ID: 1163821048

View in Genome Browser
Species Human (GRCh38)
Location 19:19496747-19496769
Sequence CATCCTACTTCCAGTGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 156}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163821048_1163821057 -3 Left 1163821048 19:19496747-19496769 CCCCACCCACTGGAAGTAGGATG 0: 1
1: 0
2: 3
3: 12
4: 156
Right 1163821057 19:19496767-19496789 ATGGGAAGAGCAGAACCAAGGGG 0: 1
1: 0
2: 4
3: 91
4: 557
1163821048_1163821056 -4 Left 1163821048 19:19496747-19496769 CCCCACCCACTGGAAGTAGGATG 0: 1
1: 0
2: 3
3: 12
4: 156
Right 1163821056 19:19496766-19496788 GATGGGAAGAGCAGAACCAAGGG 0: 1
1: 0
2: 0
3: 26
4: 441
1163821048_1163821065 24 Left 1163821048 19:19496747-19496769 CCCCACCCACTGGAAGTAGGATG 0: 1
1: 0
2: 3
3: 12
4: 156
Right 1163821065 19:19496794-19496816 TGGGCTGGAAACAGGCGCCTTGG 0: 1
1: 0
2: 0
3: 12
4: 199
1163821048_1163821064 16 Left 1163821048 19:19496747-19496769 CCCCACCCACTGGAAGTAGGATG 0: 1
1: 0
2: 3
3: 12
4: 156
Right 1163821064 19:19496786-19496808 GGGGCGGGTGGGCTGGAAACAGG 0: 1
1: 0
2: 2
3: 30
4: 361
1163821048_1163821060 4 Left 1163821048 19:19496747-19496769 CCCCACCCACTGGAAGTAGGATG 0: 1
1: 0
2: 3
3: 12
4: 156
Right 1163821060 19:19496774-19496796 GAGCAGAACCAAGGGGCGGGTGG 0: 1
1: 0
2: 2
3: 40
4: 298
1163821048_1163821058 0 Left 1163821048 19:19496747-19496769 CCCCACCCACTGGAAGTAGGATG 0: 1
1: 0
2: 3
3: 12
4: 156
Right 1163821058 19:19496770-19496792 GGAAGAGCAGAACCAAGGGGCGG 0: 1
1: 0
2: 3
3: 46
4: 532
1163821048_1163821059 1 Left 1163821048 19:19496747-19496769 CCCCACCCACTGGAAGTAGGATG 0: 1
1: 0
2: 3
3: 12
4: 156
Right 1163821059 19:19496771-19496793 GAAGAGCAGAACCAAGGGGCGGG 0: 1
1: 1
2: 2
3: 52
4: 494
1163821048_1163821055 -5 Left 1163821048 19:19496747-19496769 CCCCACCCACTGGAAGTAGGATG 0: 1
1: 0
2: 3
3: 12
4: 156
Right 1163821055 19:19496765-19496787 GGATGGGAAGAGCAGAACCAAGG 0: 1
1: 1
2: 7
3: 30
4: 497
1163821048_1163821062 9 Left 1163821048 19:19496747-19496769 CCCCACCCACTGGAAGTAGGATG 0: 1
1: 0
2: 3
3: 12
4: 156
Right 1163821062 19:19496779-19496801 GAACCAAGGGGCGGGTGGGCTGG 0: 1
1: 0
2: 1
3: 13
4: 282
1163821048_1163821061 5 Left 1163821048 19:19496747-19496769 CCCCACCCACTGGAAGTAGGATG 0: 1
1: 0
2: 3
3: 12
4: 156
Right 1163821061 19:19496775-19496797 AGCAGAACCAAGGGGCGGGTGGG 0: 1
1: 0
2: 1
3: 19
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163821048 Original CRISPR CATCCTACTTCCAGTGGGTG GGG (reversed) Intronic
904332263 1:29767722-29767744 CCTCCCTCTTCCAGTGTGTGAGG + Intergenic
906685176 1:47758608-47758630 CAGCCTCCTTCCTGTGTGTGAGG + Intergenic
907763929 1:57389529-57389551 CATCATATATGCAGTGGGTGTGG - Intronic
909163531 1:72185826-72185848 CATCTTATTTGCATTGGGTGCGG - Intronic
909685706 1:78346192-78346214 CATCTTCTTTCCAGTGTGTGAGG - Intronic
912555102 1:110510315-110510337 CATCCTAGGTCCAGTGAGTCTGG - Intergenic
