ID: 1163821769

View in Genome Browser
Species Human (GRCh38)
Location 19:19500104-19500126
Sequence CCTCTCCTGTTGCCAAGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 227}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163821764_1163821769 -2 Left 1163821764 19:19500083-19500105 CCCTCATCAGGGCTCAGTCTCCC 0: 1
1: 1
2: 2
3: 34
4: 516
Right 1163821769 19:19500104-19500126 CCTCTCCTGTTGCCAAGGATAGG 0: 1
1: 0
2: 0
3: 28
4: 227
1163821765_1163821769 -3 Left 1163821765 19:19500084-19500106 CCTCATCAGGGCTCAGTCTCCCT No data
Right 1163821769 19:19500104-19500126 CCTCTCCTGTTGCCAAGGATAGG 0: 1
1: 0
2: 0
3: 28
4: 227
1163821760_1163821769 17 Left 1163821760 19:19500064-19500086 CCAGTCTGTCTCTGCCGTTCCCT 0: 1
1: 0
2: 3
3: 35
4: 438
Right 1163821769 19:19500104-19500126 CCTCTCCTGTTGCCAAGGATAGG 0: 1
1: 0
2: 0
3: 28
4: 227
1163821763_1163821769 3 Left 1163821763 19:19500078-19500100 CCGTTCCCTCATCAGGGCTCAGT 0: 1
1: 0
2: 1
3: 25
4: 320
Right 1163821769 19:19500104-19500126 CCTCTCCTGTTGCCAAGGATAGG 0: 1
1: 0
2: 0
3: 28
4: 227
1163821759_1163821769 22 Left 1163821759 19:19500059-19500081 CCAGACCAGTCTGTCTCTGCCGT 0: 1
1: 0
2: 1
3: 9
4: 130
Right 1163821769 19:19500104-19500126 CCTCTCCTGTTGCCAAGGATAGG 0: 1
1: 0
2: 0
3: 28
4: 227
1163821758_1163821769 23 Left 1163821758 19:19500058-19500080 CCCAGACCAGTCTGTCTCTGCCG No data
Right 1163821769 19:19500104-19500126 CCTCTCCTGTTGCCAAGGATAGG 0: 1
1: 0
2: 0
3: 28
4: 227
1163821757_1163821769 30 Left 1163821757 19:19500051-19500073 CCGCTCTCCCAGACCAGTCTGTC 0: 1
1: 0
2: 2
3: 19
4: 283
Right 1163821769 19:19500104-19500126 CCTCTCCTGTTGCCAAGGATAGG 0: 1
1: 0
2: 0
3: 28
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163821769 Original CRISPR CCTCTCCTGTTGCCAAGGAT AGG Intronic
902262952 1:15240599-15240621 TCTCTCCTGTTGTCCAGGCTGGG - Intergenic
902459237 1:16560065-16560087 CCTCTCCTGTTGCAAAAGCTTGG - Intergenic
902875218 1:19336914-19336936 CCTCTCATGTGTCCAAGGAAAGG + Intergenic
903152433 1:21420747-21420769 CCTCTCCTGTTGCAAAAGCTTGG - Intergenic
903729831 1:25484323-25484345 CTTCTCCTGTTGCCAGGGGTTGG + Intronic
904482505 1:30802811-30802833 TCTCTCTTGTTGCCCAGGCTGGG - Intergenic
905682571 1:39884602-39884624 CCGCTCTTGTTGCCCAGGTTTGG - Intergenic
906667816 1:47633921-47633943 CCTATCCTATGCCCAAGGATGGG - Intergenic
909560659 1:77006183-77006205 CTTCTTCTGTTGCCCAGGCTAGG + Intronic
909993116 1:82247791-82247813 ACTTTCCAGTTGCCTAGGATTGG + Intergenic
912144168 1:106771754-106771776 CCTCCTCTGTTGCCCAGGCTGGG - Intergenic
913542016 1:119830606-119830628 CCTCTCCTGCTGCAAAAGCTTGG - Intergenic
913988916 1:143591310-143591332 CCTGTCCTGTTGCAAAAGCTTGG - Intergenic
915204116 1:154256606-154256628 CCCATCCTGTTGCCCAGGCTGGG - Intronic
918451184 1:184660884-184660906 CCTCTGCAGAGGCCAAGGATAGG + Intergenic
