ID: 1163819988

View in Genome Browser
Species Human (GRCh38)
Location 19:19490935-19490957
Sequence CTCCATTTGCTGACGGCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 87}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163819988_1163819992 -10 Left 1163819988 19:19490935-19490957 CCTTGTGCCGTCAGCAAATGGAG 0: 1
1: 0
2: 1
3: 4
4: 87
Right 1163819992 19:19490948-19490970 GCAAATGGAGCTGCTTGGTTGGG 0: 1
1: 0
2: 0
3: 11
4: 129
1163819988_1163819996 21 Left 1163819988 19:19490935-19490957 CCTTGTGCCGTCAGCAAATGGAG 0: 1
1: 0
2: 1
3: 4
4: 87
Right 1163819996 19:19490979-19491001 GCCATCTTTGGGACTTGCGTTGG 0: 1
1: 0
2: 0
3: 11
4: 187
1163819988_1163819993 -9 Left 1163819988 19:19490935-19490957 CCTTGTGCCGTCAGCAAATGGAG 0: 1
1: 0
2: 1
3: 4
4: 87
Right 1163819993 19:19490949-19490971 CAAATGGAGCTGCTTGGTTGGGG 0: 1
1: 0
2: 1
3: 11
4: 154
1163819988_1163819994 9 Left 1163819988 19:19490935-19490957 CCTTGTGCCGTCAGCAAATGGAG 0: 1
1: 0
2: 1
3: 4
4: 87
Right 1163819994 19:19490967-19490989 TGGGGACAAAGTGCCATCTTTGG 0: 1
1: 1
2: 3
3: 14
4: 164
1163819988_1163819995 10 Left 1163819988 19:19490935-19490957 CCTTGTGCCGTCAGCAAATGGAG 0: 1
1: 0
2: 1
3: 4
4: 87
Right 1163819995 19:19490968-19490990 GGGGACAAAGTGCCATCTTTGGG 0: 1
1: 0
2: 3
3: 7
4: 151
1163819988_1163819998 22 Left 1163819988 19:19490935-19490957 CCTTGTGCCGTCAGCAAATGGAG 0: 1
1: 0
2: 1
3: 4
4: 87
Right 1163819998 19:19490980-19491002 CCATCTTTGGGACTTGCGTTGGG 0: 1
1: 0
2: 1
3: 5
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163819988 Original CRISPR CTCCATTTGCTGACGGCACA AGG (reversed) Intronic
900689893 1:3974138-3974160 CCCCATCTGCTCACTGCACACGG - Intergenic
902827388 1:18986032-18986054 CCCCATTTGCGGAAGGCATATGG + Intergenic
903259872 1:22125729-22125751 CTCCATTTGTAGACAGCACCGGG - Intronic
909803787 1:79848853-79848875 CAGCATTTGCTGAAGGCATATGG + Intergenic
913420155 1:118658054-118658076 AGCAATTTGCTGATGGCACATGG - Intergenic
919288670 1:195600112-195600134 CTCCCTTGTCTGACTGCACAAGG + Intergenic
919849873 1:201665411-201665433 CTGCCTTTGCTGAGGGCTCATGG + Intronic
921269359 1:213453395-213453417 CTCCATTTGGTGGCCCCACAAGG - Intergenic
923180372 1:231512290-231512312 CTTCATTTGCAGAGGTCACATGG + Intergenic
1069546899 10:69335203-69335225 CTCCTCTTCCTGACTGCACATGG - Intronic
1069580348 10:69561669-69561691 CTCCAGTTGCTGACAGCCCCTGG - Intergenic
1070783264 10:79149469-79149491 CTCCAGTTCCTGAGGCCACAGGG + Intronic
1076912501 10:133398678-133398700 CTCCCTGTACTGAGGGCACAAGG + Intronic
1080605512 11:33861855-33861877 CTCCATTTGCTCAGGTCACCTGG - Intronic
1084517307 11:69643818-69643840 CTCCATTTGCTGCGAACACAGGG - Exonic
1084729198 11:71062406-71062428 CTCCCTTTGCTGACCCCACCAGG - Intronic
