ID: 1163814603

View in Genome Browser
Species Human (GRCh38)
Location 19:19456789-19456811
Sequence CTGAAGATTCCAAAGGACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 235}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163814603_1163814610 4 Left 1163814603 19:19456789-19456811 CCCATGTCCTTTGGAATCTTCAG 0: 1
1: 0
2: 1
3: 12
4: 235
Right 1163814610 19:19456816-19456838 GACTCTTTGAGTGGTTGATGGGG 0: 1
1: 0
2: 2
3: 13
4: 192
1163814603_1163814611 15 Left 1163814603 19:19456789-19456811 CCCATGTCCTTTGGAATCTTCAG 0: 1
1: 0
2: 1
3: 12
4: 235
Right 1163814611 19:19456827-19456849 TGGTTGATGGGGCCTTCTGATGG 0: 1
1: 0
2: 0
3: 12
4: 161
1163814603_1163814609 3 Left 1163814603 19:19456789-19456811 CCCATGTCCTTTGGAATCTTCAG 0: 1
1: 0
2: 1
3: 12
4: 235
Right 1163814609 19:19456815-19456837 TGACTCTTTGAGTGGTTGATGGG 0: 1
1: 0
2: 1
3: 9
4: 142
1163814603_1163814608 2 Left 1163814603 19:19456789-19456811 CCCATGTCCTTTGGAATCTTCAG 0: 1
1: 0
2: 1
3: 12
4: 235
Right 1163814608 19:19456814-19456836 CTGACTCTTTGAGTGGTTGATGG 0: 1
1: 0
2: 1
3: 16
4: 143
1163814603_1163814607 -5 Left 1163814603 19:19456789-19456811 CCCATGTCCTTTGGAATCTTCAG 0: 1
1: 0
2: 1
3: 12
4: 235
Right 1163814607 19:19456807-19456829 TTCAGGTCTGACTCTTTGAGTGG 0: 1
1: 0
2: 1
3: 7
4: 125
1163814603_1163814612 23 Left 1163814603 19:19456789-19456811 CCCATGTCCTTTGGAATCTTCAG 0: 1
1: 0
2: 1
3: 12
4: 235
Right 1163814612 19:19456835-19456857 GGGGCCTTCTGATGGCTGACTGG 0: 1
1: 0
2: 0
3: 16
4: 163
1163814603_1163814613 24 Left 1163814603 19:19456789-19456811 CCCATGTCCTTTGGAATCTTCAG 0: 1
1: 0
2: 1
3: 12
4: 235
Right 1163814613 19:19456836-19456858 GGGCCTTCTGATGGCTGACTGGG 0: 1
1: 0
2: 0
3: 16
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163814603 Original CRISPR CTGAAGATTCCAAAGGACAT GGG (reversed) Intronic
901463401 1:9405182-9405204 GTGAAGATTACAGGGGACATGGG - Intergenic
903783097 1:25835179-25835201 CTGAAGATTCTCAAGGCCAGCGG - Exonic
908934829 1:69362683-69362705 CTCCAGATTCCAAACAACATTGG + Intergenic
908995581 1:70149165-70149187 CTGAAGATGCCACAAGATATGGG + Intronic
909576434 1:77181864-77181886 TTGAAGATTCCTCAAGACATGGG - Intronic
910617065 1:89209903-89209925 CTTCAGATTCCAAAGAACACTGG - Intergenic
910737809 1:90481298-90481320 CTGAAGTTTCTGAAGAACATTGG - Intergenic
913260135 1:116990383-116990405 CTGAAGATATGAAAGGACAGAGG - Intergenic
913301538 1:117375454-117375476 CTGGAGATTACAAAGAACACAGG + Intronic
913503589 1:119495309-119495331 CTGAAGATTCCACTGGAGAAAGG + Intergenic
915931679 1:160064598-160064620 CTGAAGACTCCAAAGAGCTTTGG - Intronic
916004303 1:160645750-160645772 CTGCAGATTCCAAAAGAAAGTGG + Intronic
916273044 1:162964459-162964481 CTGAAGATTACACAGGATTTTGG - Intergenic