922821960 1:228490744-228490766 GCTCTCCTGTTTGCAAGGTTAGG + Intronic
923307613 1:232702499-232702521 TCACTCCTGTTGCCCAGGCTGGG - Intergenic
924075485 1:240330175-240330197 CCTCTGCTGATGCCAAACATTGG + Intronic
1062965682 10:1606156-1606178 CCTTTCCTGTTGCCCAAGTTTGG + Intronic
1063297142 10:4818002-4818024 CCTCTCCTGGACCCAAGGATGGG - Intronic
1064244772 10:13659674-13659696 CCTCTCATATTGCCTAGGTTGGG - Intronic
1065022749 10:21514350-21514372 CTTTTCCTGTTGCAAAGGAGTGG + Exonic
1065257394 10:23884827-23884849 CCTCTACTGTTCCCAAGAACAGG - Intronic
1066205658 10:33186886-33186908 ACACTCCTGTTGCCCAGGTTGGG + Intronic
1066566046 10:36723200-36723222 TCACTCTTGTTGCCAAGGCTAGG - Intergenic
1069366487 10:67699495-67699517 CTTCTCCTGTTGCCAATAATTGG + Intergenic
1069613063 10:69788173-69788195 CCTCACCTGGTGCCATGGCTTGG - Intergenic
1070690921 10:78524806-78524828 CCTCTCCTGTCGCCGTGGACAGG + Intergenic
1070727791 10:78803866-78803888 CCTTTCCAGTTGCCAAGGCTGGG + Intergenic
1077550506 11:3198034-3198056 CTTCTCCTGTGGCCAAGGAAGGG - Intergenic
1077595898 11:3531429-3531451 CCTCCCATGATGCCAATGATGGG + Intergenic
1079870763 11:25794973-25794995 CCTCTCCTGTCTCCTAGGAGTGG + Intergenic
1080377166 11:31725825-31725847 TCTCTATTGTTGCCAGGGATGGG + Intronic
1084821042 11:71690604-71690626 CCTCCCATGATGCCAATGATGGG - Intergenic
1085999788 11:81968964-81968986 CCTCTTCTGTTGCTAATGACTGG - Intergenic
1086099054 11:83079869-83079891 CTCGTCCTGTTGCCCAGGATGGG - Intergenic
1088950053 11:114559575-114559597 CCTCTCTTACTGACAAGGATAGG - Intronic
1090177100 11:124660257-124660279 TCTCTCTTGTTGCCCAGGCTGGG - Intronic
1090363081 11:126186725-126186747 CCTCTCCTGTTGCAGGGGAGTGG - Intergenic
1091596947 12:1884711-1884733 CTTCTCCTGCTGCCATGGATGGG - Intronic
1092422066 12:8340215-8340237 CCTCCCATGATGCCAATGATGGG + Intergenic
1093779049 12:23112873-23112895 CCTCTCCTCTTCCCCATGATGGG + Intergenic
1095955813 12:47805284-47805306 CTTCCCCTGTTGCCCAGGCTGGG + Intronic
1096521490 12:52187088-52187110 CCTCCCTTGGTGCCAGGGATAGG + Intronic
1096725315 12:53556724-53556746 CCCCAGCTGTGGCCAAGGATAGG - Intronic
1097239644 12:57566437-57566459 TCTCTCTTGTTGCCCAGGCTGGG + Intronic
1098689361 12:73467125-73467147 TCACTCCTGTTGCCCAGGCTGGG + Intergenic
1101851403 12:108405491-108405513 CCTCATCTGTTTCCAAGGAGGGG + Intergenic
1101995416 12:109522029-109522051 CCTGTCCTGTTGCCATGGCTGGG - Intronic
1102189864 12:110979462-110979484 CCTGCTCTGTTGCCAAGGCTGGG - Intergenic
1102303859 12:111790472-111790494 CGTTTCCAGTTGCCAAGGCTGGG - Exonic
1102939550 12:116927418-116927440 CTTCTCCAGTGGCCAAGGAGAGG + Intronic
1103186660 12:118963810-118963832 TTTCTCCTGTTGCCACAGATTGG - Intergenic
1103577984 12:121892840-121892862 GATCTTCTGTTGCCCAGGATCGG - Intronic
1104833316 12:131769884-131769906 CCTCTCCTGTTTGCAGGCATTGG + Intronic
