017884 CCCACCCTACCTGCCCCCCACGG - Intronic
1076364353 10:129912185-129912207 CCCTCCACTCCTGGCCTCCAAGG + Intronic
1076441916 10:130485979-130486001 CTCTCCACACGTCCTCCCCATGG + Intergenic
1076685814 10:132198084-132198106 ACCCCCACACATGCCCCCGCTGG + Intronic
1076854394 10:133108847-133108869 CCCTCCCCTCATGTCCTCCATGG + Intronic
1076854411 10:133108898-133108920 CCCTCCCCTCATGTCCTCCATGG + Intronic
1076854456 10:133109050-133109072 CCCTCCCCTCATGTCCTCCATGG + Intronic
1077122320 11:915313-915335 GCCACCACACATGCCCACCTCGG - Intergenic
1077214955 11:1391339-1391361 CCCTCCACCCCTGCCCGCCCGGG - Intronic
1077329327 11:1977068-1977090 CCCTCTACAGATGCCCCTCCTGG + Intronic
1077574955 11:3375933-3375955 CCCTGCACAGATGCCCTCTATGG + Intronic
1077946038 11:6899737-6899759 CCCTCCACTCATGCCCAACACGG - Intergenic
1079136745 11:17779751-17779773 CCCTCCATCCTTGCCCCCCTCGG - Intronic
1080056719 11:27914394-27914416 CCCTCCACCCATGCACCCATGGG - Intergenic
1080230419 11:30013707-30013729 CTCTCCACTCATGGCCCACATGG + Intronic
1080695116 11:34596872-34596894 CCCTCCAGACAAGCCCATCAGGG - Intergenic
1081704103 11:45170673-45170695 CCCTCCACTCAAAACCCCCATGG - Intronic
1083215217 11:61214486-61214508 CCCTCCACCCTGGCCTCCCACGG + Intergenic
1083218101 11:61233315-61233337 CCCTCCACCCTGGCCTCCCACGG + Intergenic
1084332483 11:68438180-68438202 CCCTCAACACATCCCTGCCAAGG - Intronic
1085044305 11:73344276-73344298 CCCTCTACACGTGCCCACCACGG - Intronic
1085642395 11:78200652-78200674 CCTCCCTCACATCCCCCCCATGG + Exonic
1087992244 11:104758814-104758836 CACACCACACATGCTGCCCAGGG + Intergenic
1202812306 11_KI270721v1_random:32247-32269 CCCTCTACAGATGCCCCTCCTGG + Intergenic
1091693979 12:2615942-2615964 CCCTCCACACAGGCTCCACCTGG + Intronic
1091760211 12:3082328-3082350 CCCTGCACACATGCCACACCTGG - Intronic
1092161222 12:6316451-6316473 CCCTACACACAGGACCCCCGAGG - Intronic
1092774268 12:11928863-11928885 CTCTCCACACACCCACCCCATGG + Intergenic
1095939683 12:47717936-47717958 CCCTCCTCCCATGGCCCCCCAGG + Intronic
1096469184 12:51865534-51865556 GCCTCCCCCCATGCCCCACAGGG - Intergenic
1102278020 12:111598312-111598334 CCCTCCAGAGATGTCCCCCATGG + Intronic
1102551691 12:113696156-113696178 CCCTCCACCCATGGCCCCACGGG + Intergenic
1103040298 12:117689591-117689613 TCATCCACCCATGCCCCCCGGGG - Intronic
1103165364 12:118765670-118765692 GTCCCCACACATTCCCCCCAAGG - Intergenic
1103796530 12:123506838-123506860 GGCTGCACTCATGCCCCCCATGG - Intronic
1104860946 12:131923242-131923264 CCCTCCACAGGTGCCCACAATGG + Intergenic
1108178926 13:47821976-47821998 ACCTCCCCACATGCACCCCGGGG + Intergenic
1108179000 13:47822458-47822480 ACCTCCCCACATGGACCCCAGGG - Intergenic
1108684295 13:52805343-52805365 CCCTCCCCAGTTGCTCCCCATGG + Intergenic
1112325299 13:98439647-98439669 CCCTCTACACCTGCCTGCCAAGG - Intronic