919755393 1:201062970-201062992 CATCCTCCTGCCAGTGGGGCGGG + Intronic
920451653 1:206064502-206064524 CATCCTCATTCCAGTAGGGGCGG - Intronic
924561681 1:245161882-245161904 AATTTTACTTCCAGTGAGTGGGG + Intronic
1062949303 10:1485533-1485555 CTGCCCACTTGCAGTGGGTGGGG + Intronic
1063246159 10:4221238-4221260 CAGGCCACTTCCAGTGTGTGAGG - Intergenic
1063785979 10:9382944-9382966 CCTCCTACCTCCAGTGCCTGGGG + Intergenic
1067262677 10:44707972-44707994 CATCTCACTTCCAGAGAGTGAGG + Intergenic
1067971731 10:50978888-50978910 GATCCTACTTACACTGGGTATGG - Intergenic
1068776611 10:60874376-60874398 CATCCCATTTCCTGTGGATGAGG + Intronic
1070809665 10:79291221-79291243 CTTCCTCCTTCCAGTGGGGAGGG + Intronic
1072511578 10:96130776-96130798 AATCCAACTGCCACTGGGTGTGG - Intronic
1073914300 10:108384486-108384508 CATCCTACTACACGTGGGTTTGG - Intergenic
1074141315 10:110675535-110675557 CAACCAACTTCCAGCGGGTAAGG + Intronic
1076686125 10:132199218-132199240 CATCCCATTTCCAGTGGGGGTGG + Intronic
1078248950 11:9601534-9601556 CATACTACTTCCTGTCGGGGAGG - Intergenic
1079545377 11:21627071-21627093 CATCCTAGTGCCAGGGGATGTGG + Intergenic
1079754504 11:24239529-24239551 CATCCTGGTTGCAGGGGGTGGGG + Intergenic
1083150083 11:60786489-60786511 CATCCTGCTTACAGGGGGAGAGG - Intronic
1083150107 11:60786615-60786637 CATCCTGCTTACAGGGGGAGAGG - Intronic
1084337192 11:68466112-68466134 GATGCTACTTCAAGTGGGAGGGG + Intronic
1088608661 11:111556259-111556281 CATCCTGATTCCATGGGGTGGGG - Intronic
1088884889 11:113998866-113998888 CATCCTTCTTCCTGGGGGAGGGG - Intergenic
1089901414 11:121989838-121989860 CAACCTACCCCAAGTGGGTGGGG + Intergenic
1089956749 11:122578361-122578383 CATCCTAATTCCACAGGGAGAGG - Intergenic
1091690999 12:2597370-2597392 CATGCTCCTTCCTGTTGGTGTGG + Intronic
1092494659 12:8980690-8980712 CATCCTGGTTCCAGAGGGTGTGG + Intronic
1098341260 12:69453737-69453759 CATCCAAGATACAGTGGGTGAGG - Intergenic
1098749679 12:74278279-74278301 GATCCAACTTACAGTGGGTCTGG + Intergenic
1106549415 13:30758511-30758533 CATCCTTGATCCAGTGGGTAGGG + Intronic
1106824911 13:33509828-33509850 GTTCCTCCTTCCTGTGGGTGTGG - Intergenic
1112901620 13:104363904-104363926 CATGCTACTGCCAGGGGTTGGGG + Intergenic
1114061164 14:19016736-19016758 CCTGCTTCTTTCAGTGGGTGAGG - Intergenic
1114101090 14:19383243-19383265 CCTGCTTCTTTCAGTGGGTGAGG + Intergenic
1117760362 14:59020938-59020960 CACCCCACTTCCAGTGGGGGTGG + Intergenic
1118007240 14:61574447-61574469 CATTCTACTTCCATCAGGTGAGG + Intronic
1118788748 14:69069228-69069250 CAGCCTACTGCCAGTGGGGGTGG + Intronic
1119139532 14:72253629-72253651 CATCCAACTTCAAGGAGGTGAGG - Intronic
1120714506 14:87825706-87825728 CATCCTACTGCCATTGTTTGAGG + Intergenic
1123808693 15:23901260-23901282 CATCTTACCTTCAGTGGGTAAGG + Intergenic
1124067171 15:26355114-26355136 CAGCCTCTTGCCAGTGGGTGCGG - Intergenic
1130385069 15:83403899-83403921 CATCCTATTTCAAGGGGTTGTGG - Intergenic