1105996209 13:25674495-25674517 CCTCTCTTGGTGAAAAGGATGGG - Intronic
1106838186 13:33658835-33658857 CCTCTCCTCTTCCCAGAGATTGG - Intergenic
1106871360 13:34025614-34025636 TCACTCCTGTTGCCCAGGCTGGG + Intergenic
1107019381 13:35735998-35736020 CCTCTCCTCTTCCCAAAGAATGG + Intergenic
1107290959 13:38852669-38852691 CCTCTCCTTTTGCAAATGTTGGG + Intronic
1107692654 13:42967636-42967658 CCTCTCCTGTCGGCAGGGCTTGG - Intronic
1107872954 13:44763905-44763927 CCTCTCCTGTTTCCTCGGGTGGG - Intergenic
1109267601 13:60219155-60219177 TCGCTCTTGTTGCCCAGGATGGG + Intergenic
1111343377 13:86916947-86916969 CCTCTCCTTTTGCCACAGTTTGG - Intergenic
1113490556 13:110688417-110688439 CTCGTCCTGTTGCCAAGGATGGG - Intronic
1114267254 14:21080292-21080314 TCTCACCAGTTGCCAAGGCTTGG + Intronic
1114454195 14:22844905-22844927 CCTCTGCTGTTGCCTAGAAATGG + Intronic
1115075390 14:29383580-29383602 CCCCTCCTGTTGTCCAGGAATGG + Intergenic
1115514389 14:34170774-34170796 TCTCTCTTGTTGCCCAGGCTGGG - Intronic
1116169392 14:41380534-41380556 CCTCACTTGTTACCAGGGATAGG + Intergenic
1116413231 14:44649862-44649884 GCTCTCCTCTGGCCCAGGATGGG - Intergenic
1118917341 14:70118720-70118742 CATCTCCTGTTTCCAAGTTTGGG + Intronic
1119225460 14:72941565-72941587 CCTTTCCTCTTGCCGAGGAAGGG + Intronic
1120726268 14:87944799-87944821 CCTCTCCAGTTTCCAAGCTTCGG + Intronic
1121576844 14:94995754-94995776 CATCTTCCGCTGCCAAGGATCGG + Intergenic
1122285297 14:100648161-100648183 TCTCTCCTGTCACCAAGGCTGGG - Intergenic
1122623554 14:103073097-103073119 CCTCTGCTGTTGGCCAGGACAGG + Intergenic
1124590431 15:31048779-31048801 TCTCTCTTGTTGCCCAGGCTGGG - Intronic
1124955466 15:34357289-34357311 CATATCCTGTTGCCAAGTCTGGG + Exonic
1124972663 15:34504490-34504512 CCTCTCCTTGTTCCCAGGATAGG + Intergenic
1125207247 15:37167609-37167631 CCTCTCCTGCAGCAAAGGCTGGG + Intergenic
1125478593 15:40064279-40064301 CCTCTCCTGTTTGCACAGATGGG - Intergenic
1128315746 15:66658160-66658182 CCCCTGCTGTTCCCAAGGCTGGG + Intronic
1128736075 15:70054724-70054746 ACTCTCCTGGTGCCCAGGAGGGG - Intronic
1128832760 15:70784866-70784888 GCTCTCCTGTGGTCAAGGGTGGG + Intergenic
1129005101 15:72366337-72366359 CCTCCTCTGTTGCCCAGGCTGGG + Intronic
1129237175 15:74230655-74230677 AGTCTCCTGTTGCCAAAGCTTGG + Intergenic
1130762622 15:86836078-86836100 CCTCTCATGTTTGCAAGGGTAGG - Intronic
1131584097 15:93674989-93675011 CCTGACCTCTTGCCAATGATAGG - Intergenic
1132187740 15:99817172-99817194 CCTCTCCTTGTTCCCAGGATAGG - Intergenic
1133376222 16:5289360-5289382 CCTCCCATGATGCCAATGATGGG - Intergenic
1135091602 16:19522179-19522201 CCTCCCCCGTTGCCATGGAGCGG - Intergenic
1135647663 16:24177146-24177168 CCTCTCCTGTTTCCTACAATGGG - Intronic
1137357245 16:47778549-47778571 CTTCTCGTGTTGCCATGGAAAGG + Intergenic
1139325154 16:66146845-66146867 CCACACCTGTTGCAAAGGCTCGG + Intergenic