1113106297 13:106775150-106775172 TCCTCCACAGATGAACCCCAAGG + Intergenic
1114246787 14:20921758-20921780 CCCTCCACAGTTGTCCCCAAAGG + Intergenic
1114625035 14:24123376-24123398 TCCTCCAAACATTCCCCACAAGG - Exonic
1118571614 14:67200187-67200209 TCCTCCACTGATGCCCCCCATGG + Intronic
1119938002 14:78610753-78610775 CTCCCCACACCTGCCCCCCATGG - Intronic
1121274120 14:92656351-92656373 CCCTCCACACACACCCTTCAGGG - Intronic
1122092457 14:99349364-99349386 CCCTCCTCCTCTGCCCCCCACGG + Intergenic
1122203709 14:100137817-100137839 TCCTGCTCACATGTCCCCCAGGG + Intronic
1123411674 15:20066037-20066059 CCCTCCCCATATGCCCTCCTTGG - Intergenic
1123521020 15:21073156-21073178 CCCTCCCCATATGCCCTCCTTGG - Intergenic
1124012457 15:25849739-25849761 GCCCCCAGACATGCTCCCCATGG + Intronic
1126499856 15:49333707-49333729 CCCTTCAGACAAGCCCCCTAGGG - Intronic
1127389409 15:58493100-58493122 CCATCCACCCTGGCCCCCCATGG + Intronic
1127632169 15:60837575-60837597 CACTCCAAACAGGCTCCCCATGG - Intronic
1129070541 15:72946656-72946678 CCACCCACACATGCCACCTAGGG + Intergenic
1131193562 15:90336875-90336897 CCCTTCACTCATGCCTCCCTGGG - Intergenic
1131366788 15:91848163-91848185 CCTTCCAGGCATTCCCCCCAGGG - Intergenic
1132062605 15:98704752-98704774 CCCTACACACTTCCCTCCCAAGG - Intronic
1132222629 15:100116544-100116566 CCCTCCACACATGGCGCCAGGGG + Intronic
1132686894 16:1165923-1165945 CCCACCACTCTTGCCCCACACGG - Intronic
1133104064 16:3495418-3495440 CCCACCACACTGGCCCTCCATGG - Exonic
1133225389 16:4338205-4338227 CACTCCACCCCTGCACCCCAGGG + Exonic
1133394099 16:5432124-5432146 CCCTCCACAGAGACCACCCATGG - Intergenic
1134184011 16:12069047-12069069 CTCTGCACAGATGCCCCCCTCGG + Exonic
1135108750 16:19673759-19673781 TCCTCCACCCAAGCCCCCCAAGG + Intronic
1136344627 16:29666765-29666787 CTCTCCACCCAGGCCCCACAGGG - Exonic
1137314106 16:47298973-47298995 CCCTGCACTCAGGCCCCCCATGG + Intronic
1138460288 16:57143842-57143864 CCCTCCACACGTGGCCCTCCTGG - Intronic
1139949421 16:70661886-70661908 TCCGCCACACATTCTCCCCAGGG - Exonic
1140202454 16:72905572-72905594 CACTCCGCAGATGCCTCCCAGGG + Intronic
1140923876 16:79564735-79564757 CACCCCACACATGCTCCACAGGG - Intergenic
1141137366 16:81474853-81474875 CCCTCCCCGCCCGCCCCCCATGG - Intronic
1142005548 16:87688002-87688024 CCCTCCACACAGGACCCTCACGG + Intronic
1142025599 16:87811399-87811421 TCCTGCACACATGCCCGCCTGGG - Intergenic
1142025686 16:87812252-87812274 CCCTCCACACAGGCCCGGCTGGG + Intergenic
1142047809 16:87936863-87936885 CCCTCCTCACATGCACACCATGG - Intergenic
1142217308 16:88836073-88836095 CCCTGAACCCATGCCTCCCACGG + Intronic
1142259930 16:89037923-89037945 CCCTCCACCCAGGCCCCACCAGG - Intergenic
1143686963 17:8525043-8525065 CCTTTCACACATGCCCCTAAAGG + Intronic
1144728982 17:17515935-17515957 CCCTCCCCACCTCCACCCCAGGG - Intronic
