ID: 1163817565

View in Genome Browser
Species Human (GRCh38)
Location 19:19476058-19476080
Sequence GTCCCCTCCATGACCAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 160}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163817565_1163817568 0 Left 1163817565 19:19476058-19476080 CCTCCTCTGGTCATGGAGGGGAC 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1163817568 19:19476081-19476103 TCGGATCCCTAACTTTGAAATGG 0: 1
1: 0
2: 1
3: 4
4: 66
1163817565_1163817574 24 Left 1163817565 19:19476058-19476080 CCTCCTCTGGTCATGGAGGGGAC 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1163817574 19:19476105-19476127 GCTTCTCTCTTGGACAGTGCAGG 0: 1
1: 0
2: 3
3: 28
4: 302
1163817565_1163817569 1 Left 1163817565 19:19476058-19476080 CCTCCTCTGGTCATGGAGGGGAC 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1163817569 19:19476082-19476104 CGGATCCCTAACTTTGAAATGGG 0: 1
1: 0
2: 0
3: 3
4: 60
1163817565_1163817570 2 Left 1163817565 19:19476058-19476080 CCTCCTCTGGTCATGGAGGGGAC 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1163817570 19:19476083-19476105 GGATCCCTAACTTTGAAATGGGG 0: 1
1: 0
2: 1
3: 16
4: 145
1163817565_1163817573 14 Left 1163817565 19:19476058-19476080 CCTCCTCTGGTCATGGAGGGGAC 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1163817573 19:19476095-19476117 TTGAAATGGGGCTTCTCTCTTGG 0: 1
1: 0
2: 1
3: 22
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163817565 Original CRISPR GTCCCCTCCATGACCAGAGG AGG (reversed) Intronic
900265060 1:1753231-1753253 GTCCCCTCCAGGACCTGGGATGG - Intronic
901208258 1:7509720-7509742 GTCCCTTCCATGCCCCCAGGTGG + Intronic
902108469 1:14058071-14058093 GCCCCCTCCATGCCCAGGTGGGG + Intergenic
902479623 1:16704728-16704750 GTCCCCTCCCGGTGCAGAGGGGG + Intergenic
902544564 1:17181904-17181926 GTCTCCTCCAGAAACAGAGGTGG - Intergenic
903058108 1:20650661-20650683 CTGCCCTCCATGAGCAGAGGAGG - Exonic
903852832 1:26318473-26318495 GTCACCTCCATAACCACAGCAGG - Intronic
905270174 1:36782423-36782445 GCCCCCTCACTGAGCAGAGGGGG + Intergenic
905846890 1:41241581-41241603 GTCCCCTCCGGCGCCAGAGGTGG - Intronic
906066447 1:42984596-42984618 GTCCCTTCCATGGCCCCAGGAGG + Intergenic
908253990 1:62287426-62287448 GTGCCTTCCAAGACCAGAGCAGG + Intronic
911438067 1:97887764-97887786 GTCCCTCCCATGACCACATGGGG - Intronic
916454234 1:164953983-164954005 GTCCCCTCCATAGCCAGCAGGGG - Intergenic
916683685 1:167126255-167126277 CTCCCCACCCTGGCCAGAGGAGG - Exonic
919795115 1:201316916-201316938 GTCTCTTCCATGACCAATGGAGG - Intronic
922186968 1:223284252-223284274 GTCCCCTGCATGAACAGATTTGG + Intronic
922574203 1:226651467-226651489 GTCCCCTCCTTGAACACAGAGGG - Intronic
924560933 1:245156035-245156057 GTCCCCTTCCTGACCCCAGGAGG + Intronic
