ID: 1163815226

View in Genome Browser
Species Human (GRCh38)
Location 19:19460938-19460960
Sequence CAGAGCACACAGAGGGACGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 320}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163815226 Original CRISPR CAGAGCACACAGAGGGACGG GGG (reversed) Intronic
900363653 1:2301710-2301732 CAGAGCACACTCAGGGCCGGGGG - Intronic
900438374 1:2641901-2641923 CAGAGGACACAGAGAGAGGCAGG + Intronic
900690847 1:3979424-3979446 CAGAGCACCGAGAGGGCCTGGGG - Intergenic
901193067 1:7424101-7424123 CAGAGCCCACGTGGGGACGGTGG - Intronic
901848802 1:12001958-12001980 TGGAACACACAGAGGCACGGAGG - Intronic
902364112 1:15959596-15959618 GAGAGTAGACAGAGGGAAGGAGG + Intronic
902502362 1:16919452-16919474 CAGAGGGCACCCAGGGACGGAGG + Intronic
902686526 1:18080997-18081019 CAGTGCACAGAGAGGTATGGTGG - Intergenic
903451293 1:23455470-23455492 CAGAGGACAAAGAGGGAGTGAGG + Intronic
903484295 1:23678028-23678050 AAGAGCCCACAGAGAGAAGGGGG + Intergenic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
904001757 1:27342801-27342823 CAGGGCACAGAGAGGGACGTGGG + Intronic
904238861 1:29131227-29131249 AGGAGCCCACAGAGGGAGGGGGG + Intergenic
905015669 1:34776975-34776997 CAGATCAGGCAGAGGGATGGGGG - Intronic
905880172 1:41457963-41457985 CAGAGCACACAGGGGCTCTGGGG + Intergenic
907740146 1:57157519-57157541 CTGAGCACACAGTGAGACAGTGG - Intronic
909496345 1:76283099-76283121 CAGAGGTCACTGAGGGATGGGGG - Intronic
910964255 1:92792401-92792423 CAGAGAAGACAGAGAGACTGGGG + Exonic
913168761 1:116213020-116213042 GAGAGGACACAGAGAGAAGGTGG + Intergenic
914984889 1:152448003-152448025 CAGAGGAGACAGAGAGAAGGTGG + Intergenic
916786113 1:168088254-168088276 CAGAGCAGGCAGAGGGAATGGGG + Intronic
917159323 1:172040027-172040049 CAGAGAAAACAGAGGGCCTGTGG + Intronic
920683705 1:208092933-208092955 AAGAGAACAAAGAGGGAAGGTGG + Intronic
920948886 1:210554511-210554533 CAAATCACACACAGGGAGGGTGG - Intronic
923261668 1:232273695-232273717 CAGAGCCTTCAGAGGGACGGTGG + Intergenic
1064620618 10:17213034-17213056 TAGAGCTCACAGAGGGAAAGAGG - Intergenic
1065853871 10:29814149-29814171 CCAAGTACACAGAGGGAAGGAGG - Intergenic
1067022805 10:42816511-42816533 CAGAGCACACTGTGGGCCTGTGG + Intronic
1067041807 10:42958057-42958079 CAGAGCACCCAGGGGGACTGTGG + Intergenic
1067743534 10:48914857-48914879 ATGAGCACACAGGGGGATGGGGG + Intronic
1069773875 10:70915709-70915731 CACAGCACACTCAGGGACAGTGG - Intergenic
1069984779 10:72275572-72275594 CAGAGCAGCCGGAGGGAGGGGGG + Exonic
1070652641 10:78249013-78249035 CACAGCACACAGGAGGAAGGAGG - Intergenic
1070786538 10:79165413-79165435 CAGAGCTTCCAGAGGGAGGGAGG + Intronic
1071849379 10:89552984-89553006 CAAAGTGGACAGAGGGACGGAGG - Intronic
1074732744 10:116395262-116395284 AAGAGCACACAGACAGACGCCGG - Intergenic
1075090677 10:119442528-119442550 CAGAGCAGACTGAGGAAAGGTGG - Intronic
1075257202 10:120934725-120934747 CAAAGCAGGCAGAGGGAGGGGGG - Intergenic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075618959 10:123911735-123911757 CAGAGCCCACAGAGGCTCTGTGG - Intronic
1076543776 10:131230479-131230501 CCCAGCACACTGAGGGACGCTGG + Intronic