1146637125 17:34514737-34514759 CCCTCCACACACACCCTCCCTGG + Intergenic
1147139436 17:38453098-38453120 CACTCCACACATACCCCACAGGG - Intronic
1147214711 17:38892475-38892497 CCCTCCACCTCTGGCCCCCATGG - Intronic
1147266237 17:39236617-39236639 CCCTCCATACATTATCCCCAAGG - Intergenic
1147782268 17:42952037-42952059 CCCTCCACACTGGCCCACGAGGG + Intronic
1148554772 17:48571796-48571818 CCCTCTACTTATGCCACCCAGGG + Intronic
1148756039 17:49973421-49973443 CTTTCAACACATTCCCCCCAAGG - Intronic
1148968998 17:51462921-51462943 CAATTCACACATGCCCTCCAGGG + Intergenic
1149575977 17:57713866-57713888 CCCTCCACACAATCCCGGCATGG - Intergenic
1151192134 17:72406342-72406364 CACTGCACACATCCCCACCAAGG - Intergenic
1151204194 17:72493406-72493428 CCCTCCACACCTGGCCCTCTTGG - Intergenic
1152197301 17:78925215-78925237 CCCTCCTCACCTGCCCCGCTCGG + Exonic
1152269667 17:79316610-79316632 CCCTCCCCACAAGGCCACCACGG + Intronic
1152271420 17:79327133-79327155 CCCCCCACACCTTCCCCACAAGG + Intronic
1152658214 17:81529730-81529752 TCCTGCCCACATGCCCCTCATGG - Intronic
1152790161 17:82274359-82274381 CCCTTCAGACAAGCCCCCCCAGG + Intergenic
1152804465 17:82348545-82348567 CCCTCCAAGACTGCCCCCCAGGG + Intergenic
1152861558 17:82699113-82699135 GCCTCCCCACCTGCCCACCAGGG + Intergenic
1157270467 18:46271983-46272005 CCTTCCAAACCTGCCACCCAAGG + Intergenic
1157722107 18:49933087-49933109 ACCTCCACAATTGCCCGCCATGG + Intronic
1158391048 18:57045151-57045173 CCCTCCACCCATGACCCCACAGG - Intergenic
1158396823 18:57085619-57085641 CCCTCCTCGCCAGCCCCCCAAGG - Intergenic
1160767889 19:816520-816542 TCCTCCACCCATGCCCCCAGTGG + Intronic
1160922398 19:1527033-1527055 CCCGCCACACCTGCCCCCCCCGG - Intronic
1161111171 19:2471066-2471088 TCCTCCCCACTTGGCCCCCAAGG + Intergenic
1162130429 19:8522759-8522781 CCCTCCAGACATGATCTCCAGGG + Exonic
1162909716 19:13842449-13842471 CCCTCCACCCCGACCCCCCAGGG - Intergenic
1163813129 19:19447163-19447185 CCCTCCACACATGCCCCCCAGGG - Intronic
1166230078 19:41421522-41421544 CACTCCACACCTGCCCCTCTGGG - Intronic
1166813519 19:45528031-45528053 CCCTCCAAATCTGCCCCTCACGG - Exonic
1166829466 19:45630098-45630120 TCCTCCCCCCATGCCCACCAAGG + Intronic
1167349013 19:48963476-48963498 CCCTCCACCTATGGGCCCCAAGG + Intergenic
1167667677 19:50832184-50832206 CCCTCCAGCCATGACCCCAAAGG + Intronic
1168435076 19:56310229-56310251 CCCTCCACACAGGCAGTCCAGGG - Intronic
925225452 2:2180210-2180232 CCCTCCTTCCAAGCCCCCCAAGG + Intronic
925901536 2:8512656-8512678 CCCTCCATGCATGCACACCAAGG - Intergenic
926118890 2:10230347-10230369 GCCTCCACACCTGGCCTCCAGGG + Intergenic
926221990 2:10942384-10942406 CCCTGAACACATGGCCCCCTGGG - Intergenic
926397363 2:12457383-12457405 CCCTCCATACCTGCCTCCCCAGG - Intergenic
929557690 2:42935898-42935920 CCCTCCTCTCATGCCCCACCTGG + Intergenic
929580907 2:43081321-43081343 CCCTCCCCAAATGTCCCTCATGG - Intergenic