1139420872 16:66848873-66848895 CCGCTCCTGCTTCCAGGGATGGG + Intronic
1141266718 16:82504642-82504664 TCACTCCTGTTGCCCAGGCTGGG + Intergenic
1146439196 17:32878510-32878532 GCTCTGCTGGTGCCAGGGATTGG - Intergenic
1147381440 17:40058532-40058554 TCTCTCCTGCTGGCAAAGATAGG + Intronic
1147785332 17:42974327-42974349 CCACTCTTGTTGCCCAGGCTGGG - Intronic
1148435608 17:47682023-47682045 GATCTCCTGTTGCCCAGGCTGGG + Intronic
1148448359 17:47755591-47755613 TCACTCCTGTTGCCCAGGCTGGG + Intergenic
1148664343 17:49362917-49362939 CCTGTCCTGTGGCCAGGAATAGG + Intergenic
1150384176 17:64744519-64744541 CCACTCTTGTTGCCCAGGCTGGG - Intergenic
1151055523 17:71026921-71026943 CCACTCTTGTTGCCAAGGCTAGG + Intergenic
1151242911 17:72772109-72772131 CCTCTCCTGTTGTCCAGGCCTGG - Intronic
1151484857 17:74392518-74392540 ATTTTCCTTTTGCCAAGGATTGG - Intergenic
1151923434 17:77174913-77174935 CTTCCCCTGTTGGCTAGGATTGG + Intronic
1151967294 17:77437980-77438002 CCTCTCCGGTGGCCATGCATGGG + Intronic
1152176207 17:78789164-78789186 TCTCTCTTGTTGCCCAGGCTGGG - Intronic
1155533061 18:26787250-26787272 CCTTTCCTGTTGACAGGCATAGG + Intergenic
1157887944 18:51386809-51386831 CTTGTCCTGTTGCCCAGGCTGGG + Intergenic
1158392523 18:57055147-57055169 CCTCTCCTCTTGACAATGTTTGG + Intergenic
1159917519 18:74200033-74200055 CGTCTCCTCTTCCCAAGGACGGG - Intergenic
1160898977 19:1417280-1417302 CCTCTCCCCATGGCAAGGATTGG + Intronic
1161551368 19:4914609-4914631 CCTCTCCCGTTGCCTAGGCTGGG - Intronic
1162458485 19:10800269-10800291 CCTCTCCCCTTGCCATTGATGGG + Intronic
1163810725 19:19429771-19429793 CAGCTCTGGTTGCCAAGGATGGG + Intronic
1163821769 19:19500104-19500126 CCTCTCCTGTTGCCAAGGATAGG + Intronic
1165933895 19:39377597-39377619 CCACCCCTACTGCCAAGGATGGG + Exonic
1167853876 19:52222225-52222247 CCTCACCTGTTGTCCAGGATGGG - Exonic
1168402797 19:56095615-56095637 CTTCCTCTGTTGCCAAGGACAGG + Intronic
1202675481 1_KI270711v1_random:2249-2271 CCTCTCCTGTTGCAAAAGCTTGG - Intergenic
927201759 2:20582613-20582635 GGTCCCCTGATGCCAAGGATGGG - Intronic
927282174 2:21318395-21318417 TCTCTCCTGTTGCCAAGCTTTGG - Intergenic
930970982 2:57396347-57396369 GCTCTCCTGTTGTCCAGGTTGGG + Intergenic
933216248 2:79633724-79633746 CCTCTCCTCTGACCAAAGATAGG - Intronic
934651113 2:96091869-96091891 CCTCTCCTGGAGCCATGGGTCGG + Intergenic
940713566 2:157191825-157191847 TCTCTCCTCTTGCCAAGAATTGG - Intergenic
943067594 2:183105338-183105360 GCTCTCCTATTGCCCAGGGTGGG + Intergenic
944954933 2:204798203-204798225 TCTCTCCTGGTGCCAAGCAGCGG - Intronic
946706670 2:222465083-222465105 CCTCTGCTGCGTCCAAGGATAGG - Intronic
946864211 2:224028142-224028164 CCTCTCCAGATGCCAAGTCTGGG - Intronic
1170210072 20:13839246-13839268 CCTCTCCTTTGGCCAAAGTTAGG - Intergenic
1171468644 20:25351868-25351890 TCTCTCTTGTTGCCCAGGCTGGG - Intronic