1076791442 10:132779012-132779034 CACAGCACAGCCAGGGACGGAGG - Intronic
1076930407 10:133528362-133528384 TAGAGAACCCAGAGGGACGTGGG - Intronic
1077286559 11:1768545-1768567 CAGGGCACAGAGAGGGGCAGGGG + Intergenic
1077489681 11:2855088-2855110 CCGAGCACCCAGAGGGGCAGAGG + Intergenic
1077675481 11:4190591-4190613 AAGAGGACACATAGGGACTGGGG - Intergenic
1077735572 11:4786994-4787016 CAGAGGACACTGAGGGTCGTGGG - Intronic
1077890295 11:6413436-6413458 CTGAGAACACAGAGGGAAGGGGG - Intronic
1078098326 11:8313742-8313764 GAGGGCACCCAGAGGGAAGGTGG + Intergenic
1078135352 11:8647578-8647600 CAGAGAACACACAGGGAAAGGGG + Intronic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1083670080 11:64294887-64294909 CAGGGCAGAGAGAGGGAGGGAGG + Intronic
1083726547 11:64631329-64631351 CAGAGGACAGACAGGGACGGAGG + Intronic
1083811242 11:65108107-65108129 CAAAGCACACACAGGGCAGGGGG - Intronic
1084154934 11:67308097-67308119 CAGAGGTCCCAGAGGGAAGGTGG + Intronic
1084604709 11:70165700-70165722 AGGAGGACACAGAGGGAAGGTGG + Intronic
1084727757 11:70953049-70953071 TAGGGCACACACAGGGAAGGAGG - Intronic
1087204714 11:95381975-95381997 CAGAGAACCCAGAGAAACGGTGG + Intergenic
1087397675 11:97622287-97622309 CAGAGCTGACAGATGGACAGAGG - Intergenic
1087831140 11:102820880-102820902 CAGAGAAGGCAGAGGGATGGGGG - Intergenic
1088717167 11:112558994-112559016 AAGATCACACAGAGAGAGGGGGG + Intergenic
1089029183 11:115305647-115305669 CAGAAAACACAGAGGGGAGGAGG - Intronic
1089812115 11:121140757-121140779 CAGAAGACACAGAGGGAAAGAGG - Intronic
1089969448 11:122680748-122680770 AAGAGCACAGACAGGCACGGTGG - Intronic
1090399928 11:126442693-126442715 CAGAGCAGGCAGAGGGAGGGGGG - Intronic
1090917714 11:131180649-131180671 TAGACCCCACAGAGGAACGGAGG - Intergenic
1090961880 11:131564396-131564418 GTGAGCACACAGTGGGAAGGTGG - Intronic
1091050003 11:132358834-132358856 AAGAGAAGAGAGAGGGACGGGGG - Intergenic
1093081806 12:14821360-14821382 CAGAGCCCCCAGAGGGAGAGAGG - Intronic
1095698230 12:45164745-45164767 CAGAGCACCCAGTGGGAGGGGGG - Intergenic
1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG + Intergenic
1096195600 12:49647157-49647179 CAGACCACCCAGAGGGCCAGTGG - Intronic
1096257512 12:50072414-50072436 CAGAACACACAGAGGGGCCAGGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1101752467 12:107593761-107593783 CAGAGCAACAAGAGGGAAGGTGG - Intronic
1102095936 12:110241460-110241482 AAGAGAGCACAGAGGGATGGAGG - Intergenic
1102207574 12:111100974-111100996 CACAGCCCTCAGAGGGACAGGGG - Intronic
1103796402 12:123506173-123506195 CAGAGGCCACAGAGGAAAGGAGG + Intronic
1104086018 12:125474785-125474807 CAGAGCCCAGAGACGGACAGAGG - Intronic
1105891371 13:24684859-24684881 CAGAGCCCACACAGCGAAGGAGG + Intronic
1106087036 13:26551958-26551980 CACAGCACAAAAAGGGATGGTGG + Intergenic
1108432763 13:50371031-50371053 CAGAGCACACAGAGGGGAGGAGG + Intronic
1110035130 13:70673165-70673187 CAGAGCTCTCAGAGGGAGGGTGG - Intergenic
1113876662 13:113598772-113598794 CCGAGCGGACAGAGGGACGGCGG - Intronic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1115808144 14:37075523-37075545 CAGTGTACATAGAGTGACGGGGG + Intronic
