ID: 1163817851

View in Genome Browser
Species Human (GRCh38)
Location 19:19477803-19477825
Sequence GCCCCTAGACTGCTGGTCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163817851_1163817856 17 Left 1163817851 19:19477803-19477825 CCGGAGACCAGCAGTCTAGGGGC 0: 1
1: 0
2: 2
3: 19
4: 121
Right 1163817856 19:19477843-19477865 AGAATAGCGTCCTCACACTGAGG 0: 1
1: 0
2: 0
3: 7
4: 82
1163817851_1163817858 24 Left 1163817851 19:19477803-19477825 CCGGAGACCAGCAGTCTAGGGGC 0: 1
1: 0
2: 2
3: 19
4: 121
Right 1163817858 19:19477850-19477872 CGTCCTCACACTGAGGTCCTGGG 0: 1
1: 0
2: 1
3: 12
4: 130
1163817851_1163817857 23 Left 1163817851 19:19477803-19477825 CCGGAGACCAGCAGTCTAGGGGC 0: 1
1: 0
2: 2
3: 19
4: 121
Right 1163817857 19:19477849-19477871 GCGTCCTCACACTGAGGTCCTGG 0: 1
1: 0
2: 1
3: 5
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163817851 Original CRISPR GCCCCTAGACTGCTGGTCTC CGG (reversed) Intronic
902196535 1:14802596-14802618 GCCCCGAGACGGCTGCGCTCTGG - Intronic
903499318 1:23792865-23792887 ACCCCGAGCCTGCTGGCCTCAGG - Intronic
905272553 1:36796410-36796432 GCTCCCTGACAGCTGGTCTCTGG + Exonic
907412382 1:54291939-54291961 GCCCCTGGAAGGCTGCTCTCGGG + Intronic
910255631 1:85244539-85244561 GCCCCTAGACTGGGGGTGTTGGG + Intergenic
915080679 1:153349713-153349735 GTCCCTACAGTGCTGGTCCCAGG - Intergenic
921350265 1:214227508-214227530 GCCCCCCAACTGCTGGGCTCAGG + Intergenic
924642923 1:245850790-245850812 TCCCCTGGACTGCTGGCTTCTGG + Intronic
1066202399 10:33154388-33154410 GAGCCTTGACTGCTGGGCTCTGG + Intergenic
1066978490 10:42390525-42390547 GCCCCTATACTGCTTATTTCAGG - Intergenic
1067060337 10:43075087-43075109 GCCCAGAGCCTGCTGGCCTCAGG - Intergenic
1072904763 10:99442572-99442594 GGCGCTATACTGCTGGTCTGAGG - Intergenic
1073098362 10:100994332-100994354 GCCTCAAGACTGCTGGAGTCAGG + Exonic
1075576653 10:123582635-123582657 GGCCCTAGTCTGCTGCTCTCAGG + Intergenic
1077992641 11:7425623-7425645 CCCCCAAGACTGCAGGTCTTTGG + Intronic
1078641996 11:13105319-13105341 GCTCCTATCCAGCTGGTCTCTGG + Intergenic
1079635421 11:22733058-22733080 ATGCCTATACTGCTGGTCTCTGG + Intronic
1083893337 11:65607802-65607824 GCCCCTAGACTGCTGGGCGCAGG - Exonic
1086924399 11:92624658-92624680 GACCATAGACTGCTGGGCTGTGG + Intronic
1089610614 11:119666601-119666623 GCCACTAGGCTGCGGGTCTAGGG + Intronic
1097806490 12:63970066-63970088 GACCCTGGACTGATGGTCTGGGG - Intronic
1097970328 12:65626562-65626584 GTCCCTATACTCCTGGTCCCAGG + Intergenic
1099471397 12:83053599-83053621 GCCCCTTGATGGCTGGCCTCAGG - Intronic
1101006387 12:100405164-100405186 GTTCCTTGACTGCTGGTCCCAGG + Intronic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1102257424 12:111424469-111424491 TCCCCAAGACTCCTGTTCTCTGG + Intronic