929977710 2:46651518-46651540 CCCTTCACACATGACCCACTGGG - Intergenic
931757635 2:65388371-65388393 CCCTGCCCACATGCCGCCTAGGG - Intronic
932272003 2:70419109-70419131 CTCTTCACACAGGCCCCCTAAGG - Intergenic
936020462 2:108990473-108990495 GCCTCCACACATGCCACCACCGG - Intergenic
936152507 2:110029584-110029606 CCCTCTACACATCCCCCTCGAGG - Intergenic
936192173 2:110341828-110341850 CCCTCTACACATCCCCCTCGAGG + Intergenic
937289865 2:120775804-120775826 CCAGCCTCACATTCCCCCCAGGG - Intronic
942865890 2:180674414-180674436 CCCTCCTCTGATGCCCTCCAAGG - Intergenic
943872053 2:193012085-193012107 ACCTGCACACAAGCCCCCAATGG - Intergenic
946146184 2:217732905-217732927 CCCACCACACAGGCCAGCCATGG + Intronic
946193814 2:218021737-218021759 CCCAGCAGACATGTCCCCCAAGG + Intergenic
946433154 2:219636128-219636150 CCCTCCCCACTAGCCCCCAATGG - Intronic
946475893 2:220005991-220006013 CCCTCCTCACTTGCTCTCCAAGG - Intergenic
946640458 2:221778206-221778228 CTCTTCACACAGGGCCCCCAGGG + Intergenic
947637580 2:231687858-231687880 CCCTCCCCACCTCCCGCCCAGGG - Intergenic
948489388 2:238302816-238302838 CCCTCCACACACTGCCCCAACGG - Intergenic
948776132 2:240289951-240289973 CCCTCCTCACATGGCCCGCCAGG - Intergenic
948793607 2:240391438-240391460 CCCTGGACACAGACCCCCCAGGG + Intergenic
948796121 2:240402803-240402825 CCATCCTCACCTGGCCCCCAGGG + Intergenic
949074158 2:242044634-242044656 ACCTCCACACAGACCCCACAGGG + Intergenic
1169132562 20:3173630-3173652 CCCTCCGGCCACGCCCCCCAGGG + Intergenic
1169191167 20:3660072-3660094 GCCTCCACCCAGGCCCACCAGGG + Intronic
1170141386 20:13128481-13128503 ATCTCAACACATGGCCCCCATGG + Intronic
1170471993 20:16676972-16676994 CTCTCAACACATGTCCCCAAGGG + Intergenic
1170642050 20:18162971-18162993 ACCTCCACTCCTGCCCCCAAGGG - Intronic
1171060711 20:21956755-21956777 CCATCCACACATGCCACCTGTGG - Intergenic
1172731688 20:37094343-37094365 CTCTCCAGTCATGCCACCCACGG + Intronic
1173655958 20:44700520-44700542 CGCTGCACACCTGCCGCCCAGGG + Intergenic
1174521983 20:51138780-51138802 TTCTCCTCACATGTCCCCCAAGG + Intergenic
1175473228 20:59249042-59249064 CCTTCCACATTGGCCCCCCATGG + Intronic
1175741132 20:61420431-61420453 CCCTCCCCACAGGGTCCCCAGGG + Intronic
1175843873 20:62048728-62048750 CTCTCCCCACATGCCCACCTTGG + Intronic
1175843908 20:62048847-62048869 CTCTCCCCACATGCCCACCTCGG + Intronic
1175843958 20:62048994-62049016 CTCTCCCCACATGCCCACCTCGG + Intronic
1175904137 20:62371537-62371559 CTCTCCACAGATGCTCCCCGAGG + Intergenic
1178035589 21:28578738-28578760 CCCTCCTCACTTTCCTCCCATGG - Intergenic
1180009813 21:45041724-45041746 CCCTCCGCACAGGCACCGCAGGG - Intergenic
1180070079 21:45431575-45431597 GCCTCCACCCCTGACCCCCAGGG - Intronic
1180071700 21:45440044-45440066 CCCTCCGCCCATGCGGCCCACGG - Intronic