1171501062 20:25593646-25593668 GCACTCCTGTTGCCCAGGCTGGG - Intergenic
1172093830 20:32451080-32451102 GGTCTCCTGCAGCCAAGGATGGG + Intronic
1172246350 20:33447785-33447807 TCACTCCTATTGCCCAGGATGGG + Intergenic
1173292475 20:41726899-41726921 GCTCTCCTGTTGTCAAGCATGGG - Intergenic
1173369070 20:42418786-42418808 CCTCTCCTGTGGTCAAGACTGGG - Intronic
1174096950 20:48097200-48097222 CCACTCCTGGAGCCAAGGGTGGG + Intergenic
1174298618 20:49567058-49567080 CCTCTCCTGTTGCTGAGTCTGGG - Intronic
1175549247 20:59806010-59806032 TCTCTCCTCTTGCCCTGGATGGG + Intronic
1178123648 21:29494652-29494674 TCTCTCTTGTTGCCCAGGCTGGG - Intronic
1178843310 21:36155898-36155920 CCTCTCCTGTCGCCCAGGGTCGG + Intergenic
1180600090 22:17009806-17009828 CCTCTGCTGATGGCAAGAATGGG + Intergenic
1182850281 22:33468064-33468086 CCTGTCATGTTTCCTAGGATGGG + Intronic
1183630798 22:39031537-39031559 TCTCTCCTGTTGCCCAAGCTGGG - Intronic
1183634312 22:39051922-39051944 TCTCTCCTGTTGCCCAGGCTGGG - Intronic
1184878780 22:47291972-47291994 CCTCTCCTGCGGCTAAGGAAGGG - Intergenic
950192414 3:10986827-10986849 CCTGCCCAGTTGGCAAGGATTGG - Intergenic
950639548 3:14340006-14340028 CCTCCCCTGATGTCAAGGCTGGG - Intergenic
950662965 3:14478008-14478030 CCTCCCCTGTTCCCCAGGAACGG + Intronic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
953739119 3:45521402-45521424 CCTGCTCTGTTGCCCAGGATGGG - Intronic
953928146 3:46992714-46992736 TCTGTCCTGTTCCCTAGGATGGG - Intronic
955709444 3:61763112-61763134 CCATTCCTGTTGCCAATAATTGG - Intronic
956699562 3:71947228-71947250 CATATCCTGATGCCAAGAATGGG - Intergenic
957065870 3:75521830-75521852 CCTCCCATGATGCCAATGATGGG + Intergenic
961287280 3:125816236-125816258 CCTCCCATGATGCCAATGATGGG - Intergenic
961402804 3:126658907-126658929 CCTCTCATGCTGCACAGGATAGG - Intergenic
961899811 3:130199738-130199760 CCTCCCGTGATGCCAATGATGGG + Intergenic
962243465 3:133771233-133771255 GATCTCCTGTTGCCAAGTCTGGG + Intronic
963430419 3:145194585-145194607 CCACTCTTGTTGCCCAGGCTGGG - Intergenic
963965609 3:151366596-151366618 CTTCTCCTGTTGCCACTTATTGG + Intronic
964096220 3:152934672-152934694 TCTCTCTTGTTGCCCAGGCTGGG - Intergenic
965994933 3:174869963-174869985 TCGCTCTTGTTGCCCAGGATGGG - Intronic
967310478 3:188101429-188101451 TCACTCCTGTTGCCTGGGATGGG + Intergenic
968492027 4:895126-895148 TCTCTGCTGTTGCCAAGGACAGG - Intronic
969516505 4:7651183-7651205 AGTCTCCTGTTGTCCAGGATGGG + Intronic
972574952 4:40343115-40343137 CCTCTCCAGTTCCCAGGAATGGG + Intronic
972995848 4:44878784-44878806 CCTCTCCTGGTGCCCTGGGTGGG + Intergenic
974272137 4:59664159-59664181 CCTTACCTGTGGCCATGGATGGG + Intergenic
977369687 4:96119912-96119934 TCTCTCTTGTTGCCCAGGCTGGG - Intergenic
977727575 4:100314853-100314875 TCACTCCTGTTGCCCAGGCTGGG + Intergenic
982897370 4:160949754-160949776 CCTCCCCTGTTAGGAAGGATAGG - Intergenic