1063954791 10:11255915-11255937 GTCTCCTCCAAGTTCAGAGGAGG - Intronic
1067432805 10:46255007-46255029 GTGATGTCCATGACCAGAGGAGG + Intergenic
1067440459 10:46306478-46306500 GTGATGTCCATGACCAGAGGAGG - Intronic
1068620090 10:59173030-59173052 GTCACCTCAGAGACCAGAGGAGG - Intergenic
1069731976 10:70622903-70622925 ACCCCCTCCAAGATCAGAGGAGG - Intergenic
1072662968 10:97373732-97373754 GTCCCCTCCTTCTCCAGATGTGG - Exonic
1073449351 10:103600482-103600504 GTCCCCACTATGGGCAGAGGGGG - Exonic
1076504405 10:130962424-130962446 CTCTCCTCCAAGACCAGCGGGGG - Intergenic
1076714692 10:132357810-132357832 GTCCCCTCCCTGCTCAGAGCAGG - Intronic
1079773845 11:24497973-24497995 GTCCCATCCATGGCCAGTGATGG - Intronic
1080041523 11:27764209-27764231 ATTCCCTCCATGTCCAGAGCAGG + Intergenic
1080848307 11:36045615-36045637 GTCCCACCCATGACCACATGAGG - Intronic
1083545303 11:63545085-63545107 GGCCTCTCCATGTGCAGAGGAGG + Intronic
1084606195 11:70173550-70173572 CAGCCCTCCATGGCCAGAGGTGG + Intronic
1087176336 11:95099469-95099491 CTCCGCTCCTTGAGCAGAGGTGG + Intronic
1091792392 12:3279317-3279339 ATCCTCTGCATGACCAGAGATGG + Intronic
1094580908 12:31733234-31733256 TTGCCCTCCAGGACCAGAAGAGG - Intergenic
1103507401 12:121450994-121451016 GTCAACTCCATGCCCAGAAGTGG - Intronic
1104217408 12:126747725-126747747 TTCCCCTCCATGGCCAGCAGGGG - Intergenic
1104814257 12:131637004-131637026 GTCCTGTCCAGGCCCAGAGGGGG - Intergenic
1104947435 12:132422411-132422433 TCCCACTCCATGACCAGGGGCGG + Intergenic
1105427352 13:20305732-20305754 GTGCCATCCTTGACCAGTGGGGG - Intergenic
1108507372 13:51124627-51124649 GTGGCCCCCATGACCTGAGGAGG - Intergenic
1112626074 13:101105858-101105880 GCCCCCTCCTTCAACAGAGGAGG - Intronic
1122792956 14:104192188-104192210 GGCCCCTCCATGTCCAGGCGTGG + Intergenic
1123826098 15:24083802-24083824 GCCCCTTCCATGATCAGAGTAGG + Intergenic
1124097806 15:26665562-26665584 TTCCCATGCATGACAAGAGGAGG + Intronic
1125773634 15:42190440-42190462 GTCCCCTGCATGTCCAGAAAAGG + Intronic
1129323880 15:74789460-74789482 GTCCTCTGCAGAACCAGAGGTGG + Intronic
1129596772 15:76971007-76971029 GTCCCATCTTTGGCCAGAGGGGG - Intergenic
1129684602 15:77677891-77677913 GCACCCACCATGCCCAGAGGAGG + Intronic
1132731301 16:1363586-1363608 GTGCCCGCCATGGCCACAGGGGG + Exonic
1132770489 16:1559652-1559674 GTCCCAGCCATGACCACAGCTGG + Intronic
1136282228 16:29220625-29220647 GTCCCCTCTGGGAGCAGAGGCGG - Intergenic
1137368005 16:47877473-47877495 GGCGCCTCCTTGACCAGATGAGG - Intergenic
1139373082 16:66480414-66480436 CTTCCCTCCATCTCCAGAGGGGG - Intronic
1139582109 16:67879955-67879977 GACCCCTCCTTGACCAGGTGAGG + Exonic
1140036567 16:71375878-71375900 GTCCCCTCCTTGCCCAAAGAGGG - Intronic
