ID: 1163823017

View in Genome Browser
Species Human (GRCh38)
Location 19:19507108-19507130
Sequence TTTTTTGTGCATAACTTGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 324}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163823015_1163823017 0 Left 1163823015 19:19507085-19507107 CCAAATTTCTCACTAATTTTTGT 0: 1
1: 0
2: 5
3: 92
4: 716
Right 1163823017 19:19507108-19507130 TTTTTTGTGCATAACTTGGATGG 0: 1
1: 0
2: 0
3: 21
4: 324
1163823014_1163823017 1 Left 1163823014 19:19507084-19507106 CCCAAATTTCTCACTAATTTTTG 0: 1
1: 0
2: 1
3: 68
4: 923
Right 1163823017 19:19507108-19507130 TTTTTTGTGCATAACTTGGATGG 0: 1
1: 0
2: 0
3: 21
4: 324
1163823013_1163823017 2 Left 1163823013 19:19507083-19507105 CCCCAAATTTCTCACTAATTTTT 0: 1
1: 1
2: 10
3: 92
4: 756
Right 1163823017 19:19507108-19507130 TTTTTTGTGCATAACTTGGATGG 0: 1
1: 0
2: 0
3: 21
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163823017 Original CRISPR TTTTTTGTGCATAACTTGGA TGG Exonic
901329436 1:8393886-8393908 TTTTTTGTTTATAATTTGAAGGG + Intronic
905767155 1:40610635-40610657 TCTTTTGATCATAGCTTGGATGG - Intergenic
906404498 1:45530978-45531000 TTTTTCGTGCAAAACTTGTCGGG + Intergenic
906662999 1:47595699-47595721 TTTAGTGTGCATCACCTGGAGGG + Intergenic
906671216 1:47656475-47656497 TTTTTTGTGCATATCTTCACTGG - Intergenic
906721006 1:48004566-48004588 TTTGTTTGTCATAACTTGGAAGG + Intergenic
907169285 1:52446657-52446679 TTTTTTATGCAGATCTTTGATGG - Exonic
907689968 1:56653840-56653862 TCTTCTGTGCATCACTTGGAAGG + Intronic
907891840 1:58644250-58644272 ATTTTTGTGCATTGCTTGAAAGG + Intergenic
908701223 1:66903157-66903179 TTTCTTGTTCATAGATTGGAAGG - Intronic
908906829 1:69023038-69023060 TGTTTTGAGTAAAACTTGGAAGG - Intergenic
909081076 1:71112479-71112501 TTTTTGGCATATAACTTGGAAGG - Intergenic
910796538 1:91103009-91103031 GTTTTTGAGGATAACTTGGTGGG + Intergenic
911873012 1:103123125-103123147 TCTTTTGTGCATATCCTTGAGGG - Intergenic
912525030 1:110276285-110276307 TTTTTTTTGTATAAATTGAAAGG - Intronic
912706072 1:111913924-111913946 TCTTTTTTGCATAACTTGTGGGG - Intronic
915284346 1:154843297-154843319 TTTTTTGTCTAGAACCTGGATGG - Intronic
917077838 1:171224054-171224076 GTTTTTGTGTAAAACTTCGACGG - Intergenic
917273355 1:173303190-173303212 TTTGTTGTGCTTATCTGGGAGGG + Intergenic
917501192 1:175586675-175586697 TTTTTTCTCCATAGGTTGGAGGG - Intronic
917592784 1:176494381-176494403 TTTCTCATGCTTAACTTGGAAGG - Intronic
918167459 1:181964035-181964057 TTTTGAGTGTATAACTGGGATGG - Intergenic
918622447 1:186621106-186621128 ATTCTTGTGCAAAACTTGGAGGG + Intergenic