1084893755 11:72250579-72250601 CTTCCTTTCCAGACGGCACAGGG - Intergenic
1085986533 11:81794140-81794162 CTGCTTCTGCTGAGGGCACAGGG - Intergenic
1091770640 12:3148956-3148978 CTCCAGTTGCTGAGGGAAGAGGG + Intronic
1098943864 12:76568351-76568373 GTCTATTTGCTGACTGCAGAAGG - Intergenic
1101748796 12:107565606-107565628 CTCCATCTCCTGACCTCACAAGG + Intronic
1102754408 12:115325539-115325561 ATCCATTTGCTAATGTCACATGG - Intergenic
1104750394 12:131234766-131234788 CTGCATTTGCTGAAGCCACAGGG + Intergenic
1104782326 12:131429696-131429718 CTGCATTTGCTGAAGCCACAGGG - Intergenic
1112562906 13:100529586-100529608 CTCCATTTTCTGAAGGGAAATGG - Intronic
1116073114 14:40074326-40074348 CTTCATATGCTGAGGGGACATGG - Intergenic
1122588377 14:102826913-102826935 CTCCATTTGCCCAAGGCACATGG - Intronic
1122789272 14:104177489-104177511 CTCCACTGGCTGACAGCTCATGG - Exonic
1123840520 15:24243025-24243047 CTCCAATTGATAAGGGCACATGG - Intergenic
1132874547 16:2130528-2130550 CTCCTTCTGCTGAGGGCTCATGG + Intronic
1134553491 16:15149361-15149383 CTCCTTCTGCTGAGGGCTCATGG + Intergenic
1134787541 16:16958736-16958758 CTGCATGTGCTGAAGGCAAATGG + Intergenic
1135996964 16:27257494-27257516 CTCCAGTTGCTGATGACCCATGG - Exonic
1147188415 17:38725311-38725333 CTCCCTCTCCTGAGGGCACACGG + Intronic
1147378143 17:40035178-40035200 CTCCAGGCGCTGAAGGCACATGG + Exonic
1152083679 17:78204678-78204700 GTCCACCCGCTGACGGCACAGGG + Exonic
1158324045 18:56295009-56295031 TTCCCTTTGCTGACGGGCCAAGG + Intergenic
1159091936 18:63860011-63860033 CTGCATTTGCTCAAGGCACTAGG + Intergenic
1163819988 19:19490935-19490957 CTCCATTTGCTGACGGCACAAGG - Intronic
1165335646 19:35167926-35167948 ATTCATTTGCTGGCGGGACACGG + Intronic
925574733 2:5349130-5349152 CTCCTTCTGCAGATGGCACATGG - Intergenic
926855800 2:17254639-17254661 CACAATTTGCTGAGGGCACTCGG + Intergenic
926860644 2:17305266-17305288 CCCCATTTTCTGAAGCCACATGG - Intergenic
930778355 2:55197331-55197353 CTACATTTGCTGAAGGCCCTAGG - Intronic
931633524 2:64322310-64322332 CTCCTCCTTCTGACGGCACAGGG - Intergenic
935540588 2:104343681-104343703 CTCTATTTTCTGAGGACACAGGG - Intergenic
938945688 2:136210147-136210169 CCCCACTTGCAGAAGGCACACGG + Intergenic
946623649 2:221587964-221587986 CTCCATTTTCTGAAGACAAAAGG - Intergenic
948256570 2:236573016-236573038 TTCCATTTGCTGGCAGCAGAGGG + Intronic
1171014278 20:21525641-21525663 TTTCACTTGCTGAGGGCACACGG - Intergenic
1171067272 20:22030046-22030068 CTCCATTTGCTGCCTCCACTGGG - Intergenic
1172685326 20:36749566-36749588 CTCAGTTTGCTGACGATACAAGG - Intergenic
1183186211 22:36293006-36293028 CTACAGATGATGACGGCACAGGG + Intronic
1183530010 22:38348241-38348263 CTCCAGATGCTGATGGCACGGGG + Intronic