1117066238 14:52015239-52015261 CAGCGCTCACAGATGGTCGGGGG + Exonic
1117481375 14:56148666-56148688 CAGAGAACACAGAAGAAAGGAGG - Intronic
1119909643 14:78337961-78337983 CAGAGTACCCAGTGGGAAGGTGG + Intronic
1120638886 14:86985467-86985489 CAGAGCTTACAAAGCGACGGAGG - Intergenic
1120878907 14:89399322-89399344 AAGAGCACACAGAGGGAGCTGGG + Intronic
1122293875 14:100694201-100694223 CAGGGCACACAGAGCGGGGGCGG + Intergenic
1122736997 14:103848510-103848532 GAGAGCAGACAGGGGGACTGAGG + Intergenic
1122917935 14:104867354-104867376 CAGGGAACACAGAGGCAGGGCGG - Intronic
1123142376 14:106093960-106093982 CTGAGCACACAGAGGGCAGCAGG + Intergenic
1123149697 14:106169163-106169185 CTGAGCACACAGAGGGCAGCAGG + Intergenic
1123196022 14:106617460-106617482 CTGAGCACACACAGGGAAGCAGG + Intergenic
1123706404 15:22954200-22954222 GAGAGGACACAGAGAGAAGGTGG + Intronic
1124108983 15:26769766-26769788 CACAGAACAGAGAGGGAGGGAGG - Intronic
1124995054 15:34715603-34715625 CAAATCACACAGAAGGACAGAGG + Intergenic
1125145995 15:36469003-36469025 CAGACCAGACAGAGGGAAGGAGG + Intergenic
1125245836 15:37638045-37638067 CAGAGCAAACAGAAGGGAGGAGG + Intergenic
1125731605 15:41895346-41895368 GAGAGCACCCAGAGTGAGGGGGG - Intergenic
1126249474 15:46551012-46551034 CAAAGCTCAAAGAGGGATGGGGG - Intergenic
1127550351 15:60031534-60031556 GTGAGCACACAGAGAGAAGGTGG + Intronic
1128084451 15:64876194-64876216 CAGAGCAGTAAGAGGGAAGGAGG - Intronic
1128827683 15:70735193-70735215 GAGGGCAGACAGAGGGATGGGGG + Intronic
1129185689 15:73904854-73904876 CAAAACACACAGATGGAGGGAGG + Intergenic
1129464440 15:75716033-75716055 CAGAGCACAGGGTGGGAGGGAGG + Intergenic
1129720806 15:77876979-77877001 CAGAGCACAGGGTGGGAGGGAGG - Intergenic
1131667227 15:94583416-94583438 CAAGGCACACAGAGGTACTGTGG + Intergenic
1132919584 16:2379363-2379385 CAGAGCACACAGCAGCACGAAGG - Intergenic
1133103942 16:3494881-3494903 CAGAGGAGACAGCGGGAGGGTGG + Intronic
1133383890 16:5353429-5353451 CACCACACACAGAGGGGCGGAGG - Intergenic
1135044150 16:19141008-19141030 GTGAGGACACAGCGGGACGGTGG + Intronic
1135504678 16:23026173-23026195 CAGAGCACAGCAAGGGATGGAGG + Intergenic
1136419325 16:30122481-30122503 CAGAGCACACGGTGGGGCCGGGG + Intronic
1138445261 16:57059374-57059396 CAGGGCACAGAGAGGGAAGCGGG - Intronic
1138465175 16:57185240-57185262 CAGTCCACACAGAGGAAAGGGGG - Intronic
1139513860 16:67442147-67442169 CAGAGCACAGTGAGGGTTGGTGG - Intronic
1139960521 16:70714939-70714961 CAGAGCTTCCAGTGGGACGGAGG - Intronic
1141798953 16:86294400-86294422 AGGAGCACACAGAGGGAGGCTGG + Intergenic
1141998625 16:87650368-87650390 CAGAGGAGAGAGAGGGATGGGGG - Intronic
1142253200 16:89002212-89002234 CAGAGCAGCCGGAGGGACGCAGG + Intergenic
1143309668 17:5977988-5978010 CAAGGCACACAGCTGGACGGTGG + Intronic
1144504899 17:15821594-15821616 CAGAGAACACAGAGGCACAGAGG + Intergenic
1145017726 17:19410131-19410153 CAGAGCACAGAGAGGTGCAGTGG + Intergenic
1145169072 17:20639477-20639499 CAGAGAACACAGAGGCACAGAGG + Intergenic
1145294643 17:21578568-21578590 CAGAGCAGACAGAGGCTTGGTGG + Intergenic
1145302729 17:21652596-21652618 CAGAGGAGACAGAGGGCAGGAGG - Intergenic
1145347574 17:22050592-22050614 CAGAGGAGACAGAGGGCAGGAGG + Intergenic