918945278 1:191056711-191056733 TTTTTTGAGCAGAACTGGGAGGG - Intergenic
919010235 1:191950586-191950608 TTTTTTTGACATAACTTGCAGGG - Intergenic
920281173 1:204844865-204844887 TTTGTTGTGCTTATCTGGGAGGG + Intronic
921388859 1:214599349-214599371 TTTGGGGTGCATAACTGGGAAGG + Intergenic
921824769 1:219660541-219660563 TTTTTAGTGCAAAATTTTGAGGG - Intergenic
922036738 1:221855898-221855920 TTTTTTGTCCATTACTTGCTTGG - Intergenic
922381772 1:225036503-225036525 TTTGTTGTGCTTATCTGGGAGGG + Intronic
923697229 1:236264987-236265009 TTTTTTGTGTATAAATTTAAGGG - Intronic
924040987 1:239983632-239983654 TTTTTATTCAATAACTTGGAAGG + Intergenic
924045058 1:240020569-240020591 TTTTTTGTGTTTTACTTAGAAGG - Intronic
924402562 1:243702095-243702117 TTTTTTTTGCATAAATTCTATGG - Intronic
924601969 1:245498934-245498956 TTTTTTGTGCATGTGTTAGATGG + Intronic
924611471 1:245577289-245577311 TTTGTTGGTCACAACTTGGAGGG - Intronic
1063062769 10:2575225-2575247 TTTTTTTTTCATATCTTGAATGG + Intergenic
1063587768 10:7368076-7368098 TTTTTTGTTCTTAACGTGGCTGG - Intronic
1065090167 10:22224116-22224138 TTTGTTGTAGATAACTTGGGAGG + Intergenic
1065701104 10:28426293-28426315 TTTATTGTTCAAAACTTTGAAGG - Intergenic
1068310856 10:55272791-55272813 TCTTTTTTGCTTTACTTGGATGG + Intronic
1068327908 10:55518722-55518744 TTTGTTGTGCTTATCTGGGAGGG - Intronic
1068800022 10:61130193-61130215 TTCTTTGTGTATAAAATGGAAGG - Intergenic
1070848141 10:79540595-79540617 ATTTTTAAGCATAACTTGGTAGG + Intergenic
1070925636 10:80219574-80219596 ATTTTTAAGCATAACTTGGTAGG - Intergenic
1071226510 10:83536271-83536293 TGTTTTATGCATAGTTTGGAAGG + Intergenic
1071708755 10:88027899-88027921 TTTTTTGCGCATATATTAGAGGG - Intergenic
1071892623 10:90028232-90028254 TTTGTTGTGCTTATCTGGGAGGG + Intergenic
1072156964 10:92732527-92732549 TTTATTGTGCCTAACCTGTAGGG + Intergenic
1076281868 10:129253095-129253117 TTTTTGGTGCATTTCTTTGAAGG - Intergenic
1077863428 11:6203161-6203183 TTTTTTTTGTATAAATTTGAAGG + Intergenic
1078286799 11:9964874-9964896 TTTTTTTTGCATAAATTTAAGGG + Intronic
1079042038 11:17068006-17068028 TTTTTTTTCCAGAACTTGGAAGG - Intergenic
1079246828 11:18758543-18758565 TTATTTGCTCATGACTTGGAGGG - Intronic
1080489552 11:32748281-32748303 ATTTTTGTGCATCTCTTGTATGG + Intronic
1081267433 11:41043085-41043107 TTTTTTTTGCATGACGAGGAAGG + Intronic
1081791965 11:45794511-45794533 ATTTCTTTGCATAACTTGGCTGG - Intergenic
1082575440 11:54797951-54797973 TATTCTGTGCATGGCTTGGAGGG + Intergenic
1082732561 11:56817992-56818014 TTTGTTGTGCTTATCTGGGAGGG - Intergenic
1082913648 11:58406582-58406604 TTTTTTGTTCATATCTTTGGAGG + Intergenic