917571307 1:176267980-176268002 CTGGAGATTCCAGAGGGCACAGG + Intergenic
918263460 1:182818118-182818140 TTGAAGATTCCAAGGGATTTAGG + Intronic
918833674 1:189431765-189431787 CTGAAGAAACCAAAGGCAATGGG - Intergenic
921454217 1:215348199-215348221 CTCCAGATTCCAAAAGACCTGGG + Intergenic
1063303416 10:4874527-4874549 CTGATGACTGCAAAGGACAGGGG + Intergenic
1064526247 10:16259873-16259895 CTGAAGCTTCCCAGAGACATAGG - Intergenic
1066376372 10:34860985-34861007 CTGACGATTCTAATGGTCATAGG + Intergenic
1067074130 10:43163602-43163624 TTTAAGATTCCAAAGGTCAGTGG + Intronic
1067536839 10:47117032-47117054 CTGCAAATTCCAAGGGGCATTGG + Intergenic
1068228536 10:54138522-54138544 CTCCAGATTCCAAAGAATATTGG - Intronic
1069175405 10:65283791-65283813 CTGAAGATTCTAAAGGTTTTAGG - Intergenic
1070504966 10:77104843-77104865 CTGGGGATCCCAAAGGCCATGGG + Intronic
1078514439 11:12009657-12009679 CTGAGGATTTCACAGGACAGAGG - Intronic
1078795412 11:14587291-14587313 CGCCAGATTCCAAAGGACACAGG - Intronic
1079847957 11:25494171-25494193 CAGAAGATTCCCCAGGACTTTGG - Intergenic
1081813233 11:45924734-45924756 CTGAAGCTGCCACAGGACCTGGG - Intronic
1082636396 11:55599585-55599607 CTGCAGATTCCAAACAACAATGG - Intergenic
1082922605 11:58511792-58511814 CTCATAATTCCCAAGGACATAGG - Intergenic
1083938956 11:65884894-65884916 CTGAAGATGCCAAGGGTCAGAGG + Intronic
1084269409 11:68021115-68021137 CCGAAGTTTCCAAAGGAGATGGG + Intronic
1085412824 11:76301672-76301694 CTGAAGAGCCCACAGGACACAGG - Intergenic
1085434630 11:76489108-76489130 CTGAAGAATCCACAAGGCATTGG - Intronic
1085480484 11:76819110-76819132 CTTCAGATTCCAAACAACATTGG + Intergenic
1085833299 11:79926155-79926177 GTGAATGTTCCCAAGGACATCGG + Intergenic
1086947680 11:92859487-92859509 CTGAATGTTCAAAAGGAAATGGG - Intronic
1087208457 11:95421006-95421028 CTGAAGATTGCAAGGCCCATTGG - Intergenic
1087677806 11:101182491-101182513 CTAAAGATTCTAAATGACACAGG + Intergenic
1089989391 11:122844683-122844705 CTGAAGTTTCTAGAGGACAACGG - Intronic
1090027934 11:123183639-123183661 CTGAGGAACCCACAGGACATGGG + Intronic
1092191155 12:6521977-6521999 CGGAAGATTACAGAGGCCATTGG + Exonic
1092624013 12:10305755-10305777 CCAAATATTCCAAGGGACATAGG + Intergenic
1092679365 12:10960990-10961012 ATGGAGTTTCCAAAGGCCATTGG + Intronic
1092979581 12:13780530-13780552 TTGTAGATTCCAAAAGAAATGGG + Intronic
1093315310 12:17642779-17642801 CTAAACATTTCCAAGGACATTGG - Intergenic
1094380953 12:29842050-29842072 CTGAAGATTCAAATGATCATTGG + Intergenic
1094380979 12:29842354-29842376 CAGATGATTCCAAATGACAGAGG + Intergenic
1094433018 12:30390334-30390356 CTCCAGGTTCCAAAGAACATTGG - Intergenic
1098435383 12:70463377-70463399 CTCCAGATTCCAAAGAATATTGG + Intergenic
1098443039 12:70537804-70537826 GTGAAGATTCCAAATAACATGGG + Intronic