1180212296 21:46302130-46302152 CCCGCCACATGTGCCCCCGAGGG - Exonic
1181388643 22:22563044-22563066 CTCTCCACACATGCGCACAAAGG - Intronic
1181645874 22:24231687-24231709 CCCTCCACGCCTGGCCCCAAGGG - Intronic
1181892557 22:26076590-26076612 CCCTCCCCACATCTCCCCCAAGG + Intergenic
1182585414 22:31341921-31341943 CCGTCCACGCCTGACCCCCAGGG + Intronic
1182765071 22:32752835-32752857 CCCCCCATGCATGCTCCCCATGG - Intronic
1184473188 22:44707340-44707362 TCCTCCACACAGGCCCTCCCTGG - Intronic
1185190760 22:49434397-49434419 GCCTCCTCACACGTCCCCCATGG + Intronic
1185228478 22:49667429-49667451 CCCTCCACCCCGGCTCCCCAGGG + Intergenic
950176399 3:10877891-10877913 CCCTGCTCACATGCCCCTGAGGG - Intronic
950544180 3:13629103-13629125 CCCTCCACACACACCTCCCAGGG - Intronic
951545589 3:23821755-23821777 CCCACCACACACGCGCCCTACGG - Intronic
952257349 3:31706868-31706890 CACTCCACCCATGTCCCCAAAGG + Intronic
953901568 3:46846672-46846694 CCCCCCTCACACTCCCCCCAAGG + Intergenic
954377244 3:50201654-50201676 CCCTCCACACTTGCTGGCCATGG - Intergenic
954859692 3:53677131-53677153 CCTACCACCCATGACCCCCATGG - Intronic
956390824 3:68771065-68771087 CCCTGGACACAGGCCACCCAGGG - Intronic
958974952 3:100657247-100657269 CCCTACACACATGCCATCAAGGG + Intronic
959350478 3:105255913-105255935 CACTCCACCCAGGCTCCCCAGGG - Intergenic
960641204 3:119825071-119825093 CCTTCCCCACATGCCTTCCAAGG - Intronic
961393226 3:126569042-126569064 CCCTGCTCACATTCCCTCCATGG - Intergenic
961502767 3:127349779-127349801 CTCTGCACACATGGCCCGCAGGG - Intergenic
961673507 3:128551029-128551051 CCCTCCTCACATGTCCTCCCTGG + Intergenic
961731500 3:128968562-128968584 GCCTCCACACCTGCACCCCCTGG + Exonic
961779300 3:129312309-129312331 CCCTCCCCACATGCCCATCCTGG - Intergenic
962797456 3:138861624-138861646 CTCTCCTCACAGGCTCCCCAGGG - Intergenic
964558087 3:157963131-157963153 CCCTCATCACATGCCACCCTAGG - Intergenic
965395060 3:168152951-168152973 CCCTACACAGAATCCCCCCAGGG + Intergenic
965901309 3:173644865-173644887 CCCTCAACACCTGCCCACCTTGG - Intronic
967878202 3:194281005-194281027 TCCTCCACACAGGCACCCCAGGG - Intergenic
968229413 3:196996522-196996544 CCCTCCACTCATGCCCATCTCGG + Intronic
968650181 4:1757321-1757343 CCCACCAGAGATGGCCCCCAGGG + Intergenic
969545379 4:7823126-7823148 CCCTCCACACATGCCCACAGAGG + Intronic
969835076 4:9833872-9833894 CCCTGCTCAAATGCCCACCAGGG - Intronic
970771060 4:19613117-19613139 ACCACCACACCTGACCCCCAAGG - Intergenic
971268556 4:25115679-25115701 GCCTCCACACAGGCTCCCAAAGG - Intergenic
981084894 4:140673469-140673491 CCCTCCACTCAGACCCCACATGG + Intronic
981427486 4:144620256-144620278 CACTCCACTCATGCCCCCTGAGG - Intergenic
982312665 4:154002226-154002248 CCCTCCCCATAAGCTCCCCATGG + Intergenic
985007583 4:185549466-185549488 TCCTCCATTCATGCCCTCCATGG - Intergenic
985571128 5:645890-645912 CCGTCCACACAGGCCGCCGACGG - Intronic