983467870 4:168117545-168117567 CCTCACCTGATGTCATGGATAGG + Intronic
984868901 4:184310115-184310137 CCAATCCTGTTTCCAGGGATTGG + Intergenic
984993250 4:185402504-185402526 TCACTCCTGTTGCCCAGGCTGGG + Intronic
988265620 5:28945919-28945941 CCTCTCCTGTAGACAAGTAGAGG - Intergenic
988964519 5:36403035-36403057 CCGCTCTTGTTGCCCAGGTTGGG + Intergenic
989283502 5:39672218-39672240 CCGGACCTGTTGCCAAGGATTGG + Intergenic
990406184 5:55493282-55493304 CTTGTCCTGTTGCCCAGGCTGGG - Intronic
990897774 5:60717397-60717419 CCATCCCTGTAGCCAAGGATAGG + Intergenic
991943093 5:71873970-71873992 CTTCTGCTGTTGCCCAGGAATGG + Intergenic
992554899 5:77893463-77893485 CCTGACCTGTGGCCAGGGATTGG - Intergenic
993541070 5:89152493-89152515 TCGCTCTTGTTGCCTAGGATGGG + Intergenic
994059544 5:95459005-95459027 CCTCTCCTGAAGCAAAGGGTGGG + Intergenic
994630085 5:102274546-102274568 CCTATCCTGCTGCCAGGGGTAGG + Intronic
996079734 5:119244093-119244115 CCTCTCCTGGTGCCATGGTCAGG + Intronic
996210206 5:120798872-120798894 CCTCTACTTTTGACAAGGGTAGG + Intergenic
996372330 5:122766689-122766711 CCTCTCCTGTGGCAAAGACTGGG - Intergenic
996516147 5:124371920-124371942 CCTCTCCAGCTGCCAAGGCAAGG - Intergenic
997979436 5:138459710-138459732 CCTCTCCTGTTTGCAAGGAAAGG + Intergenic
1000114996 5:158145670-158145692 CAGCTGCTGTTGCCAAGGAGAGG - Intergenic
1001551613 5:172606539-172606561 CCTCTCCTGTTGCCGAGGCAGGG + Intergenic
1001880903 5:175243332-175243354 CCTGTCATGTTCCCCAGGATTGG + Intergenic
1005564956 6:27082055-27082077 GCTCTCCTGTTACCAATGTTGGG + Intergenic
1006055818 6:31383952-31383974 AGTCTCCTGTTGCCCAGGAATGG + Intergenic
1006544723 6:34770338-34770360 CCTCCCATGATGCCAATGATGGG + Exonic
1007583340 6:42972797-42972819 CCTCTCCTGTTTTCAGAGATAGG + Intronic
1007723325 6:43899081-43899103 CCTCTCCTTGTGCCTAGGTTGGG - Intergenic
1008985528 6:57538039-57538061 CTTCTTCTGTTGCCCAGGCTGGG + Intronic
1009217184 6:60936678-60936700 CCTGTCCTGAGGACAAGGATAGG + Intergenic
1010266341 6:73872305-73872327 CCTTTCCTCTTGCCAGTGATTGG + Intergenic
1011000523 6:82583276-82583298 CCTGCTCTGTTGCCAAGGCTGGG - Intergenic
1012764928 6:103355801-103355823 CCTCTCCTGTGCCCTAAGATTGG + Intergenic
1013587829 6:111595200-111595222 TCGCTCCTGTTGCCCAGGCTGGG - Intronic
1013601337 6:111707977-111707999 TCTCTCCAGTTGTCAAGGAGCGG + Exonic
1014517950 6:122401963-122401985 GCTCACATGTGGCCAAGGATGGG + Intronic
1014887856 6:126803560-126803582 CCCCAGCTGTTGCCAAGGATGGG - Intergenic
1017467765 6:154710542-154710564 TCTCTCTTGTTGCCCAGGCTAGG - Intergenic
1017651619 6:156588626-156588648 CCTCTGGTGTTGCCAAGAGTCGG + Intergenic
1018788351 6:167126593-167126615 CCTCTGCTGTTGCCTCGAATAGG + Intronic
1018826873 6:167415187-167415209 CCTCTCTTGCTGCCATGGGTCGG - Intergenic
1019830075 7:3319257-3319279 CCTCTCCTGTGGAAAAGGGTGGG - Intronic