1145388381 17:22435518-22435540 CGCAGCAGCCAGAGGGACGGCGG - Intergenic
1146798509 17:35800036-35800058 CAGTGCAGAGAGAGGGAGGGAGG - Intronic
1146835059 17:36104253-36104275 CAAGGCACAGAGAGGGACAGGGG - Intronic
1146849671 17:36211489-36211511 CAAGGCACAGAGAGGGACAGGGG - Intronic
1146945239 17:36869158-36869180 CAGAGGTCACAGAGGGAGGAGGG + Intergenic
1148158577 17:45437194-45437216 AAGAGGACACAGAGGAACCGGGG + Exonic
1148346697 17:46908193-46908215 CAGACCTCACAGAGTGAGGGGGG - Intergenic
1149984236 17:61335196-61335218 CAGAGCACACACAAGGCCTGCGG - Intronic
1150062252 17:62078525-62078547 AAGGGCAAACAGAGGGATGGTGG - Intergenic
1155025819 18:21939902-21939924 AAGAGCACAGAGAGGGAGCGAGG - Intergenic
1156473963 18:37394262-37394284 CAGAGCAGGGAGAGGGACGCGGG + Intronic
1156995321 18:43458846-43458868 CAGAGCACAAATAGTGACTGTGG - Intergenic
1157779813 18:50428237-50428259 CAGAGCAAGCAAAGGGAGGGAGG + Intergenic
1159607022 18:70485425-70485447 CAGAGCACTGAGAGGGAGTGTGG - Intergenic
1159985053 18:74831874-74831896 CACAGCACACGGAGGGTGGGAGG - Intronic
1160111260 18:76033987-76034009 TAGAGCACACAGAGGGAAGACGG + Intergenic
1160245885 18:77159060-77159082 CAGAGCCTTCAGAGGGAAGGCGG + Intergenic
1160322851 18:77912595-77912617 CTGTGCATACAGAGAGACGGGGG - Intergenic
1160362847 18:78298360-78298382 CAAAGCACACTGAGGGAGAGGGG - Intergenic
1160501567 18:79403657-79403679 CCGGGCACACAGAGGTTCGGAGG - Intronic
1160988937 19:1852782-1852804 CAGAGAACACAGAGAGCCGAGGG + Exonic
1161719707 19:5896046-5896068 CAAGGCACACAGAAGGAAGGCGG + Intronic
1162310394 19:9903319-9903341 GAGAGCACACAGAGGGCCATGGG - Intronic
1162791800 19:13066864-13066886 CAGGGCAGCCAGAGGGCCGGGGG - Intronic
1163815226 19:19460938-19460960 CAGAGCACACAGAGGGACGGGGG - Intronic
1163926760 19:20353257-20353279 AAGAGCACACAGAGGGGGGAGGG - Intergenic
1164542053 19:29128630-29128652 GAGAACACACACAGGGACGATGG + Intergenic
1164542167 19:29129228-29129250 TAGAACACACACAGGGACGATGG + Intergenic
1165481237 19:36065764-36065786 CAAAGCACACAGAGAAATGGGGG - Intronic
1166304928 19:41932302-41932324 CAGAGGACACAGTGGTAGGGTGG - Intergenic
1166750361 19:45161595-45161617 CAGGGCACACAGAGGCAGGGCGG + Intronic
1166872412 19:45878930-45878952 CAGAGTAGACAGAGAGACGGTGG - Intergenic
1167288016 19:48609810-48609832 CTGAGCACACTGAGGGAAAGTGG + Intronic
1167381835 19:49142759-49142781 CAGAGGGGACAGAGGGACAGAGG - Intronic
1167571344 19:50290822-50290844 CCTAGCACACAGAGGGAGGCTGG + Intronic
1167687912 19:50968159-50968181 GGGAGCAGACAGAGGGATGGGGG - Intronic
1168127437 19:54293712-54293734 CAGAGCACACAGATGTGCAGAGG + Intergenic
1168172919 19:54601136-54601158 CAGAGCACACAGATGTGCAGAGG - Intronic
925169161 2:1740472-1740494 CAGAGCCCCCAGAGGGCCTGGGG + Intronic
925663883 2:6232306-6232328 CAGAGAGCACAGAGGAAAGGAGG - Intergenic
926121101 2:10241498-10241520 CAGGGCTCACAGAGGGGCTGGGG + Intergenic
926259274 2:11242397-11242419 CAGAGCTCAGAAAGGGAAGGAGG + Intronic
927571969 2:24167762-24167784 CAGAGTCCACAGTGGGAGGGAGG + Intronic
929995897 2:46826019-46826041 CAGACCACACAGAGGGATTGCGG + Intronic
930265980 2:49199542-49199564 CAGGGGACACAGAGGGACAATGG - Intergenic