1099525621 12:83715619-83715641 CAGAAGATTTCAAAATACATGGG + Intergenic
1100797462 12:98197493-98197515 CTGAAGGTTCCAAAGGGGAGAGG - Intergenic
1103391389 12:120576202-120576224 CTCAAGATTCTAAAGGATACAGG - Intronic
1106139432 13:26999497-26999519 CTAAAGCTTCCAAAGGTTATTGG - Intergenic
1106871407 13:34025887-34025909 CTGACGATTAGAAAGGACATGGG - Intergenic
1108028474 13:46203577-46203599 CAAAAGATTCCTAAGGATATGGG - Intronic
1108144781 13:47464652-47464674 CTGAAAATTCAAAAGGCCAGAGG + Intergenic
1108442419 13:50468613-50468635 ATGATGATGCCAAAGCACATAGG + Intronic
1110368372 13:74713213-74713235 CTGAAGATTCAGAAGATCATTGG - Intergenic
1110559287 13:76893067-76893089 CTGAAGAGTTCAAAGAGCATGGG - Intergenic
1111977505 13:94982337-94982359 CTGAAGAGTCTAGAGGAAATGGG + Intergenic
1112142916 13:96665747-96665769 CTGAAGATCCCAGAGTACAATGG + Intronic
1113062419 13:106337615-106337637 CAGAAGCTACTAAAGGACATAGG - Intergenic
1113440364 13:110323642-110323664 CAGAAAATTCCAAAGGAAAGGGG + Intronic
1113497164 13:110740210-110740232 CTGAAGAATAAAAAGGAGATTGG + Intergenic
1114306599 14:21429270-21429292 CTGGAGGTCCCCAAGGACATCGG - Exonic
1114661915 14:24351958-24351980 ATGAGAATTCCAAAGGACACAGG - Intergenic
1115437859 14:33396682-33396704 ATAAAAATTCCAAAGGAAATTGG - Intronic
1116189192 14:41641216-41641238 CTGAAGGTCTAAAAGGACATTGG + Intronic
1116770409 14:49120810-49120832 CAGAAGATAGCAAAGGAGATGGG + Intergenic
1117056791 14:51920257-51920279 CTGAAGATATCAAGGGACAACGG + Intronic
1117324017 14:54652333-54652355 CAGAAGATCCCAAATGACACTGG - Intronic
1121999206 14:98632666-98632688 CAGAAGATCCCAAGGTACATGGG + Intergenic
1122137441 14:99642880-99642902 CTGAATATTGACAAGGACATTGG - Intergenic
1122473924 14:101992626-101992648 ATGAAGATTGCAGGGGACATGGG - Intronic
1123888639 15:24752297-24752319 CCTAAGATTCACAAGGACATTGG - Intergenic
1124069705 15:26379987-26380009 CAGGAGCTTCCAAGGGACATTGG - Intergenic
1126888833 15:53182146-53182168 CTGAAGATCACAATGCACATTGG + Intergenic
1128642687 15:69351332-69351354 CTGAAGAATCCAGAAGACAGTGG + Intronic
1130339270 15:82985660-82985682 CTGAACATCCCACAAGACATGGG + Intronic
1131165898 15:90142004-90142026 CTGCAGATTCCACAGGACCAAGG + Intergenic
1134743876 16:16572509-16572531 CTGACCACTTCAAAGGACATAGG - Intergenic
1135001606 16:18781242-18781264 CTGACCACTTCAAAGGACATAGG + Intergenic
1138027293 16:53532050-53532072 CTGAATATCCCAAGGGACACAGG + Intergenic
1138065514 16:53937251-53937273 TTGAATGATCCAAAGGACATCGG + Intronic
1139233188 16:65307035-65307057 CTGAAGAGTTCAGAGGACATAGG + Intergenic
1140197328 16:72865913-72865935 CTGAAGATTCCACATGCCACCGG + Intronic
1144970026 17:19102628-19102650 GTGAAGATTCCAAACAAAATGGG - Intergenic
1144977890 17:19149437-19149459 GTGAAGATTCCAAACAAAATGGG + Intronic