1131796630 15:96024321-96024343 CATCATACTTCTAGTTGGAGAGG + Intergenic
1134167541 16:11942530-11942552 CATCTTACTGCCCGTGTGTGTGG + Intronic
1134493157 16:14711182-14711204 CATCTTACTGCCCGTGTGTGTGG - Intronic
1134498538 16:14750306-14750328 CATCTTACTGCCCGTGTGTGTGG - Intronic
1134547802 16:15123983-15124005 CATCTTACTGCCCGTGTGTGTGG + Intronic
1134593403 16:15475687-15475709 CCACCTCCTTCCACTGGGTGGGG + Intronic
1134593578 16:15476784-15476806 CCACCTTCTTCCACTGGGTGGGG + Intronic
1134712680 16:16335423-16335445 CATCTTACTGCCCGTGTGTGTGG - Intergenic
1134720545 16:16378738-16378760 CATCTTACTGCCCGTGTGTGTGG - Intergenic
1134946882 16:18333147-18333169 CATCTTACTGCCCGTGTGTGTGG + Intronic
1134954147 16:18373270-18373292 CATCTTACTGCCCGTGTGTGTGG + Intergenic
1135312972 16:21420182-21420204 CATCTTACTGCCTGTGTGTGTGG + Intronic
1135365896 16:21852462-21852484 CATCTTACTGCCTGTGTGTGTGG + Intronic
1135445919 16:22518700-22518722 CATCTTACTGCCTGTGTGTGTGG - Intronic
1136152128 16:28357914-28357936 CATCTTACTGCCTGTGTGTGTGG + Intronic
1136168382 16:28471782-28471804 CATCTTACTGCCTGTGTGTGTGG + Intergenic
1136194620 16:28643269-28643291 CATCTTACTGCCTGTGTGTGTGG - Intronic
1136210952 16:28757368-28757390 CATCTTACTGCCTGTGTGTGTGG - Intronic
1136255674 16:29037327-29037349 CATCTTACTGCCTGTGTGTGTGG - Intergenic
1136309640 16:29398910-29398932 CATCTTACTGCCTGTGTGTGTGG + Intronic
1136323085 16:29500690-29500712 CATCTTACTGCCTGTGTGTGTGG + Intronic
1136437769 16:30240658-30240680 CATCTTACTGCCTGTGTGTGTGG + Intronic
1137408746 16:48210100-48210122 CATCATCCTTCCAGTGGTTGAGG - Intronic
1137488579 16:48912110-48912132 CTGCCTGCTTCCAGTGGGTAGGG - Intergenic
1139647309 16:68340854-68340876 CATTATCCTTTCAGTGGGTGAGG + Intronic
1139741708 16:69040876-69040898 CTTCCTCCTTCAAGTGGGTTTGG + Intronic
1139857322 16:69991289-69991311 CATCTTACTGCCCGTGTGTGTGG + Intergenic
1140365351 16:74376631-74376653 CATCTTACTGCCTGTGTGTGTGG - Intergenic
1140407325 16:74719396-74719418 CATCCTCCTTACAGAGGCTGTGG + Intronic
1140464254 16:75166880-75166902 CAACTTACTTTCAGTGGGTAAGG + Exonic
1141720380 16:85752264-85752286 CATCCTGCCTCCGGAGGGTGGGG - Intergenic
1148613161 17:48978471-48978493 CAGCCTATTTCCTGTGGGTTGGG - Intergenic
1149734617 17:58980877-58980899 CTTCCCACTTCCAGTAAGTGAGG - Exonic
1151390354 17:73782889-73782911 CATCCTGCTTCCAGAGGCTGTGG - Intergenic
1154118769 18:11634537-11634559 CATCTTACTGCCTGTGTGTGTGG + Intergenic
1155687386 18:28572141-28572163 CAACCTACATTCAATGGGTGGGG + Intergenic
1156450895 18:37266044-37266066 CATCCTGCTGCCAGTGTGTGAGG + Intronic
1157449120 18:47772375-47772397 CACCCTACTTCCATCGGGAGAGG - Intergenic
1157575045 18:48738096-48738118 CATCCTTCTTGCAGTCGCTGAGG + Intronic
1158010626 18:52723570-52723592 CATCTAACTTACAGAGGGTGAGG + Intronic
1158106855 18:53895326-53895348 CATCTCACTTCCAGTGGGTTTGG + Intergenic