1082938332 11:58677281-58677303 TAGTTTATGCATAACTTGGCGGG + Intronic
1084374395 11:68766171-68766193 GTTATTGTGCATAACCTTGAAGG + Intronic
1085159882 11:74330706-74330728 TTTGTTGTGACTCACTTGGAAGG + Exonic
1085960090 11:81451639-81451661 TTTCTTGTTCATTGCTTGGAAGG - Intergenic
1086569955 11:88271096-88271118 TTTTTTGAGCATCAATTGAAAGG - Intergenic
1088500088 11:110474393-110474415 TTTTTTTTTCATACTTTGGAAGG + Intergenic
1092347890 12:7731291-7731313 TTTGTTGTGCTTATCTGGGAGGG - Intronic
1093074469 12:14743416-14743438 TTTATTGTGCTTATCTGGGAGGG + Intergenic
1093422545 12:18991704-18991726 TTTTCTCTGAATAACCTGGACGG + Intergenic
1093449646 12:19300621-19300643 ATTCTTGTTCAAAACTTGGAAGG + Intronic
1094178602 12:27567209-27567231 TCTTCAGTGAATAACTTGGAAGG + Intronic
1095141595 12:38669899-38669921 TTTGTTGTGCTTACCTGGGAGGG - Intronic
1095265313 12:40149782-40149804 TTTTTTCTTTATAAATTGGATGG - Intergenic
1095314982 12:40749515-40749537 TTTTTTGTTAATAACCTGGTAGG + Intronic
1095582489 12:43816075-43816097 TATTTTGTGCACAAATTGTAAGG + Intergenic
1095784988 12:46100422-46100444 TTGTTTATGCATATCTTGCAGGG - Intergenic
1096448697 12:51719030-51719052 TTTTTGGTATATAACTTGGAAGG + Intronic
1096534178 12:52260331-52260353 TTTGTTGTGCTTATCTGGGAGGG + Intronic
1097569638 12:61317070-61317092 TATTCTGTGCATGGCTTGGAGGG + Intergenic
1097970548 12:65628531-65628553 TTTTCAGAGCAAAACTTGGAAGG + Intergenic
1098647901 12:72927947-72927969 TTTTTTGTGGATAAATTTAAGGG + Intergenic
1099721537 12:86367427-86367449 TTTGTTGTGCTTATCTGGGAGGG - Intronic
1099803703 12:87490058-87490080 GTTTTTGTACATAGCTTTGAGGG - Intergenic
1099865177 12:88271043-88271065 TTTTCTGTGCCTTACTGGGAGGG - Intergenic
1102161507 12:110772784-110772806 TTTGTTGTGCTTATCTGGGAGGG + Intergenic
1102913498 12:116736843-116736865 CTTTTTGTGCATAACTTGATTGG - Intronic
1103245936 12:119457309-119457331 CTTTTTGATCATAAATTGGATGG - Intronic
1103545338 12:121697036-121697058 TCTTTTGTGCATAAAATGTACGG - Intergenic
1105447124 13:20467423-20467445 TTTTTTCTCCTTAAATTGGATGG + Intronic
1106682895 13:32026450-32026472 TTTTTGATGCATGATTTGGACGG - Intergenic
1107691608 13:42958945-42958967 ATTTTTATGCATGAATTGGATGG - Intronic
1109006103 13:56879800-56879822 TTTTTTTTTAATAATTTGGATGG - Intergenic
1109101608 13:58191423-58191445 GTTTTAGAGCAAAACTTGGATGG - Intergenic
1109790069 13:67234655-67234677 TTTTTTCTGCATCACATGTAGGG + Intergenic
1109889030 13:68582902-68582924 TTTGTTGTGCTTATCTGGGAGGG + Intergenic
1110332263 13:74286515-74286537 TTCTTGGTGCATAAATTAGAAGG + Intergenic