1144990331 17:19228796-19228818 GTGAAGATTCCAAACAAAATGGG - Intronic
1145931669 17:28690417-28690439 ATGAAGATTCCATAGCACACTGG - Intronic
1146013068 17:29211416-29211438 CTGCAGAGTACAAAGGGCATAGG - Intergenic
1146742775 17:35301135-35301157 CTGAAGGTTGCAAAGACCATGGG - Intergenic
1148194423 17:45702954-45702976 GTGAGGAGCCCAAAGGACATGGG + Intergenic
1150848742 17:68684964-68684986 CTGCAGATTCCAAAGGACACTGG + Intergenic
1151846277 17:76658191-76658213 CTGCACCTTCCAAAGGTCATGGG - Intergenic
1153419198 18:4885583-4885605 CTGAAAATTCCAAAAAACAGAGG - Intergenic
1154970027 18:21398741-21398763 ATGCAGATTCCAAAGACCATGGG + Intronic
1155100293 18:22604384-22604406 CAGAAAATTACAAGGGACATAGG + Intergenic
1155678217 18:28456930-28456952 CTGGAAATTACAAAGAACATGGG + Intergenic
1158066801 18:53420308-53420330 CTGAATATTCTAAAGAACAAGGG + Intronic
1159049633 18:63407950-63407972 CTGGGGATTCCAAAGGACAGAGG + Intronic
1163185454 19:15635976-15635998 CTGCAGATTAAAGAGGACATAGG - Intronic
1163814603 19:19456789-19456811 CTGAAGATTCCAAAGGACATGGG - Intronic
1166438305 19:42788418-42788440 CTGCAGTTTCCAAAGCCCATGGG - Intronic
1166473335 19:43099152-43099174 CTGCAGTTTCCAAAGCCCATGGG - Intronic
1166494125 19:43286154-43286176 CTGCAGTTTCCAAAGCCCATGGG - Intergenic
1166597460 19:44062617-44062639 TAGAAGTTTCCACAGGACATGGG - Intronic
1168256571 19:55169269-55169291 CTGCAGATTGCATAGGGCATAGG - Intergenic
926741528 2:16115163-16115185 CTGAAGGATCCAAAGGTCAAAGG + Intergenic
927765356 2:25802576-25802598 CAGGAAATTCCAAGGGACATAGG - Intronic
929836871 2:45410542-45410564 CTGGAGATTCCAAAGGTTTTAGG - Intronic
929961892 2:46503218-46503240 CTGAGGATTCCACAGCACAGTGG + Intronic
932365900 2:71153442-71153464 CTGAACATGCCTGAGGACATTGG + Intergenic
932530013 2:72519916-72519938 CACAAAACTCCAAAGGACATGGG + Intronic
933302379 2:80556675-80556697 CTGAGGAAGCCAAAAGACATTGG - Intronic
933405116 2:81848139-81848161 CTGAAGAATACAATGGAAATTGG + Intergenic
935401972 2:102669693-102669715 CTGATGATTCCTATGGACAACGG + Intronic
940205704 2:151199147-151199169 CTGAAGTTTTTCAAGGACATGGG + Intergenic
941059620 2:160831304-160831326 CTCAAGATTCCAAAGGAACAAGG - Intergenic
941518773 2:166511727-166511749 CTGCAGATTGCAAAATACATGGG + Intergenic
941584520 2:167340924-167340946 TTCAAGATTACAAAGGAAATAGG + Intergenic
942671164 2:178377633-178377655 CTGCAGCTGCCAAAGGAAATTGG + Intronic
943926901 2:193796009-193796031 CTGAAGACACCAAAGTTCATGGG - Intergenic
944421443 2:199535151-199535173 CTGAAAATTACATAGGACATAGG - Intergenic
947483215 2:230522328-230522350 CTCCAGATTCCAAAGAATATTGG - Intronic
948094027 2:235319469-235319491 CTGCAAATTCCACAGGGCATGGG - Intergenic
948642037 2:239381724-239381746 CTGAACATTCTACAGCACATGGG - Intronic