985571155 5:646085-646107 CCATCCACACAGGCCGCCAATGG - Intronic
985777292 5:1851466-1851488 CCCACCACACCTGGCCCCCTGGG + Intergenic
986329198 5:6705022-6705044 CCCTCCCCACTAGCTCCCCATGG + Intergenic
991037757 5:62144914-62144936 CACTCCAAACATTCCCACCATGG - Intergenic
994222292 5:97209288-97209310 CCCTGAACACATGCCCCCACTGG - Intergenic
997581409 5:135019628-135019650 CCCTCCAGACAGGTTCCCCAGGG - Intergenic
997660589 5:135586553-135586575 CTCTCCCCACATTCCGCCCATGG - Intergenic
997845137 5:137279118-137279140 CCCTCCAAATAAGCCCTCCAGGG - Intronic
998199357 5:140107562-140107584 CCCTCCTCAGACGCGCCCCAAGG + Intergenic
998396473 5:141821805-141821827 CCCTCCAGACATCCCACCCCTGG - Intergenic
999758297 5:154681627-154681649 ACCCCCACACATACCCCCCAAGG + Intergenic
1000728719 5:164804048-164804070 CACTACACACATGTTCCCCAGGG + Intergenic
1001098483 5:168794783-168794805 CCATCGACACATGCTCCCTAAGG + Intronic
1002172992 5:177385795-177385817 CTCGCATCACATGCCCCCCACGG - Exonic
1002435839 5:179230224-179230246 CCCTCCCCCCTTGCCCCCGAGGG - Intronic
1003136603 6:3439210-3439232 CCCTCCCCCCATGCCCCCAAAGG + Intronic
1004614978 6:17281138-17281160 CCCTCCCCACACCCCACCCAAGG + Intergenic
1005234784 6:23747403-23747425 CCCTCTACACATCACCTCCAAGG + Intergenic
1006645708 6:35512757-35512779 CCCTCCATCTAGGCCCCCCAGGG + Intronic
1007800464 6:44387959-44387981 CCCTCCACGCAGACCCCACAGGG - Intronic
1009248141 6:61264910-61264932 GCCTCCACACATGACCCTGATGG - Intergenic
1010746999 6:79574891-79574913 CTCTCCACACAAGCCCCTCTAGG + Intergenic
1010761832 6:79732845-79732867 GCCTCTCCACATGCCCCCCATGG + Intergenic
1011438883 6:87367200-87367222 CCCTCCACACATTCACCCGTGGG - Intronic
1012448617 6:99331719-99331741 CCCTCGACAGAGGCCCTCCAAGG - Intronic
1014581835 6:123147316-123147338 CCCTCCCAACCTTCCCCCCAAGG - Intergenic
1017054200 6:150423448-150423470 TCCTCTTCACATGCCCCCCTTGG + Intergenic
1019310619 7:358970-358992 CCCTCCACACATGCCCCCACAGG + Intergenic
1019607410 7:1917119-1917141 CCCTCCATCCATGTGCCCCAGGG + Intronic
1021100947 7:16585583-16585605 CCCTTCCCACATGTCCCCAAAGG - Intergenic
1023151075 7:37201987-37202009 CCCTTTACCCATGTCCCCCAAGG + Intronic
1024985126 7:55187824-55187846 CCCTCCCCACCAGCACCCCAAGG + Intronic
1025035623 7:55591124-55591146 CCCTCCACTCAGACCCCACATGG - Intergenic
1029546462 7:101212832-101212854 CCCACCTCACCTGCCCCCCCGGG + Exonic
1032443745 7:131962286-131962308 CCATCAACCCATGCCCCCCAAGG - Intergenic
1032645001 7:133813849-133813871 CCCACCACACATACACCCCAGGG + Intronic
1034224567 7:149472724-149472746 GCCCCCAAACATGCCCTCCAAGG - Intergenic
1035051479 7:156001343-156001365 CCCTCCACAAATCATCCCCATGG - Intergenic
1035323680 7:158051103-158051125 CCCCCTGCAGATGCCCCCCATGG - Intronic
1035446271 7:158945133-158945155 CCCTCCACTCCTGGCCTCCATGG - Intronic