1022957045 7:35390538-35390560 CCTCAGATGTTGCCATGGATTGG - Intergenic
1029914170 7:104189515-104189537 CTTCTCCTTTTCCCAAGGACAGG - Intronic
1033024115 7:137756179-137756201 TCTCTCCTGTTTCCAAGCAGTGG + Intronic
1036248798 8:7143792-7143814 CCTCCCATGATGCCAATGATGGG - Intergenic
1036252002 8:7170562-7170584 CCTCCCATGATGCCAATGATGGG + Intergenic
1036365488 8:8116899-8116921 CCTCCCATGATGCCAATGATGGG - Intergenic
1036963478 8:13271202-13271224 CCTCTGGTGTTGCCTATGATTGG + Intronic
1037164517 8:15810630-15810652 CCTATCTTGTGGCCAAGGAGGGG + Intergenic
1039062349 8:33581729-33581751 CCTCTCTGGTTCCCAAGGACAGG + Intergenic
1039204150 8:35131174-35131196 TCTCTCTTGTTGCCCAGGCTGGG + Intergenic
1041147381 8:54891350-54891372 CCTCTCCTGGTGACAAGGAAGGG + Intergenic
1042112442 8:65395153-65395175 CCGCTCATGATGCCAAGGGTAGG + Intergenic
1046463354 8:114570828-114570850 CCTCTCCTCTTCTCAAGGAGAGG + Intergenic
1047164374 8:122420838-122420860 CATCTTCTGTTTCCAATGATTGG - Intergenic
1048118796 8:131555674-131555696 GCTCTCTTCTTGCCCAGGATAGG - Intergenic
1048185581 8:132237564-132237586 CCTTGCCTGTTGCCAAGCCTGGG - Intronic
1048291419 8:133184552-133184574 CCTCACCTGTGGCCAAGACTGGG + Intergenic
1049006924 8:139861671-139861693 CCTCTCCAGTGGCCTAGAATGGG - Intronic
1051047223 9:12889142-12889164 GCTCTCCTCTGGCCAAGGGTAGG - Intergenic
1051944311 9:22548617-22548639 CCCCTCCTGTTGCCATAGAGGGG + Intergenic
1052769678 9:32676205-32676227 CCTCCCATGATGCCAATGATGGG - Intergenic
1056025643 9:82491756-82491778 CCTTTCCTGTTGTCAAGTATAGG + Intergenic
1057095965 9:92309899-92309921 CTTCTTCTCATGCCAAGGATGGG + Intronic
1060416399 9:123433864-123433886 CTTCTCCTGTGCCCAAGGATGGG - Intronic
1060966897 9:127716618-127716640 CCTCTCCTGTGGTCAAGGTCAGG - Exonic
1061217643 9:129231133-129231155 CAAGTCCTGATGCCAAGGATGGG - Intergenic
1061744944 9:132732809-132732831 CCTCTTCTCTTGCCTAGGCTGGG + Intronic
1061873629 9:133533450-133533472 CCTCTCCAGTAGGCAAGGCTGGG - Intronic
1187699190 X:21948344-21948366 CCTCTCTTGTTAGCCAGGATGGG - Intronic
1189328703 X:40129708-40129730 CCACTCCTGCTCCCAAGGAAAGG - Intronic
1193721369 X:84991194-84991216 CCTCTATTGTTGCCAGGGACTGG - Intergenic
1194719532 X:97323870-97323892 TCGCTCCTGTTGCCCAGGCTGGG - Intronic
1195162569 X:102185035-102185057 TCTCTCCTGTTGCCATGGCTGGG - Intergenic
1195165814 X:102219335-102219357 CTTTGTCTGTTGCCAAGGATGGG + Intronic
1195193044 X:102467756-102467778 CTTTGTCTGTTGCCAAGGATGGG - Intronic
1195902717 X:109815520-109815542 CTTCTCCAGTTGCTAATGATGGG + Intergenic
1196181866 X:112701063-112701085 CCTTTCATGTTGCCAAGCCTGGG + Intergenic
1197708884 X:129652544-129652566 CTTCTCCTGGAGCCAAGGAAGGG - Intronic
1198458728 X:136842943-136842965 TCGCTCCTGTTGCCCAGGCTGGG - Intergenic
1200904792 Y:8470901-8470923 CCTCTCCTGAAGCCAGGCATAGG - Intergenic