950131719 3:10551904-10551926 TTCCATTTGCTGAGGGCCCTAGG - Intronic
951144750 3:19213990-19214012 CTCCTATTGCTGACAGCACCTGG + Intronic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
967479234 3:189955326-189955348 TGCCATTTGCTGACAACACAGGG - Intergenic
967688659 3:192447243-192447265 CCCAATTTGCTCAAGGCACAGGG + Intronic
967813598 3:193780939-193780961 CGCCATCTGCTGACGGCACCCGG - Intergenic
969052462 4:4383052-4383074 CTCCATAGGCTGACAGCACTGGG + Intronic
972682830 4:41323543-41323565 TTCCATATGCTTACTGCACATGG + Intergenic
974324770 4:60399173-60399195 CTCCATATGCTCACTGCTCAGGG - Intergenic
983780392 4:171663278-171663300 CTCCCTTTGCTAGCTGCACAAGG - Intergenic
985910139 5:2872898-2872920 CTTCATCTGCTAATGGCACATGG - Intergenic
986606273 5:9526619-9526641 CTTCAGTTGCTGATGGCTCAAGG - Intronic
989664493 5:43838022-43838044 CTCACTTTGCAGAGGGCACAAGG - Intergenic
992422778 5:76623304-76623326 TTCCATTTGCTGCTGACACATGG - Exonic
997417356 5:133739332-133739354 CTCACTTTGATGACAGCACAAGG - Intergenic
1004232046 6:13842470-13842492 CTCCCTTTGCTGATGGCGCTTGG + Intergenic
1005478285 6:26230715-26230737 CACCATTTACTGACAGCAAATGG + Intergenic
1007413534 6:41678892-41678914 CTCCTTTTGCTGAACCCACACGG + Intergenic
1013428345 6:110034644-110034666 GTCCATTTGCTGAAATCACAAGG + Intergenic
1013958627 6:115870480-115870502 CTCCCTTTGCCTACGGGACAGGG + Intergenic
1019809023 7:3150460-3150482 CCCCATTTGCTTATGTCACAGGG + Intronic
1023486829 7:40696487-40696509 TTCCATTTCATGACAGCACAGGG - Intronic
1034955602 7:155332502-155332524 CTTCATTGACTGACTGCACAGGG - Intergenic
1035039441 7:155916826-155916848 CTCCATTTTCTTAGGGCTCATGG + Intergenic
1035706224 8:1677389-1677411 TTCCCTTTGCTGGGGGCACAGGG - Intronic
1037862234 8:22413674-22413696 CTCCATTTTCTGATGGGAAACGG - Intronic
1039238280 8:35526874-35526896 CTCCATCTTCTGCAGGCACACGG + Intronic
1041586736 8:59529330-59529352 CTCCATTTACTGACAGCACAAGG - Intergenic
1046739189 8:117810765-117810787 GTCCATTATCTGAGGGCACAGGG - Intronic
1048200443 8:132369699-132369721 CACCATTTGCTGAGTGCTCATGG - Intronic
1050104930 9:2155684-2155706 CTCCATGTGCTTATGGCATATGG + Intronic
1050625593 9:7500738-7500760 CTCCATTTGCTGCCAACTCATGG - Intergenic
1058240755 9:102555205-102555227 CTCCATTTACAGTAGGCACAAGG + Intergenic
1058625383 9:106928443-106928465 CTGCATTTGTAGACGGCACCTGG - Exonic
1060796338 9:126514986-126515008 CTCCATTTACTGAGAGCTCAGGG - Intergenic
1061503067 9:131014615-131014637 CTGCATTTGCCCACTGCACAGGG + Intronic
1061595887 9:131628899-131628921 CTCCCTGGGCTGAGGGCACAAGG + Intronic
1190584116 X:51920590-51920612 CTAGATAGGCTGACGGCACACGG - Intergenic
1194845972 X:98809557-98809579 CTCCATTTGGTGACTGCAGTGGG + Intergenic