1102482994 12:113236673-113236695 GCCCCCAGCATGCTAGTCTCTGG - Intronic
1102680322 12:114686471-114686493 TCCCCCAGACTGCTCGCCTCCGG + Intergenic
1102738142 12:115181477-115181499 GCTCCTAGGATGCTTGTCTCAGG - Intergenic
1103345618 12:120248188-120248210 GCTGCCAGACTGCTGGTCTGGGG + Intronic
1105822487 13:24091904-24091926 GCTGCTAGGCTGCTGTTCTCAGG + Intronic
1108692256 13:52870112-52870134 GTCCCCAAACTTCTGGTCTCTGG - Intergenic
1110366625 13:74694019-74694041 GTGCCTAGGCTGCTGGTCTCAGG - Intergenic
1111602564 13:90493748-90493770 GCCCCTAGACTACTAGTCTCTGG - Intergenic
1113769606 13:112899654-112899676 GCCCCAAGACTCCTGGCCCCAGG + Intronic
1121690982 14:95876910-95876932 GCGCGCAGCCTGCTGGTCTCTGG - Intergenic
1124704977 15:31956208-31956230 GCCCCTAACCTGCAGGCCTCGGG + Intergenic
1129221694 15:74135039-74135061 AGCCCTAGACTGCTGCTCCCAGG - Exonic
1129749572 15:78052049-78052071 GAGCCTAGACTGCTGGTCTTGGG - Intronic
1132937725 16:2490007-2490029 GCACCTACTCTGCTGGTGTCTGG + Intronic
1135559759 16:23467143-23467165 GCTCCCAGGCTGCTGTTCTCAGG - Exonic
1135625074 16:23987730-23987752 ACCTCTAGACTGCGGGTTTCTGG - Intronic
1136157044 16:28390046-28390068 GCTCCCAGGTTGCTGGTCTCAGG - Intronic
1136206042 16:28725235-28725257 GCTCCCAGGTTGCTGGTCTCAGG + Intronic
1136901890 16:34049514-34049536 ATCCCTAGGCTGCTGGTTTCAGG - Intergenic
1137979173 16:53055221-53055243 GCTCCGAGGCTGCGGGTCTCTGG - Intronic
1138624026 16:58235055-58235077 GCCTCCAGACTTCTGGCCTCCGG + Intronic
1140045190 16:71436105-71436127 GCCCCCAGAATGCTGGTCTGGGG + Intergenic
1141445213 16:84053498-84053520 GCCCCTAGGCTGCTGGCGGCCGG - Intergenic
1142408597 16:89904788-89904810 GCCCCTGGGCTGCTGGCCTGAGG - Intronic
1143904759 17:10199216-10199238 GCCACCAGGCTGCTGGGCTCAGG - Intergenic
1145270855 17:21404242-21404264 GCACCAAGACTGCAGGACTCTGG + Intronic
1145277265 17:21439490-21439512 GCCTCCAGCCTGCTGGTCTCAGG - Intergenic
1145309061 17:21691629-21691651 GCACCAAGACTGCAGGACTCTGG + Intergenic
1145315101 17:21725384-21725406 GCCTCCAGCCTGCTGGTCTCAGG - Intergenic
1145713535 17:26997321-26997343 GCCTCCAGCCTGCTGGTCTCAGG - Intergenic
1145868390 17:28255272-28255294 GCCCCTGTCCTGCTGCTCTCTGG - Intergenic
1147923696 17:43933916-43933938 GCCCCTGGCCTGCTGCCCTCTGG + Intergenic
1148341191 17:46874497-46874519 GCCCCTGGCCTGCTGCCCTCTGG + Intronic
1152434892 17:80270378-80270400 GCCACTAGCCTGCTGGCTTCAGG + Intronic
1152497874 17:80687136-80687158 GCGCCTACACTGCAGGCCTCTGG + Intronic
1152735351 17:81994545-81994567 GCCCCGAGACTGGAGGTCTCGGG + Intronic
1153489493 18:5632118-5632140 GCCACTAGACTGCTGTCTTCAGG - Intergenic
1154008354 18:10554784-10554806 GCCCCATGTCTGCTGCTCTCAGG + Intergenic
1159950707 18:74480661-74480683 GACCTCAGACTTCTGGTCTCTGG + Intergenic
