ID: 1163820267

View in Genome Browser
Species Human (GRCh38)
Location 19:19492432-19492454
Sequence CCTCATGGTGAGCCACGTGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163820261_1163820267 2 Left 1163820261 19:19492407-19492429 CCTTGAAGGAGACTAGCACCGAG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1163820267 19:19492432-19492454 CCTCATGGTGAGCCACGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 78
1163820260_1163820267 11 Left 1163820260 19:19492398-19492420 CCACGGTGGCCTTGAAGGAGACT 0: 1
1: 0
2: 1
3: 9
4: 127
Right 1163820267 19:19492432-19492454 CCTCATGGTGAGCCACGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 78
1163820256_1163820267 30 Left 1163820256 19:19492379-19492401 CCGAGAGTGAATGGGCTGACCAC 0: 1
1: 0
2: 0
3: 8
4: 80
Right 1163820267 19:19492432-19492454 CCTCATGGTGAGCCACGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163820267 Original CRISPR CCTCATGGTGAGCCACGTGT TGG Exonic
900782110 1:4625040-4625062 CCTCAGAGTGAGCCACATGAAGG - Intergenic
905017036 1:34785038-34785060 CCTCACGGTAGGCCACGTGCAGG - Exonic
906104308 1:43282874-43282896 CCTCATCTTCAGCCACCTGTGGG + Exonic
910239927 1:85075443-85075465 CATTATGGTGAGACAAGTGTAGG + Intronic
912758548 1:112345837-112345859 ACCCATGGAGAGCCACATGTGGG - Intergenic
917747886 1:178028166-178028188 CCCCATGGTGAGGCATGTCTAGG - Intergenic
1065852754 10:29804614-29804636 CCACATGCTGAGCCCTGTGTGGG - Intergenic
1067232142 10:44419429-44419451 CCCCACAGTGAGCCACGTGATGG + Intergenic
1072640432 10:97207269-97207291 CCCCAGGGTGGGCCAAGTGTGGG + Intronic
1076076116 10:127535023-127535045 CCTGTAGGTCAGCCACGTGTTGG - Intergenic
1078639062 11:13078566-13078588 GCTCATGGTGATCCAGATGTTGG - Intergenic
1086108129 11:83169132-83169154 CCTCATGGTCAGCCAGGAGGTGG + Exonic
1086108162 11:83169288-83169310 CCACATGGTCAGCCAGGGGTTGG + Exonic
1090869272 11:130728372-130728394 ACTCTGGGTGAGCCATGTGTAGG - Intergenic
1091002501 11:131922147-131922169 CCTCAGGGTAAGCAAGGTGTGGG - Intronic
1094034611 12:26054567-26054589 CCTCATGCTGTGCCTGGTGTTGG + Intronic
1094491730 12:30964978-30965000 CCTCATGGTAGGCCCCATGTGGG - Intronic
1094555048 12:31490644-31490666 CCTCATTTTGAGCCAAGTTTAGG - Intronic
1097446486 12:59678636-59678658 GCTCATGGGCAGCCACGGGTAGG + Intronic
1102211520 12:111130779-111130801 CCTCACTGTGAGCCACCTTTTGG + Intronic
1116542263 14:46112907-46112929 CCTCATGGAGAGCCACTGTTAGG + Intergenic
1118292858 14:64541563-64541585 CCGCATGGTGAGCCACCTGGCGG + Exonic
1118732193 14:68676329-68676351 CCTCATAGTAAGCCACATTTGGG + Intronic
1129929944 15:79402350-79402372 CCTCAGCATGAGCCACATGTGGG - Intronic
1136513526 16:30753865-30753887 CCACATGTTCAGCCACGTTTGGG + Intronic
1142095216 16:88235681-88235703 CCTCATGGGGAACCACGGTTTGG - Intergenic
1142937215 17:3344834-3344856 CCTCATGCTGAGCCAACTGGAGG + Intergenic
1142937352 17:3346394-3346416 CCTCATGCTGAGCCAACTGGAGG + Intergenic
1144583562 17:16474153-16474175 CCCCACCGTCAGCCACGTGTGGG - Intronic
1144826342 17:18107716-18107738 CATCATGGAGAGCCCTGTGTGGG - Exonic
1152368306 17:79870157-79870179 TCCCAGGGTGAGCCACGTGATGG - Intergenic
1157768939 18:50327348-50327370 CCTCATGGTGGGGCACTTGGGGG + Intergenic
1160957497 19:1700228-1700250 CCCCATGGGGACCCAGGTGTCGG + Intergenic
1161846030 19:6712492-6712514 CCTCATGGTGAGACCCGGGGCGG - Exonic
1163820267 19:19492432-19492454 CCTCATGGTGAGCCACGTGTTGG + Exonic