1140342440 16:74177644-74177666 GTCCCATCTTTGACCAGTGGGGG - Intergenic
1141891683 16:86930411-86930433 CTCCCCACCCAGACCAGAGGCGG - Intergenic
1142086600 16:88186543-88186565 GTCCCCTCTGGGAGCAGAGGCGG - Intergenic
1142240958 16:88944830-88944852 GTGCCCTCCGTGACCCTAGGAGG + Intronic
1142280810 16:89146646-89146668 TTCCCCTCCATGTCCAGGGCAGG + Intronic
1142889875 17:2936331-2936353 ATCCTCTCCATGGCCAGGGGAGG - Intronic
1145768643 17:27476810-27476832 GTCCCCTCCATGACAGGAAAGGG + Intronic
1148680255 17:49469774-49469796 GTCCCCTCCTCTAGCAGAGGAGG - Intronic
1149543448 17:57485833-57485855 CTCCCCTCCACGGCCAGAGCAGG - Intronic
1149665262 17:58360742-58360764 TTCACCTCCATGACCAGACTGGG - Intronic
1151355000 17:73553131-73553153 GCCACCTCCATGCCCAGAGTGGG - Intronic
1151682900 17:75631062-75631084 GTCCCATCCAGCACCAGAGAAGG + Intronic
1152212291 17:79009126-79009148 GTCCCCACACTAACCAGAGGGGG + Intronic
1152565413 17:81098077-81098099 GGCCCCTCCATGACCCCAGCTGG - Intronic
1155416518 18:25605122-25605144 GGCCCCACCATGAACAGAAGGGG + Intergenic
1157483190 18:48069048-48069070 ATACCCTCCAGGAGCAGAGGCGG - Intronic
1158554650 18:58465436-58465458 CTCCTGTCCATCACCAGAGGAGG - Intergenic
1160352410 18:78194917-78194939 GTAGCCTTCATGAACAGAGGAGG - Intergenic
1161152457 19:2716878-2716900 GTTCCCACCAGGACCAGAGGAGG - Exonic
1163817565 19:19476058-19476080 GTCCCCTCCATGACCAGAGGAGG - Intronic
1164558213 19:29269682-29269704 TTCCCCTCCAAGTCCAGAGAAGG + Intergenic
1165013533 19:32865004-32865026 GTCACCCCCATGGACAGAGGAGG + Intronic
1167322881 19:48807234-48807256 GTCCCCTCCCTGCCCTGACGAGG + Intronic
1167749400 19:51370799-51370821 CTCCCCTCCATGTCTACAGGGGG + Intergenic
1168061202 19:53893202-53893224 GTCCCCTAGAAGAGCAGAGGAGG - Intronic
1202713659 1_KI270714v1_random:30634-30656 GTCCCCTCCCGGTGCAGAGGGGG + Intergenic
925911192 2:8574635-8574657 GTCCTCTCCAGAACCTGAGGTGG - Intergenic
926235471 2:11039891-11039913 GCCTCCTCCATGATCAGGGGAGG + Intergenic
927308272 2:21598701-21598723 TTCACCTCAATGACCAAAGGAGG - Intergenic
929449174 2:42025305-42025327 GTTCCCTCCAGGGCTAGAGGAGG - Intergenic
941896847 2:170637572-170637594 ATGCCCTCCCTGACCTGAGGAGG - Intronic
944534326 2:200694804-200694826 GTCGCATCCATGACCTGGGGAGG - Intergenic
945689149 2:213010685-213010707 GTTCTCTCCATTACCAAAGGGGG - Intronic
947810215 2:232999441-232999463 GTCACCAGCATGTCCAGAGGGGG - Intronic
947966814 2:234289084-234289106 GTTCCCTCTGTGACCAGAAGAGG + Intergenic
948081909 2:235213751-235213773 GTCCCCTCCATGACATCAGGGGG - Intergenic
948139088 2:235659843-235659865 GACCCTCCCAGGACCAGAGGTGG - Intronic
948750918 2:240132474-240132496 GTCCCCTCCCTGACCGGCCGTGG + Intronic