1111359481 13:87156631-87156653 TGTTTTAAGCATAACTTGTAAGG + Intergenic
1112548719 13:100398618-100398640 TTTTTTGTGCCAAATTTGGCAGG + Intronic
1113588722 13:111483337-111483359 TTCTTTGTCCAGAACTGGGAGGG + Intergenic
1114186286 14:20404878-20404900 TATTTTGTGGACAACGTGGAGGG - Intronic
1114214138 14:20643068-20643090 TTTGTTGTGCTTATCTGGGAGGG - Intergenic
1115530006 14:34318415-34318437 TTACTTGTGCAGAATTTGGATGG - Intronic
1115695686 14:35896512-35896534 TTTTTTGAGCATATATTGTAAGG + Intronic
1116397425 14:44463344-44463366 TTTGTTGTGCTTATCTGGGAGGG + Intergenic
1116916832 14:50532923-50532945 TTTTCCGTGTTTAACTTGGAGGG - Intronic
1118238154 14:64029895-64029917 GATTCTGTGCAAAACTTGGACGG + Exonic
1118264743 14:64284250-64284272 TTTTTAGAGCATAAATTGAAGGG - Intronic
1120509829 14:85399637-85399659 TTTTTTTTGCATTACTTGTGGGG - Intergenic
1121253467 14:92515432-92515454 TTTTTTGTTCATTACTGGGTCGG + Intronic
1123397164 15:19948555-19948577 TATCCTGTGCATATCTTGGAGGG + Intergenic
1123770878 15:23527073-23527095 TTATTGGTGCATATCTTGCAGGG + Intergenic
1124035560 15:26050780-26050802 TTTTTTGTTCATATCCTGGGGGG + Intergenic
1124136085 15:27037515-27037537 TTTGTTGTGCTTATCTGGGAGGG + Intronic
1125750653 15:42025415-42025437 TTTGTTGTGCTTATCTGGGAGGG + Intronic
1127400443 15:58580080-58580102 TTTTTTTTTCATAACTTTGCTGG + Intergenic
1128009238 15:64276338-64276360 ATTTTTATGCATAACTTCAAAGG + Intronic
1129571518 15:76690080-76690102 TTTTTTTTCCATATCTTGGAAGG - Intronic
1129810542 15:78506797-78506819 TTTGTTGTGCTTATCTCGGAGGG + Intergenic
1130176807 15:81581525-81581547 ATTTTTGTCATTAACTTGGAAGG + Intergenic
1130837869 15:87669383-87669405 GTTTTTATGGATAACTTGGTGGG - Intergenic
1131333485 15:91524555-91524577 TTTGTTGTGCTTATCTGGGAGGG - Intergenic
1136024097 16:27458988-27459010 ATTTCTGTGCAGAGCTTGGAGGG + Intergenic
1136598640 16:31269055-31269077 GTTTTTGAGGATAACTTGGTAGG + Intronic
1137349169 16:47695901-47695923 TATTATGTGCAGAACTGGGAAGG - Intronic
1137515683 16:49141525-49141547 TTTTTTGTGCATGACCTGCATGG - Intergenic
1138967526 16:62103139-62103161 TTTGTTGTGCTTATCTGGGAGGG + Intergenic
1140632209 16:76866949-76866971 TTTTTTTTTCATCACTTGCAGGG + Intergenic
1141011922 16:80409500-80409522 TTCTCTGTGCATCATTTGGATGG - Intergenic
1144389748 17:14783002-14783024 TTTAATGTGCATAGCGTGGAGGG + Intergenic
1144478564 17:15610364-15610386 TTTGTTGTGCTTATCTGGGAGGG + Intronic
1144919731 17:18753366-18753388 TTTGTTGTGCTTATCTGGGAGGG - Intronic
1145281607 17:21471661-21471683 TTTTTGGTCTATAACTTTGAAGG + Intergenic
1146732345 17:35204599-35204621 TATCCTGTGCATGACTTGGAGGG - Intergenic