1161342681 19:3751644-3751666 GCCCCTGGACTCCAGGTCTCTGG - Intronic
1161649194 19:5473913-5473935 GCACCTAGCCAGCTGGGCTCGGG - Intergenic
1163275827 19:16283639-16283661 GCCCCGAGACTGCGCGGCTCCGG - Intergenic
1163669748 19:18620592-18620614 GCCCTTGGACTCCTGGGCTCAGG - Exonic
1163817851 19:19477803-19477825 GCCCCTAGACTGCTGGTCTCCGG - Intronic
1165445097 19:35852407-35852429 GCTCCTGGCCTGCTGGACTCTGG - Intronic
1166569579 19:43785061-43785083 GGGCCTGGACTGCTGGTCTGAGG + Intergenic
1168078000 19:53991260-53991282 GACCCAAGACTCCTGGCCTCAGG + Intergenic
929054149 2:37861803-37861825 GGACCTAGACTGCTGGACTAAGG - Intergenic
929906582 2:46051273-46051295 GCCCCTGGGCTGGTGGTTTCTGG + Intronic
932559485 2:72854910-72854932 GCCCCTACACCCCTTGTCTCAGG + Intergenic
937717297 2:125047560-125047582 GGCCCTTGAATGATGGTCTCTGG - Intergenic
938029246 2:127978112-127978134 GCCCTTGGACTGCTGTTCTCCGG - Intronic
938702003 2:133887873-133887895 GCTCCTAGACTCCTTGTCTAAGG - Intergenic
941113157 2:161440083-161440105 GTCCCTGGACTTCTGGTCACTGG + Intronic
947973478 2:234344226-234344248 TCCTCTGGACTGCTGCTCTCTGG + Intergenic
1169411536 20:5374621-5374643 GCCCCTAGACCTCTGATTTCTGG - Intergenic
1171222155 20:23408293-23408315 GCCACTAGACTGATGCTCTGGGG + Intronic
1174000475 20:47370962-47370984 GCCCCTGCACTGCAGCTCTCTGG - Intergenic
1178990734 21:37353850-37353872 GCCCCAAGAATACTCGTCTCCGG - Intergenic
1181437344 22:22918500-22918522 GCCCCTGCTCTGCTGGTCTTTGG - Intergenic
1183358402 22:37371341-37371363 GGCCCTAGACTGGGGGTCTCTGG + Exonic
1183463327 22:37966394-37966416 GCCCCCTGACTGCTGGCCTCAGG + Intronic
1184762340 22:46551638-46551660 GCCCCTAGCCTCCAGCTCTCTGG + Intergenic
954995784 3:54880405-54880427 GCCCCTAGACTTTGGGACTCGGG - Intronic
955042740 3:55333045-55333067 ACCCCTGGACTCCAGGTCTCAGG + Intergenic
955146681 3:56326768-56326790 GCCTCTAGCCTGCTGCTCCCTGG - Intronic
956290487 3:67654881-67654903 GCCCCAAGACCGCAGGGCTCGGG - Intergenic
962888599 3:139651705-139651727 ATCCCTAGACTCCTGGTCTCAGG + Intronic
962985466 3:140531955-140531977 AACCCAAGACTCCTGGTCTCAGG - Intronic
965554102 3:170001929-170001951 GACCGTAGACTGCTTTTCTCAGG + Intergenic
969244202 4:5922018-5922040 GCCCCCAGTATGCTGGTTTCTGG + Intronic
969286262 4:6204281-6204303 GCCCATAGACTCCTGGTGCCAGG + Intergenic
969369748 4:6724122-6724144 GTCCCTGGACTTCTCGTCTCTGG + Intergenic
969444627 4:7237381-7237403 CCCTCTTGGCTGCTGGTCTCAGG + Intronic
969705139 4:8787615-8787637 GCCTCTTTACTGCTGGTCCCTGG - Intergenic
976777834 4:88725365-88725387 GTTCCAAGACTGCTGGTCTTGGG + Intergenic
978482020 4:109203550-109203572 CCCTCTGGACTGGTGGTCTCTGG - Intronic
981525762 4:145705685-145705707 ACCCCTAGACTGCTCATCACTGG - Intronic