932418705 2:71588828-71588850 CACAGCCTACAGAGGGACTGGGG - Intronic
932699122 2:73981503-73981525 TAGAGCAGACAGAGGGAGAGAGG - Intergenic
934059721 2:88282998-88283020 CAGAGCACACAGAATGAGGTGGG - Intergenic
935757052 2:106284442-106284464 CAGAGCAGACACAGGGAAGCTGG - Intergenic
935795277 2:106634917-106634939 CAGACCACACACAGGGAGGAAGG + Intergenic
936112509 2:109676546-109676568 CAGAGCAGACACAGGGAAGCTGG + Intergenic
936861930 2:117029465-117029487 CAGAGCACACACAGAGACCCAGG + Intergenic
937183279 2:120014767-120014789 CAGAGCAAACAGAGGGGAGTAGG + Intronic
937305390 2:120867551-120867573 CGCAGCACCCAGAGGGGCGGCGG - Intronic
937726038 2:125167737-125167759 CAAAGCACAGAGAGGGAGAGCGG + Intergenic
938219674 2:129554604-129554626 CAGAGCACACAGCTGGAGAGAGG - Intergenic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
940995069 2:160140399-160140421 CAGAGCAAGCAGAGGCATGGCGG + Intronic
942243879 2:173989813-173989835 CAGAGCACTGGGAGGGAGGGGGG - Intergenic
945450154 2:209984975-209984997 CAGAGAAGACAGAGAGACAGAGG - Intronic
946083605 2:217149392-217149414 CAGAGCACACAGAGGCTCCAGGG + Intergenic
946250111 2:218406481-218406503 CAGAGGCCGCAGAGGGGCGGGGG - Intergenic
947442812 2:230138009-230138031 CAGAAGACACAGAGGGAGGTAGG - Intergenic
947731903 2:232435912-232435934 CAGGACACAGTGAGGGACGGAGG - Intergenic
948234609 2:236379084-236379106 CAGAGCACCCAGAGGGGCACTGG - Intronic
948381983 2:237557055-237557077 GAGAGAACAGAGAGGGAGGGAGG - Intergenic
948687354 2:239677563-239677585 CAGCGCACACCCAGGGAGGGAGG - Intergenic
1170508549 20:17054199-17054221 CAGAGCTCCCAGAGGGGTGGGGG - Intergenic
1171440858 20:25161848-25161870 GAGAACACTCAGAGGGCCGGGGG + Intergenic
1171519319 20:25764127-25764149 CAGAGGAGACAGAGGGCAGGAGG - Intronic
1172882116 20:38208866-38208888 CAGTGCACAGAGAGGGAAGCAGG + Intergenic
1175839071 20:62015167-62015189 CAGACCCAACAGAGGGAGGGTGG + Intronic
1175850250 20:62086764-62086786 CTGGGCACACAGAGAGACTGGGG + Intergenic
1176193324 20:63824626-63824648 CAGAGCACCCAGAAGAACGGGGG - Intronic
1176653463 21:9570408-9570430 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1177244249 21:18502219-18502241 CAGAGGAGATAGAGGGATGGAGG + Intergenic
1178114575 21:29404374-29404396 GGGAGCACACAGAGGGGCAGAGG + Intronic
1179979031 21:44886987-44887009 CACAGCACTTAGAGAGACGGAGG + Intronic
1180045614 21:45303792-45303814 CAGAGCGCACAGAGGGGCCCTGG + Intergenic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1180986104 22:19904689-19904711 CAGAGCCCACCGAGGGCCTGGGG + Intronic
1182396753 22:30041646-30041668 CAGAGAACACAGTGGGGCTGGGG - Intergenic
1183284305 22:36952775-36952797 CAGAGGACAGAGGAGGACGGAGG - Intergenic
1184001164 22:41674670-41674692 CAGAGCAGACAGAAGCAGGGTGG - Exonic
1184105088 22:42362798-42362820 CAGAGCACAGGGAGGGAGAGGGG + Intergenic
1184376803 22:44118781-44118803 CAGAGCAAGCGGAGGGACAGAGG - Intronic
1184586269 22:45450228-45450250 CAGAGCCCACCGGGGCACGGAGG - Intergenic
1184650693 22:45918314-45918336 CAGAGCACACAGGGGCCCTGTGG - Intergenic
1185117539 22:48946143-48946165 CAGGGCATACGGAGGGAGGGAGG + Intergenic