1169247670 20:4036557-4036579 GTCCTCTCCAAGCCCTGAGGGGG - Intergenic
1171418221 20:24998229-24998251 GTCACCTCCATAGCCAGGGGTGG + Intergenic
1172881120 20:38200673-38200695 GTCACCCCCATTTCCAGAGGAGG + Intergenic
1173571723 20:44081524-44081546 CTCCCCTCCCTGACAGGAGGAGG + Intergenic
1175981508 20:62741065-62741087 GTGCCCTCCAGGACAGGAGGAGG - Intronic
1176084900 20:63291420-63291442 GTCCTGGCCATGGCCAGAGGAGG - Intergenic
1178328570 21:31665471-31665493 ATCACCTCCCAGACCAGAGGCGG - Intronic
1178640725 21:34343039-34343061 GTGACCACAATGACCAGAGGAGG + Intergenic
1179088860 21:38245059-38245081 GACACCTCCATGACCACAGAAGG + Intronic
1181018934 22:20088132-20088154 GTCCCCTCAATGGCCCAAGGAGG - Intronic
1182413142 22:30204116-30204138 GTCTCCTCCATGACAAGGAGGGG + Intergenic
1183380931 22:37490162-37490184 TGCCCCTGAATGACCAGAGGAGG - Intergenic
1183587564 22:38761557-38761579 CTCCCCTCCATGTCCAGGAGAGG + Intronic
1184454023 22:44599053-44599075 GTCTCCCCCATGGCCAGGGGTGG - Intergenic
1185359031 22:50394101-50394123 TTCTCCTCCATGTCCAGGGGCGG - Exonic
952460398 3:33519058-33519080 GTCCTCACCATGACCCTAGGAGG - Intronic
952980163 3:38727800-38727822 GACCCCACCATGACCAGAGTGGG + Intronic
957262517 3:77920194-77920216 CTGCCATTCATGACCAGAGGAGG - Intergenic
960986851 3:123286443-123286465 GTCCCTTCCATGCCCAGTAGAGG + Intronic
961174346 3:124821520-124821542 GTGCCCTGCATGACCAGGGCAGG - Intronic
962304108 3:134270643-134270665 GTATCCACCATGACCAGAGTTGG + Intergenic
968949927 4:3685237-3685259 GGCCCCTCCATCACGAGAAGGGG + Intergenic
968976495 4:3824801-3824823 GGCTCCTCCATCACCAGCGGTGG + Intergenic
969288230 4:6221863-6221885 GTGCCCTCAGTGGCCAGAGGTGG - Intergenic
970494142 4:16608775-16608797 ATCACCTCCAGGACGAGAGGAGG + Intronic
970928448 4:21481402-21481424 GACCCTTCCAGGACCAGAGAGGG + Intronic
977958041 4:103052989-103053011 CTTTCCTCCATGACCAGGGGAGG - Intronic
979878845 4:125928854-125928876 GTGCCCTCCCTAGCCAGAGGTGG + Intergenic
983304203 4:165965614-165965636 GTACCCTACATGATCAGAGGAGG + Intronic
984858623 4:184217543-184217565 CTCCCCTCCCTGCCCAGAAGAGG + Intronic
985997053 5:3602854-3602876 GTCCTCTCCCTGCCCCGAGGCGG + Intergenic
987828541 5:23064618-23064640 GTCCCCTCCATGCCAAGAATAGG + Intergenic
988346166 5:30040679-30040701 GTTCCCTCCATGACTCCAGGTGG + Intergenic
989992853 5:50788877-50788899 GTCCCTAACATGACCAGTGGAGG + Intronic
993867357 5:93211264-93211286 GCTCCCTCCATGACCAGATGAGG - Intergenic
994497646 5:100534362-100534384 TTCTCCTCCATGACAGGAGGTGG + Intergenic
995028699 5:107454951-107454973 CTCCATTCCATGAACAGAGGTGG + Intronic
997740793 5:136251937-136251959 GTTCCCTCCATGACCTCATGCGG - Intronic
998133695 5:139663822-139663844 GTCCTCTCCAGGACCTGACGAGG + Intronic