984653237 4:182291209-182291231 GCCCCGAGCTGGCTGGTCTCCGG + Intronic
989507605 5:42245482-42245504 GCCACTAGATGGGTGGTCTCTGG + Intergenic
991185650 5:63803682-63803704 GCCTATAGCCTTCTGGTCTCTGG - Intergenic
991725372 5:69530566-69530588 GCCTCTAGACTGTTGGAGTCTGG + Intronic
992212358 5:74493280-74493302 GCCGCTAGATGGCTGGTCACAGG - Intergenic
995815763 5:116166374-116166396 TCCCCTAGAGTGCTTGTCTATGG - Intronic
995828217 5:116325258-116325280 GCCTCCAGACTTCTGGTTTCTGG + Intronic
997401503 5:133606930-133606952 GCACCAAGACTGCTGGTTTCTGG + Intronic
1001485346 5:172115843-172115865 GCCCCCAGCCTGCTGGTAGCAGG + Intronic
1002100753 5:176856389-176856411 GCCCCTTCACTCCTGGTCTGTGG - Intronic
1007410793 6:41660199-41660221 GCTCCTAGCCTGCTGGGCTGTGG + Intergenic
1011864422 6:91805677-91805699 GCCTCTAGTCTGCTGGTCTTTGG - Intergenic
1012510728 6:99998583-99998605 GCCCCTAGCTGGCTGGTCTATGG + Intergenic
1013460115 6:110366656-110366678 GCCCCTGGCCTTCTGTTCTCTGG - Intergenic
1017772907 6:157656871-157656893 GCCTCTTCACTGCTGGCCTCAGG + Intronic
1019626948 7:2020600-2020622 GCCCCTAGACTCCGGGTACCAGG - Intronic
1029646664 7:101861189-101861211 GCCCCGTGTCTGCTGGTCGCAGG + Intronic
1034131615 7:148723322-148723344 GGCCCTACACAGCTGATCTCTGG - Intronic
1034411965 7:150946647-150946669 GCCCCTAGACAGCTGGGTGCAGG - Intronic
1035175193 7:157045337-157045359 GCCCCTAGCCTGCTGGTGAGGGG - Intergenic
1035574869 8:697883-697905 GTCCCTACACTCCTCGTCTCAGG - Intronic
1035777247 8:2197865-2197887 GCCCATTGACTGCAGGTCTCAGG - Intergenic
1042386959 8:68187872-68187894 GCCTCTGGCCTGCTGGACTCTGG + Intronic
1046624463 8:116562069-116562091 GCCACTGGATTCCTGGTCTCAGG + Intergenic
1047254513 8:123205734-123205756 GCCTCTAGCCTGCTGCTCTCGGG + Intronic
1047699380 8:127434129-127434151 GCCCCTAGAACGCTGGTCCAAGG + Intergenic
1049993990 9:1017484-1017506 GCCCCTGGACTGCTGATCCCTGG + Intergenic
1052797836 9:32940286-32940308 ACCCCCAGACTGCGGGTCTGTGG + Intergenic
1056790778 9:89624058-89624080 GCCCCCAGCCAGCTGGTCTGCGG + Intergenic
1057950684 9:99366952-99366974 GCTGCTAGACTCCTGGGCTCAGG + Intergenic
1059560842 9:115333323-115333345 GCCCCTACTCTCCTGGTCACTGG - Intronic
1061199808 9:129131288-129131310 GCCCCTAGACTCCTGTGCCCTGG + Intronic
1062159667 9:135073430-135073452 GTCCATATACTGCAGGTCTCGGG - Intergenic
1186452656 X:9686339-9686361 GCCCCTAGAGTGCTGGAATCTGG - Intronic
1188560498 X:31462666-31462688 GCACCTAGACCCCTGTTCTCAGG + Intronic
1188572741 X:31608683-31608705 CCATCTAGGCTGCTGGTCTCAGG - Intronic
1190257860 X:48777307-48777329 GCCCCTGGTCTTCTGGACTCTGG + Intergenic
1190594306 X:52037705-52037727 TCCACTTGGCTGCTGGTCTCTGG - Intergenic
1202044562 Y:20725554-20725576 GCCCTCAGACTGCTGGAATCTGG - Intergenic