1169587233 20:7098620-7098642 CTGAAGATTCAAAAGCTCACTGG + Intergenic
1169628444 20:7598457-7598479 CTAAATATTCAAAAGGACTTGGG - Intergenic
1172083969 20:32364139-32364161 CTGAAGCTTCCAAAGTCCACTGG - Intronic
1173141860 20:40491695-40491717 ATGAATATCACAAAGGACATGGG - Intergenic
1173270440 20:41529586-41529608 CTGAAGAATGGAAAGGACTTGGG + Intronic
1174591966 20:51653150-51653172 CTGAAGACACCAAAGGCCAAAGG + Intronic
1174638337 20:52021109-52021131 CTTCAGATTCCAAAGGACAATGG + Intergenic
1177498862 21:21924529-21924551 GTGAAGACTCCAAAAGAAATGGG + Intergenic
1178573129 21:33759619-33759641 GTGAAGATTCTAAAGGACTGTGG - Intronic
1181580112 22:23823433-23823455 GTGGAGATAGCAAAGGACATGGG + Intronic
1181828743 22:25541592-25541614 ATGAAGATCCCCAAGGACCTTGG + Intergenic
1182164920 22:28163370-28163392 CTGAAGATAGCCAAGGACCTGGG - Exonic
1183019571 22:35016404-35016426 CAGAAGAACCCAAAGGAAATGGG + Intergenic
952871126 3:37902377-37902399 GTGAAGATCTCTAAGGACATAGG + Intronic
953007831 3:38994645-38994667 CTGCAGACTCCAAGGGACTTAGG - Intergenic
958173563 3:89966887-89966909 AGGAAGATTACAAAGGACTTAGG - Intergenic
958840944 3:99204425-99204447 CTGAAAATTCAAAAGGCCTTGGG - Intergenic
959578667 3:107962056-107962078 CAGAAAATGCCAAAGGACTTAGG + Intergenic
962074174 3:132063398-132063420 CTGCAGATCACAAAGGACAATGG + Intronic
963271145 3:143286891-143286913 TTTAAGATTCCTAATGACATGGG - Intronic
963323193 3:143832285-143832307 CTGAAGGTTCCAAATCATATAGG - Intronic
964380183 3:156090848-156090870 CTAAACATTCCAAAGGGCATAGG + Intronic
969507230 4:7595592-7595614 CTGGAGATTCCAAGGGTCCTAGG + Intronic
971169716 4:24220710-24220732 CTAAAGATTCCAAAGGGGAAAGG + Intergenic
974195702 4:58571707-58571729 TAGAAGATTGCAAAGGAGATGGG - Intergenic
975594284 4:76033170-76033192 TTGAAGAATCCACAGGACAATGG + Intronic
976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG + Intronic
977832430 4:101609338-101609360 CTTCAGATTCCAAAGAATATTGG - Intronic
980006915 4:127552751-127552773 GTGGAGATTCCCAAGGACATGGG + Intergenic
981003504 4:139851704-139851726 CTTGAGATTACAAAGGAAATAGG + Intronic
982577154 4:157127764-157127786 CTGAAGAAGCCAAAGGAAAGAGG + Intronic
982853014 4:160342632-160342654 CTGAAGGTTGCAAAGACCATGGG + Intergenic
983053930 4:163080069-163080091 CTGGAGATTCCAAGGGTCTTTGG + Intergenic
983612819 4:169668835-169668857 CTGAAGCTTCAAGAGGACTTAGG - Intronic
984389231 4:179107642-179107664 CTGGAGATTCCAGAGGAAAAAGG + Intergenic
984517384 4:180757561-180757583 TTGAAGATTCCAAAGATCTTAGG - Intergenic
988426651 5:31072917-31072939 CTTAGGATTCCATAGAACATGGG - Intergenic
990965869 5:61447214-61447236 ATGCAGATTCCAAAGAATATTGG + Intronic
993481207 5:88426595-88426617 TTGCACATTCCAAAGGAGATAGG - Intergenic
993615974 5:90113109-90113131 CAGAACATTCCAAAGGAGAGTGG + Intergenic