950211434 3:11126509-11126531 CAGACCACAAAGAGAGAGGGCGG + Intergenic
950475517 3:13212046-13212068 CACAGCACACAATGGGACAGAGG - Intergenic
951456310 3:22896145-22896167 GAGATCACACAGAGGCATGGAGG - Intergenic
952360506 3:32625912-32625934 AAGAGCTCACGGAGGGAGGGGGG - Intergenic
953875136 3:46662374-46662396 GAGAGCACAGAGAGGAAAGGGGG + Intergenic
953903949 3:46858859-46858881 CACAGCACACAGAAGTACGGAGG - Intronic
953920675 3:46949261-46949283 CAGTGGGGACAGAGGGACGGAGG + Intronic
954564723 3:51589905-51589927 CAGAACACTCATAGGGAAGGTGG + Intronic
954649013 3:52148758-52148780 CAGAGCACACGGTGGGTCTGTGG - Intronic
956039585 3:65132031-65132053 TAGAGCCAACAGAGGGAAGGAGG - Intergenic
956707957 3:72015628-72015650 CAGGGCAGAAAGAGGGGCGGAGG - Intergenic
957713342 3:83892676-83892698 CACAGCATACAAAGGGAGGGAGG - Intergenic
959950545 3:112175578-112175600 CAGAGCGCCCAGAGGGAGGGTGG - Intronic
960037953 3:113120636-113120658 CACAGCTCAGAGAGGGACTGTGG - Intergenic
960800238 3:121531472-121531494 CAGAGCACTAAGAGGGGTGGGGG + Intronic
961001557 3:123377506-123377528 CACAGCACTCAGAGGGAGGGAGG - Intronic
963039580 3:141058960-141058982 CAGAACACACATATGGACTGTGG - Intronic
964122172 3:153196329-153196351 CAGAGCACACAGAGGCTGGCAGG + Intergenic
966250804 3:177863393-177863415 CAGAGCCTACACAGGGAAGGAGG - Intergenic
968410501 4:386235-386257 CACAGGTCACAGAGCGACGGAGG - Intergenic
968505721 4:970452-970474 CAGAGCCCTTAGAGGGAGGGTGG + Intronic
968639218 4:1702909-1702931 CACCGCACACAGAAGGTCGGTGG + Intronic
969145862 4:5123609-5123631 TGGAGGACACAGAGGGAAGGTGG - Intronic
969155385 4:5205458-5205480 CAGGGCACACAGAGACAGGGAGG + Intronic
969590761 4:8120636-8120658 CAGAGCACACAGATGGGGGCTGG - Intronic
969633434 4:8351599-8351621 CTGAGCACACAGAGGGGCTGTGG - Intergenic
970719838 4:18973540-18973562 CAGAGCACACAAAGCCAGGGAGG - Intergenic
971143654 4:23952024-23952046 GAGAACACACAGAGTGACCGTGG - Intergenic
971728902 4:30350538-30350560 CAGAGCAGGGAGAGGGACAGAGG - Intergenic
975131840 4:70839381-70839403 AGGCGCACACGGAGGGACGGAGG + Intronic
975323600 4:73035915-73035937 CAGAGGACACACAGGGAAGAAGG - Intergenic
975632782 4:76419519-76419541 CAGAGCCTCCAGAGGGAGGGAGG - Intronic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976781295 4:88761544-88761566 CACATCACACAGAAGGAAGGAGG + Intronic
978052684 4:104222037-104222059 CAAAGCACACAGTGGGAAGGTGG + Intergenic
978120617 4:105074703-105074725 CAAAGCAGAGAGAGGGAGGGAGG - Intergenic
978562357 4:110046539-110046561 CAGAGCTCACAGATGGCAGGGGG - Exonic
979987585 4:127333983-127334005 CAGTGCAAACAGAGGAAGGGAGG - Intergenic
985644929 5:1080343-1080365 GAGCGCACTCAGACGGACGGGGG + Intronic
985657890 5:1141490-1141512 GAGAGCACAGAGAGGGAGGCAGG - Intergenic
985750313 5:1669855-1669877 CACAGCACACAGAGAGCCGGGGG + Intergenic
986602734 5:9489461-9489483 CAGGGCACCCACAGGGATGGCGG + Intronic
987460081 5:18198433-18198455 GAGAGCAGCCACAGGGACGGAGG + Intergenic
988853358 5:35200851-35200873 AAGATCACACAGATGAACGGAGG + Intronic
988935915 5:36082946-36082968 CAGAGCTCCCAGAGGGACAGTGG + Intergenic
990864081 5:60361209-60361231 CAGATCAGACATAGGGAAGGTGG - Intronic