1158399657 18:57110649-57110671 CATTTTATTTCCAATGGGTGAGG + Intergenic
1158955709 18:62535734-62535756 CAGCCTAGATCCACTGGGTGGGG + Intronic
1161365417 19:3876471-3876493 CATACCACACCCAGTGGGTGTGG - Intergenic
1163155831 19:15439508-15439530 CATCCTCCTCCCAGTGGGGATGG + Intronic
1163645917 19:18489004-18489026 CATCCCACCTGCAGGGGGTGTGG + Intronic
1163701546 19:18789060-18789082 CAGCCTCCTTCCAGCGGGAGGGG - Intronic
1163821048 19:19496747-19496769 CATCCTACTTCCAGTGGGTGGGG - Intronic
1166976372 19:46607368-46607390 CAGCCTATTCCCAGAGGGTGTGG - Intronic
1167161051 19:47767229-47767251 GATTCTACTTCACGTGGGTGGGG - Intergenic
925119709 2:1408748-1408770 CTTCCTACTTCTATTTGGTGAGG - Intronic
929085847 2:38166543-38166565 CATCCTACTCCCTGAGAGTGGGG - Intergenic
929738846 2:44581056-44581078 CATCCTGCTTGCTGTGGTTGTGG + Intronic
929934522 2:46285117-46285139 CATCTGACTTCCAGAGGTTGAGG - Intergenic
931260676 2:60615715-60615737 TATAGTACTTCCAGTAGGTGAGG + Intergenic
932577919 2:72972900-72972922 CCCCCTCCTTCCAGTGGGGGGGG + Intronic
934737999 2:96699708-96699730 AATCCTACTGCCAGTGAGAGTGG + Intergenic
940813476 2:158272594-158272616 CATCCTACTCTCAGGGGCTGGGG - Intronic
948706879 2:239800121-239800143 CATTCTGCCTCCAGTGAGTGGGG - Exonic
1171052306 20:21871403-21871425 CCACCCACTTCCAGTGGCTGGGG - Intergenic
1172066965 20:32228187-32228209 CATCCTTTTTCCCGTGGGGGTGG + Intronic
1174189883 20:48732874-48732896 CATCCTACTTCCAGGTGGTGGGG - Intronic
1179791395 21:43757796-43757818 CATCCTCCTTCCTGCTGGTGTGG - Exonic
1180479649 22:15739348-15739370 CCTGCTTCTTTCAGTGGGTGAGG - Intergenic
1180802495 22:18638384-18638406 CCAGCTTCTTCCAGTGGGTGGGG + Intergenic
1180853730 22:19033940-19033962 CCAGCTTCTTCCAGTGGGTGGGG + Intergenic
1180918375 22:19505410-19505432 CATCCTCGTTCCGGTGGTTGTGG - Exonic
1181219228 22:21356877-21356899 CCAGCTTCTTCCAGTGGGTGGGG - Intergenic
1182403661 22:30105144-30105166 CCTCCTACTTCCTCTTGGTGCGG + Intronic
949824693 3:8153276-8153298 CCTCCAATTGCCAGTGGGTGGGG + Intergenic
951833030 3:26951342-26951364 CTTCCCTGTTCCAGTGGGTGTGG + Intergenic
952652203 3:35739700-35739722 TATACTACTTCCTGTTGGTGAGG - Intronic
953530666 3:43737105-43737127 TATCCTATTCCCAGAGGGTGAGG + Intergenic
956002416 3:64743306-64743328 TATCCTATTCCAAGTGGGTGAGG - Intergenic
956143561 3:66169944-66169966 CCTCATACTTCCAGTGGGATGGG + Intronic
959023143 3:101211137-101211159 CCAGCTACTTGCAGTGGGTGGGG + Intergenic
959518219 3:107294803-107294825 CATCCTCCTTCTAGTTTGTGAGG + Intergenic
968964688 4:3763966-3763988 TGTCCTTCTTCCAGTGGGAGTGG - Intergenic
970640940 4:18065345-18065367 CAGCCTACAGCCAGTGGATGAGG - Intergenic
982350830 4:154413612-154413634 CATCTGACTTCCAGTAGGTTAGG + Intronic
982724613 4:158892479-158892501 CATGTTAATTCCAGTGGCTGGGG - Intronic
982761781 4:159293350-159293372 CATCTTACAACTAGTGGGTGGGG - Intronic
982933245 4:161436174-161436196 CAGCATACTTCCAGTTGGAGGGG + Intronic