993894932 5:93522829-93522851 CTGCAGATTGCAAAGACCATGGG - Intergenic
994254269 5:97574505-97574527 ATAAAGTTTACAAAGGACATAGG - Intergenic
994684348 5:102930850-102930872 CTTAATATTCCATAGGAAATAGG + Intronic
995170356 5:109103929-109103951 CTGAAGATATCAAAGAACAATGG - Intronic
995213275 5:109565278-109565300 CTGAAAATGCTACAGGACATTGG - Intergenic
999634289 5:153604019-153604041 CTGAAGCTTCCAAGGCATATTGG - Intronic
999740185 5:154544025-154544047 CTGAAGATTGGAAGTGACATTGG + Intergenic
1002457130 5:179351596-179351618 CTCATTATTCCAAAGAACATTGG - Intergenic
1002820789 6:722864-722886 CTGAAAATCCCACAGGACAGTGG - Intergenic
1004513991 6:16306525-16306547 CTGAAGTTTCCAGAGAAAATGGG - Exonic
1004557702 6:16715728-16715750 CTGTAGATTCCAAAACATATGGG - Intronic
1005670996 6:28106011-28106033 CTGAGGATTCCAAAAGCCCTGGG - Intergenic
1007172979 6:39877539-39877561 CTGAAGAGGCCAAAAGTCATGGG + Intronic
1007262435 6:40573225-40573247 CTGACTATTCCAGAGGCCATTGG + Intronic
1007527896 6:42512718-42512740 CTGAAGATTCTAAGGGAAGTAGG - Intergenic
1008499339 6:52165144-52165166 CTGGAGATTCCAATGGAGTTTGG + Intergenic
1009553085 6:65125273-65125295 CTGAACAATCCTAATGACATTGG - Intronic
1009828234 6:68896307-68896329 ATGAAAAATCCAAAGGACCTGGG + Intronic
1009962321 6:70539127-70539149 ATGAGGATTTCAAAGGACACTGG - Intronic
1010989384 6:82462463-82462485 CTCCAGATTCCAAAGTATATTGG - Intergenic
1014400322 6:120981045-120981067 CTGCAGATTCCAAGGGACAATGG + Intergenic
1014733919 6:125068980-125069002 CTGAAGATTTCTGAGAACATGGG + Intronic
1017666870 6:156728122-156728144 TTGAAGTTTCCTAAGAACATAGG + Intergenic
1018771091 6:166972252-166972274 CTCCAGATTCCAAAGAACACTGG + Intergenic
1018797692 6:167200038-167200060 CTGCAGATTACAAAAGCCATGGG + Intergenic
1019882579 7:3875808-3875830 GTGGAGATTCCCAAGGATATAGG - Intronic
1022340017 7:29459355-29459377 AGGAAAATTCCAAATGACATGGG - Intronic
1022606739 7:31822808-31822830 ATGAAGACTCTACAGGACATGGG - Intronic
1023000685 7:35804330-35804352 CTGATGATGCAAAAGGACACAGG - Intronic
1023464004 7:40433557-40433579 TTGAAGATTCAAAAGGAAACAGG - Intronic
1024442928 7:49442672-49442694 CTGAAGTTTCCAGAAGAAATGGG - Intergenic
1028801465 7:94970302-94970324 CTGCAGATTGCAAAGACCATGGG + Intronic
1028804704 7:95011677-95011699 CTAAAGATTCCAAAAGAGAGTGG + Intronic
1029810158 7:103038881-103038903 CTGAAAATTCCAAAAGACACAGG + Intronic
1029978653 7:104857883-104857905 CTGAAAATTCCACAGGAAACGGG + Intronic
1031100583 7:117475389-117475411 CTGAACATTCCACAGTACAAGGG + Intronic
1031282664 7:119823508-119823530 CTGTCAAGTCCAAAGGACATAGG + Intergenic
1033361077 7:140639679-140639701 CCCAAGGTTCCAAATGACATCGG - Intronic
1033523985 7:142191996-142192018 CTGAAATTTCCCAACGACATTGG - Intronic