1166924273 19:46255622-46255644 TCTCTTGGTGAGCCACCTGATGG + Intergenic
927094309 2:19735990-19736012 CCACATGGAAAGCCACATGTAGG - Intergenic
928207575 2:29297190-29297212 CCTCTTGGTGAGACAGGTGGTGG - Intronic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
930119489 2:47748430-47748452 CCTCATGGAGAACCACTTCTGGG + Intronic
932237581 2:70133226-70133248 TTTCATGGTGAGCTATGTGTCGG + Intergenic
935746377 2:106193632-106193654 ACTCTTGGGGAGCCAAGTGTGGG - Intronic
935948976 2:108311944-108311966 CCTCATGGAGAACCACCTCTAGG + Intergenic
937113417 2:119385171-119385193 CCACATGGGGAGCCAGGTGTAGG - Intergenic
937152622 2:119696369-119696391 CCTCATGGTGACCACGGTGTGGG + Intergenic
1169526289 20:6429678-6429700 CCTCGTTGTGAGCCACATGAGGG - Intergenic
1169598228 20:7225950-7225972 ACTCTTGGTGAGCCACCTGGAGG - Intergenic
1170732298 20:18985722-18985744 CCACATGCAGAGCCACGGGTTGG - Intergenic
1172964193 20:38821818-38821840 TCTCAAGGTGACCCAGGTGTTGG - Intronic
1181469583 22:23129426-23129448 CCTAATGGTGCGCCCAGTGTTGG + Intronic
1183498257 22:38162850-38162872 CTTCAAGGAGAGCCAGGTGTGGG + Intronic
954107745 3:48418433-48418455 CTGCATGGTGAGCCACCTGCGGG - Exonic
968509978 4:991292-991314 CCTCATGGTGGGGCAGGTGGTGG - Exonic
969264832 4:6057560-6057582 CCTCATGCTGATCCATGTGTGGG + Intronic
976283340 4:83346868-83346890 CCTCATGGAGAGCCTCTTCTAGG - Intergenic
977781236 4:100983417-100983439 CCTCACTGTGATCCACGTTTAGG - Intergenic
980474282 4:133291416-133291438 CCTCATGGTGAATCACTTTTAGG + Intergenic
984318554 4:178161208-178161230 CCTCATGGAGAACCTCTTGTAGG - Intergenic
985436520 4:189935466-189935488 CATCATAGGGAGCCAGGTGTGGG - Intergenic
985606883 5:862580-862602 CCTCATGGTGCGGCAGGCGTGGG - Intronic
986372483 5:7093737-7093759 CCTTCTGGTGAGCCACATTTTGG - Intergenic
987069875 5:14326157-14326179 CCTCACAGTGAGCCAGGGGTAGG - Intronic
987152620 5:15057409-15057431 CCACGGGGTGAGTCACGTGTGGG + Intergenic
990125941 5:52518109-52518131 CCTCATGGAGAGCCACTGCTAGG + Intergenic
990842057 5:60092920-60092942 CCTCGTGGTGAGTCATGTCTAGG - Intronic
997689690 5:135818752-135818774 CCCCAAGGTGGGCCATGTGTTGG + Intergenic
1002397996 5:178972736-178972758 CCTGAGGCTGAGCCACGTGGGGG + Intergenic
1003117673 6:3294014-3294036 CCTTGTGGGGAGCCACGTGCAGG - Intronic
1010778745 6:79918341-79918363 ACTCAAGGAGAGCCAGGTGTAGG + Intronic
1012958747 6:105599554-105599576 CCTCTTAGAGAGCCAGGTGTGGG - Intergenic
1016782296 6:147972765-147972787 GCTTGTGGCGAGCCACGTGTGGG + Intergenic
1017726302 6:157278374-157278396 CCTCAGGGTGAGGCAGCTGTAGG - Intergenic
1023660532 7:42467013-42467035 CCTCATGGTAAGCCACATTCTGG - Intergenic
1040297995 8:46173202-46173224 CCACATTGTGAGCCAGTTGTTGG - Intergenic
1048441344 8:134461865-134461887 CTGCATGCTGCGCCACGTGTGGG + Intergenic
1055808836 9:80127511-80127533 CCTCATTATAAGCCATGTGTAGG + Intergenic
1055843265 9:80531412-80531434 CCTCATGGAGAACCACTGGTAGG - Intergenic
1056721812 9:89078590-89078612 CCCCATGCAGAACCACGTGTTGG - Intronic
1187429545 X:19209661-19209683 CCACATGGAGAGGCAGGTGTAGG - Intergenic
1188114975 X:26231835-26231857 CCTCATGGAGAGCCACTTCTAGG - Intergenic
1192201191 X:69067812-69067834 CCTCATGGTCAGGCATGTGTGGG - Intergenic
1199203838 X:145124451-145124473 CCTCATGGAGAACCACTGGTAGG - Intergenic
1201447959 Y:14079099-14079121 CCCCATGGTGTGCCACAAGTAGG - Intergenic
1201733256 Y:17228702-17228724 TCTTGTGGTCAGCCACGTGTGGG - Intergenic