1037716559 8:21406189-21406211 CCCTCCACCTACTCCCCCCAGGG + Intergenic
1037946573 8:22993380-22993402 CCCTCCACACACGGCCCAGATGG + Intronic
1038646296 8:29365279-29365301 CCATCCACACATCTCCCCCATGG + Intergenic
1041032696 8:53754465-53754487 CTCACCACCCATGTCCCCCAGGG + Intronic
1042116302 8:65435328-65435350 CCCTCCACACATGCACTCAGAGG + Intergenic
1045500243 8:102739034-102739056 CCCTCCATACAGACCCTCCACGG - Intergenic
1049308308 8:141919862-141919884 CCCTCCACACATCACTCACATGG - Intergenic
1049486428 8:142866083-142866105 GCCTCCACCCCTGCCACCCATGG - Intronic
1049804050 8:144530935-144530957 CCCTCCATGCATGTCCGCCACGG - Intronic
1050253424 9:3769751-3769773 CCCTCCAGACAGGCCCACTATGG + Intergenic
1055369547 9:75582444-75582466 ACCCCCACACTCGCCCCCCAGGG - Intergenic
1055487103 9:76766972-76766994 CTCGCCACACCTTCCCCCCAAGG + Intronic
1056753661 9:89368894-89368916 GCCTTCCCACAGGCCCCCCATGG - Intronic
1056765155 9:89440513-89440535 CCCTCCACACTCAGCCCCCAAGG + Intronic
1057272034 9:93656896-93656918 CCCTCCACACTTGCCTCCATTGG + Intronic
1057873314 9:98734069-98734091 GCCTCCACACATGCCCCCGCTGG + Exonic
1059386345 9:113967749-113967771 GCATCCACACTTGCTCCCCAGGG - Intronic
1060627567 9:125127514-125127536 GCCACCACACCTGCCCCCAAGGG + Intronic
1061382098 9:130264917-130264939 GCATCCACACATGCAGCCCATGG + Intergenic
1062192747 9:135256156-135256178 CCCTCCACATGCTCCCCCCAGGG + Intergenic
1062255108 9:135617199-135617221 CCTCCGACACATGCCCCTCAGGG + Intergenic
1062349719 9:136132951-136132973 TCCTCCACCCCTGCACCCCAGGG - Intergenic
1062412254 9:136431377-136431399 CCCTCCACGCCCGCCCCCCCAGG + Intronic
1062412270 9:136431419-136431441 CCCTCCACGCCCGCCCCCCCAGG + Intronic
1062412301 9:136431502-136431524 CCCTCCACGCCCGCCCCCCCAGG + Intronic
1062412333 9:136431586-136431608 CCCTCCACGCCCGCCCCCCCAGG + Intronic
1062412349 9:136431628-136431650 CCCTCCACGCCCGCCCCCCCAGG + Intronic
1062412395 9:136431752-136431774 CCCTCCACGCCCGCCCCCCCAGG + Intronic
1062450004 9:136611188-136611210 CTGCCCACACCTGCCCCCCACGG - Intergenic
1062595167 9:137296048-137296070 CCACCCCCACATGCCCCCCACGG + Intergenic
1185699376 X:2218919-2218941 CTCTCCACACAGCTCCCCCAGGG + Intergenic
1189648624 X:43163614-43163636 CCCTCCACAGCTTCCCCCAATGG - Intergenic
1192223576 X:69213591-69213613 CCCTCCTCACAACCCTCCCAAGG - Intergenic
1192239706 X:69319429-69319451 CCCTCCACACAGACCCCCAGGGG + Intergenic
1195483872 X:105379965-105379987 ACCTTCACAGATGCCCCCCAGGG - Intronic
1195559702 X:106269397-106269419 CCCTCCCCACAACCCCGCCAGGG - Intergenic
1195562259 X:106296942-106296964 CCCTCCCCACAACCCCGCCAGGG + Intergenic
1198692650 X:139301089-139301111 CACTCCTCCCTTGCCCCCCATGG + Intergenic
1199868365 X:151874598-151874620 CCCTCCATACATGCCCAAAAGGG + Intergenic
1201273989 Y:12281946-12281968 CTCTCCACACAACTCCCCCAGGG - Intergenic