1037543168 8:19891359-19891381 CTGAAGGCTCCAAAGGCCTTTGG - Intergenic
1038635042 8:29279418-29279440 GTAAATATTCCAAAGGACATTGG + Intergenic
1038740059 8:30209271-30209293 ATAAAAATTCCAAAGGACACAGG - Intergenic
1040607416 8:48947839-48947861 CTTAAGATGCCTAAGGAAATAGG - Intergenic
1040650392 8:49442750-49442772 CTTCAGATTCCAAAGAACACTGG + Intergenic
1042110864 8:65379921-65379943 CTGCAGGTTGCAAAGCACATGGG - Intergenic
1042891687 8:73618935-73618957 GTGAAGATTGCAAAAGAAATGGG + Intronic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044013926 8:87027749-87027771 CTCCAGATTCCAAAGAATATTGG + Intronic
1044358234 8:91251018-91251040 CTTAAGTTTTCAAAGTACATTGG - Intronic
1047025343 8:120817579-120817601 CTTCAGATTGCAAAGGAGATTGG + Intergenic
1047331194 8:123888445-123888467 CTTCAGATTCCAAAGAATATTGG - Intronic
1051241773 9:15064462-15064484 CTGAACCTTCAAGAGGACATAGG + Intergenic
1052753561 9:32517025-32517047 CTCCAGATTCCAAAGAATATTGG - Intronic
1055727571 9:79247979-79248001 CTCAAGCTACCAAAAGACATGGG + Intergenic
1056074817 9:83027472-83027494 CTGGAGATTCCAAAGGTTTTAGG + Intronic
1058418008 9:104808040-104808062 CTGAACATTCAAAAGGGGATTGG + Intronic
1058722005 9:107772902-107772924 GTGAAGCTTCCCAAGGCCATGGG - Intergenic
1058840338 9:108901364-108901386 ATCAAGACTCCAAAAGACATTGG + Intronic
1061657625 9:132104906-132104928 GTGAAGAGTTCAAAGAACATGGG + Intergenic
1186053380 X:5624000-5624022 GTGAAGCTTCCCAAGGCCATGGG + Intergenic
1188232999 X:27689030-27689052 CTGATGATTCAAAAGTATATGGG + Intronic
1188561794 X:31476831-31476853 CTGGGGATTAAAAAGGACATTGG + Intronic
1189213912 X:39307078-39307100 GTTAAGTTTCCAAAGAACATGGG - Intergenic
1189539203 X:41968778-41968800 CAGAGGATTCTAAAGAACATAGG - Intergenic
1189937705 X:46087111-46087133 CTGAGGGTTGCAAAGGCCATGGG - Intergenic
1190290422 X:48988767-48988789 CTGAAGATTCCAAGAGACTGGGG - Intronic
1191313266 X:59095766-59095788 TTGAAGATTTCAATGGAAATGGG + Intergenic
1191317844 X:59156949-59156971 TTGAAGATTTCAATGGAAATGGG + Intergenic
1191524759 X:61925854-61925876 TTGAAGATTTCAATGGAAATGGG + Intergenic
1193001649 X:76569096-76569118 CTGAAAATTCCAAAAAACAGAGG + Intergenic
1194007256 X:88510399-88510421 CTGAAGATTTTAAGGGACAATGG - Intergenic
1195328468 X:103777022-103777044 TTGAAGATTCAAGAGGACACAGG + Intronic
1196103403 X:111871012-111871034 CTGAAGATTTGAAAGGAAGTGGG - Intronic
1196476498 X:116092344-116092366 CTGCAGATTGCAAAAGCCATAGG + Intergenic
1196833405 X:119793700-119793722 GTGAAGATTCAAAAGGTCACTGG - Intergenic
1198060620 X:133042364-133042386 CTGCAGATTCCAAAAACCATGGG + Intronic
1198230016 X:134680088-134680110 CTGAATCTTCAGAAGGACATGGG + Intronic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1202108613 Y:21397746-21397768 CTGATGACTACAAATGACATAGG + Intergenic