990864156 5:60362211-60362233 CAGATCAGACATAGGGAAGGTGG - Intronic
990986966 5:61649582-61649604 CAGAGTGCACAGGGGGAAGGTGG - Intronic
994016738 5:94975429-94975451 CTGAGCACACAGCAGGAAGGTGG + Intronic
995077911 5:108009496-108009518 CACAGAGCACAGAGGCACGGAGG + Intronic
995377073 5:111486550-111486572 AAGAGCAAAGAGAGGGAAGGGGG + Exonic
995888582 5:116923422-116923444 CAGGGCAGACAGTGGGAAGGAGG + Intergenic
996192910 5:120567434-120567456 CAGAGTACACAGAGGGTGGTAGG + Intronic
996847777 5:127919832-127919854 CAGAGCAGATAGAGGGACAGAGG - Intergenic
997732780 5:136192978-136193000 CAGAGCGCACGGAGGGCGGGTGG + Intergenic
998870052 5:146542987-146543009 GAGAGCACACAGTTGGAAGGGGG + Intergenic
1000137142 5:158363775-158363797 AAGTGGACACAGAGGGATGGTGG + Intergenic
1002359749 5:178661255-178661277 CAGAGGACACAAAGGGAATGAGG - Intergenic
1002764631 6:228295-228317 CAGAGCACGAGGAGGGAGGGAGG + Intergenic
1003536354 6:6978855-6978877 TAGAGCACAAAGAGGAAGGGAGG + Intergenic
1004595355 6:17094349-17094371 GAGAGAAGACAGAGGGAAGGAGG + Intergenic
1005061115 6:21777889-21777911 CAAACCTCACAGAGGGAGGGAGG - Intergenic
1006449690 6:34098935-34098957 CCCAGCCCACAGAGGGAGGGAGG - Intronic
1007040539 6:38717251-38717273 CAAAGCACACAGAGTGAATGTGG - Intronic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1007460769 6:42017159-42017181 CAGGGCACAGTGAGGGACAGAGG - Intronic
1008428578 6:51388086-51388108 CAGAGCAAACAAAGGGATGAAGG + Intergenic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1015238517 6:130997460-130997482 CAGACCACACAGAGCTACGAAGG + Intronic
1015866067 6:137728018-137728040 CAAAGCAGAAAGAGGGAAGGAGG + Intergenic
1017590433 6:155973491-155973513 CAGAGCACAAAGAGGAACAGAGG + Intergenic
1017955737 6:159176354-159176376 CAGAGGACACACAGGCAAGGAGG + Intronic
1019122531 6:169814347-169814369 CAGACCACACTGATGGATGGAGG + Intergenic
1019162414 6:170077698-170077720 CAGAGGACACAGCGAGAAGGCGG - Intergenic
1019408053 7:894250-894272 CATGGCGCACAGAGAGACGGGGG - Intronic
1019587711 7:1814116-1814138 CTGTGAACACAGAGGGACAGGGG - Intergenic
1019676177 7:2314102-2314124 CAGGGGACCCCGAGGGACGGAGG + Intronic
1020071142 7:5227693-5227715 CAGAACACACACAGGGCCTGTGG + Intronic
1022237090 7:28472790-28472812 CAGAGCACAGAGAAGCACTGAGG - Intronic
1022302071 7:29111295-29111317 CAGGGCACAGAGCGGGATGGAGG - Intronic
1022510684 7:30933260-30933282 AGGGACACACAGAGGGACGGGGG + Intergenic
1024292999 7:47819203-47819225 CAGAGCACCCAGAGGCAGTGAGG + Intronic
1024294290 7:47830384-47830406 CAGAGCACAGAGAGGGGAAGGGG + Intronic
1028729606 7:94130739-94130761 CAGAGAAGACAGAGGGACAGAGG - Intergenic
1029272590 7:99385838-99385860 CAGAGCACACATGGGGACTCTGG + Intronic
1032016614 7:128384108-128384130 CAGAGCACACAAGGGGAGGGAGG + Intergenic
1032626375 7:133595886-133595908 CAGAGAAGACAGAGGCAAGGTGG - Intronic
1033236784 7:139644435-139644457 CAGAGCACAGCGAGGCATGGGGG - Intronic
1034405865 7:150902105-150902127 CAGGACACACAGAAGGAAGGAGG + Intergenic
1034827067 7:154275292-154275314 GAGGGGACACAGAGGGAAGGAGG - Intronic
1035014735 7:155755285-155755307 CAGGACACACAGAAGGACAGGGG - Intronic
1035582072 8:746800-746822 CAGAGCAGACAGAGGGAACCTGG - Intergenic