983436680 4:167724388-167724410 CATGCTCCTTCAAGTGAGTGTGG + Intergenic
983944742 4:173572915-173572937 CATCCTCCTTCCAGTAGCTCTGG - Intergenic
992598466 5:78370307-78370329 TTTCCAACTTTCAGTGGGTGTGG + Intronic
993996188 5:94726274-94726296 CATACAACTTCCAGTGGGTGGGG - Intronic
997147849 5:131456830-131456852 CATCCTTCTTACAGTGGTTTGGG - Intronic
997215167 5:132103939-132103961 CATCCTTTCTGCAGTGGGTGGGG - Intergenic
998401008 5:141849212-141849234 CCTCCCCCTACCAGTGGGTGTGG - Intergenic
998558293 5:143147371-143147393 CATCATACTTACAGTGAGTTGGG - Exonic
1000939062 5:167338277-167338299 CATCTTAGTTCCATGGGGTGGGG - Intronic
1001522842 5:172407260-172407282 CATCCTACTTCAAGGGACTGGGG - Intronic
1001629808 5:173166503-173166525 CTGCCTTCTTGCAGTGGGTGTGG + Intergenic
1003108086 6:3230231-3230253 CATCACAATTCCAGTGGGGGTGG - Intronic
1005491982 6:26355466-26355488 CATCCTACTTTCAGGGAGAGAGG + Intergenic
1006870813 6:37249609-37249631 AATCTTCCTTCCACTGGGTGCGG - Intronic
1006913440 6:37579040-37579062 CATCCTACCTCCCTGGGGTGAGG + Intergenic
1009960468 6:70514851-70514873 CCTCATACTTCCAGATGGTGGGG + Intronic
1013069281 6:106713951-106713973 CTTCCTTCTTCCAGTGGGCTGGG - Intergenic
1017906408 6:158760028-158760050 CATCCTTCTCCCAGTGGGGTGGG - Intronic
1019489351 7:1304390-1304412 CATCCTACTTCCTGTCTCTGTGG + Intergenic
1022084042 7:27049246-27049268 AATCCTGCTTTCACTGGGTGCGG + Intergenic
1022727658 7:32995775-32995797 CCTCTTACTTCCAGTGGGCAAGG + Intronic
1025045926 7:55691866-55691888 CCTCTTACTTCCAGTGGGTGAGG - Intergenic
1026244861 7:68610947-68610969 CATCTTCCTTCCTGTGGATGGGG - Intergenic
1036398486 8:8387547-8387569 CTTCCTCCTCTCAGTGGGTGGGG - Intergenic
1036714255 8:11106096-11106118 TATCCTACTTTCAGTGTGTCAGG + Intronic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1041124248 8:54618991-54619013 CATCCTTCTTACAGTTGCTGAGG + Intronic
1041662595 8:60414112-60414134 CATCATTTTTCCAGAGGGTGTGG + Intergenic
1048681276 8:136843871-136843893 CTTCCTATTCCAAGTGGGTGGGG - Intergenic
1050198519 9:3114204-3114226 CACCCTACTTCCACGGGGAGTGG + Intergenic
1051993616 9:23184952-23184974 CATCATAGTTTCAGTGGGTCAGG - Intergenic
1056172279 9:83997543-83997565 CACCCTCCTCCCAGTGGGTGCGG - Intronic
1057396232 9:94682893-94682915 CACACCATTTCCAGTGGGTGTGG + Intergenic
1059344331 9:113617816-113617838 TATCCTACTCCCAGGGGTTGTGG + Intergenic
1062322674 9:135998108-135998130 CAGCCTACTTCAGGTGGGTGAGG + Intergenic
1062419358 9:136472340-136472362 CACCCTGCTGCCTGTGGGTGTGG - Intronic
1187967287 X:24624590-24624612 CCTCCTGCTTCCAGTTGGTTGGG + Intronic
1190280464 X:48925889-48925911 AATCCTACCTGCAGTGGTTGCGG - Exonic
1194157984 X:90416422-90416444 CATGCTGCTGCCAGTGGGTGTGG + Intergenic
1194703415 X:97144212-97144234 CATGCTACTTGCAGGGGCTGAGG + Intronic
1198304003 X:135362212-135362234 CATACTACTTTAAGGGGGTGAGG + Exonic
1200504309 Y:3993391-3993413 CATGCTGCTGCCAGTGGGTGTGG + Intergenic