998625634 5:143842688-143842710 GTCTCCTCACTGACCAGAAGTGG + Intergenic
1002389251 5:178896297-178896319 GGCCCCTCCCTGACCCGTGGTGG - Intronic
1003088534 6:3081497-3081519 TTCCCCTGCATTTCCAGAGGAGG - Intronic
1006509878 6:34515936-34515958 GCCCCCTCCCTGCCCAGAGTTGG - Intronic
1006572492 6:35017461-35017483 GTCCACTCCAAGACCACAGGCGG + Exonic
1007078041 6:39080290-39080312 GTCTCCTTCATGAACAGATGGGG + Intronic
1007094345 6:39204109-39204131 GTCTCCTCGAAGACCAGAGCTGG + Intronic
1008227212 6:48935924-48935946 GTCCCCAGCATGTCCAGAAGAGG + Intergenic
1009936454 6:70240197-70240219 GTGACCTCCATCTCCAGAGGAGG - Intronic
1011530729 6:88318159-88318181 GTCACCTCCATCATCAGATGAGG + Intergenic
1011771406 6:90677596-90677618 GTGCCCTCCATCACCATGGGAGG - Intergenic
1018078835 6:160241069-160241091 AACTCCTCCATGCCCAGAGGTGG - Intronic
1018791997 6:167155753-167155775 GTCACCACCATGCCCAGAGGAGG - Intronic
1021018423 7:15564892-15564914 GTGCCTTACATGACCAGAGCAGG - Intergenic
1023648907 7:42348222-42348244 GTCCCCTGGATGACCTGATGAGG + Intergenic
1024095731 7:45981043-45981065 GTCCCTTCCAGGACCAGTGCTGG + Intergenic
1024533518 7:50411513-50411535 AACTCCTCCATGACCAAAGGGGG - Intergenic
1025851890 7:65250967-65250989 GAACCCTCCATCACCAGAGACGG + Intergenic
1026994326 7:74606022-74606044 GTCCCATCCATGCCCAGAGCTGG + Intergenic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1029675350 7:102064781-102064803 GTCCCCTCCTCGTGCAGAGGAGG + Intronic
1038287016 8:26214244-26214266 GGCCCCTGCAGGACAAGAGGAGG - Intergenic
1038425070 8:27459623-27459645 GTCCCCTCCATGGCCACATGAGG + Intergenic
1038658061 8:29472350-29472372 GTCCCCTCAATCCTCAGAGGAGG + Intergenic
1038679806 8:29656247-29656269 GTCCCCTCCTTGCCCAGAGCAGG - Intergenic
1043295879 8:78663303-78663325 CTTCCTTCCATGACCAGAAGAGG - Intergenic
1047919109 8:129614966-129614988 ATCCCCACCATGACCAGATAAGG - Intergenic
1049210701 8:141385182-141385204 GTCCCCACCAGGCCCAGAAGAGG - Intergenic
1053531524 9:38886841-38886863 ATCCCCTACAGGACTAGAGGAGG + Intergenic
1054203748 9:62111269-62111291 ATCCCCTACAGGACTAGAGGAGG + Intergenic
1054634614 9:67477096-67477118 ATCCCCTACAGGACTAGAGGAGG - Intergenic
1056271836 9:84954745-84954767 GTCCCCACCAGCACCAGAGCTGG - Intronic
1056941913 9:90963087-90963109 GTCCCTCCCATGACAAGTGGGGG - Intergenic
1057312477 9:93951006-93951028 GTGCCCTCACTGCCCAGAGGTGG + Intergenic
1057867562 9:98693354-98693376 GGCCCCTCCATGTCCTCAGGTGG + Intronic
1061870776 9:133519161-133519183 GACCCCTCCATGACCAGGCTGGG - Intronic
1188745110 X:33831649-33831671 CTCCCCTCCTTCACCAGATGAGG + Intergenic
1191101060 X:56729257-56729279 GTCCCCTCCAGGCACAGAGCTGG - Intergenic
1194776754 X:97974541-97974563 TTCCTCTCCATGAGAAGAGGGGG - Intergenic