1035751237 8:1997848-1997870 AAGGGCACGCAGGGGGACGGCGG + Intronic
1037316695 8:17605958-17605980 CAGACAACACAAAGGGAGGGTGG + Intronic
1037878040 8:22558408-22558430 CAGAGGACACTGTGGGACAGTGG - Intronic
1039635799 8:39163330-39163352 CAGGGCCCACAAAGGGAAGGAGG + Intronic
1040887959 8:52285649-52285671 CAGAGCCCCCAGAGGGACTCAGG + Intronic
1041457018 8:58072008-58072030 CACAGCAGGCAGAGGGAGGGAGG - Intronic
1041654438 8:60335062-60335084 CAGAGGATGCAGAGGGAAGGGGG + Intergenic
1042021311 8:64373230-64373252 GAGAGAACGCAGAGGGAGGGAGG + Intergenic
1043727454 8:83629110-83629132 TAGAGCTCCCAGAGGGAGGGAGG - Intergenic
1044742327 8:95340987-95341009 CCGACCACCCAGAGGGACTGGGG - Intergenic
1045251097 8:100484146-100484168 CAGAGCCCACACAGGAACTGAGG - Intergenic
1047431016 8:124791748-124791770 CATATGACACAGAGGGACAGAGG - Intergenic
1047940722 8:129825448-129825470 CAGAGGACACAGTGAGAAGGTGG - Intergenic
1047971518 8:130088471-130088493 CTGAGAACACAGAGAGGCGGCGG + Intronic
1049288125 8:141787571-141787593 CAGAGAACAGAGAGGGAGGGAGG + Intergenic
1049385352 8:142340334-142340356 CAGAGCAGACAGAGGCACATGGG + Intronic
1049410189 8:142470556-142470578 CAGACCACACACAGGGAAGCAGG - Intronic
1052470110 9:28883142-28883164 CAGAGCACAGAGAGTGAAGGAGG - Intergenic
1056814848 9:89793653-89793675 CCAAGCACACAGTGGGACTGCGG - Intergenic
1057500100 9:95590031-95590053 CAGAGAAGACAGAAGGACCGAGG - Intergenic
1058903680 9:109463080-109463102 CACACCACACAGAAGGGCGGGGG + Intronic
1059547854 9:115196835-115196857 CAGGCCACACAGAGTGATGGAGG - Intronic
1060113780 9:120925659-120925681 CAGACCACACAGTGAGACAGTGG + Intronic
1060344648 9:122805624-122805646 CAGAGAACAAAAAGGGAAGGAGG - Intronic
1060494164 9:124105718-124105740 AAGGGGACACAGAGGGAAGGAGG - Intergenic
1060591221 9:124818126-124818148 CAGAGCTCACAGAGGGGAGATGG - Intergenic
1061805599 9:133136029-133136051 CAGACCACAGAGAGGGCCCGGGG + Intronic
1061949212 9:133926842-133926864 CAGAGCACACAGAAGCAGAGAGG + Intronic
1062044421 9:134418466-134418488 CTGGGCCCACAGAGGGACAGAGG - Intronic
1062190370 9:135244942-135244964 CAGAACACACAGAGGCTCTGGGG + Intergenic
1062447275 9:136600225-136600247 CAGAGCAGACAGAGGCTGGGAGG - Intergenic
1062548916 9:137077212-137077234 CAGGGGACGGAGAGGGACGGGGG + Intergenic
1203631183 Un_KI270750v1:73855-73877 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1186053695 X:5626847-5626869 AAGAGCAGACAGAGGGAGGAAGG + Intergenic
1187005038 X:15224469-15224491 CAGTGTCCACAGAGGGACTGTGG + Intergenic
1187231031 X:17423501-17423523 CCGAGCAGACAGAGGGCCAGAGG - Intronic
1187501245 X:19840869-19840891 CACAGCACACAGCTGGAGGGTGG - Intronic
1189356605 X:40314370-40314392 AAGACCACACAGAGAGAAGGAGG - Intergenic
1192495840 X:71616286-71616308 CAGAGCCGGCAGAGGGAGGGAGG + Exonic
1193352268 X:80477370-80477392 CAGTGCATGCAGAGGGACTGTGG + Intergenic
1197745861 X:129932052-129932074 CTGGCCACACACAGGGACGGGGG - Intergenic
1199417243 X:147599502-147599524 CAGGGCAGAGAGAGGGAGGGAGG - Intergenic
1200336290 X:155354247-155354269 CAGAGCTCCCGGAGGGAGGGAGG + Intergenic
1200350180 X:155486980-155487002 CAGAGCTCCCGGAGGGAGGGAGG - Intergenic