1147519300 17:41154166-41154188 TTTGTTGTGCTTATCTGGGAGGG - Intergenic
1150870641 17:68906574-68906596 TTTTTTGAGAATTAATTGGATGG + Intronic
1153640594 18:7153620-7153642 TCTTTTTTGAATAACTTGTATGG + Intergenic
1153829975 18:8913540-8913562 TTTTTAGTGTATAAATAGGAAGG - Intergenic
1154324822 18:13382365-13382387 GTTTTTGTGAATAACTGGTAAGG + Intronic
1155547032 18:26926536-26926558 TTTTTCCTACAAAACTTGGAAGG - Intronic
1155859945 18:30885000-30885022 TTTTTTCTGCATCATGTGGAAGG - Intergenic
1156151777 18:34251540-34251562 TTGCTTGTGCATGACTTGTAGGG + Intergenic
1157126720 18:44963210-44963232 TTCTTTAGGGATAACTTGGAAGG - Intronic
1161823951 19:6549747-6549769 TTTTCTGTACATATCTTGAAGGG + Intergenic
1162051047 19:8033299-8033321 TTTGTTGTGCTTATCTGGGAGGG + Intronic
1163823017 19:19507108-19507130 TTTTTTGTGCATAACTTGGATGG + Exonic
1165390129 19:35533990-35534012 TGTTTTGTGCATCACAGGGAGGG - Intronic
1166235843 19:41455715-41455737 ATTTTTATGGATAATTTGGAAGG + Intergenic
1167847119 19:52173707-52173729 TTTTTTGAGCCTAGGTTGGAGGG - Intergenic
1168366116 19:55789066-55789088 TCTTTTGCCCAAAACTTGGAGGG - Intronic
925726749 2:6880400-6880422 TTTGTTGTGCTTATCTGGGAGGG + Intronic
926400286 2:12489611-12489633 TTTTTTGTGTGTCACTGGGAGGG - Intergenic
928418164 2:31113998-31114020 TTTGTTGTGCTTATCTGGGAGGG - Intronic
929627037 2:43420010-43420032 TTTATGATTCATAACTTGGAAGG - Intronic
930599172 2:53424124-53424146 TTTGTTGTGCTTATCTGGGAGGG + Intergenic
931798415 2:65734362-65734384 TTTTTTTTGCAGGACATGGATGG - Intergenic
932030537 2:68179079-68179101 TTGCTTGTGCATATCTTGGCTGG - Exonic
933860852 2:86465730-86465752 TTTTGTGTGAATATCTTTGAAGG + Intronic
933943116 2:87261744-87261766 TTTTATGTGAATGACTTGCATGG + Intergenic
935556765 2:104518872-104518894 TTTTTTTTGCATAAATTTAAGGG - Intergenic
936337096 2:111599819-111599841 TTTTATGTGAATGACTTGCATGG - Intergenic
940061035 2:149568441-149568463 TTTTATTTTCATAATTTGGAGGG - Intergenic
941820504 2:169840042-169840064 TTTGTTGTGCTTATCTGGGAGGG + Intronic
942852927 2:180511970-180511992 TTTTTTTTACATATCTTGGAGGG - Intergenic
945123149 2:206479986-206480008 TATTTGGTGAATTACTTGGAAGG + Intronic
945606133 2:211934560-211934582 TTTTTTGTGGATGAGGTGGAAGG - Intronic
945846475 2:214950924-214950946 CTTTTTGTGGATAAGTTGGTAGG + Exonic
946680118 2:222204986-222205008 TTTTGTTTGCATAACTTTGAAGG + Intronic
947189062 2:227482520-227482542 TTTTTAGTAAATAACTAGGATGG + Intronic
947386901 2:229599527-229599549 TTTGGTTGGCATAACTTGGAAGG - Intronic
948745264 2:240087505-240087527 TTTGTTGTGCTTATCTGGGAGGG + Intergenic
1170030342 20:11937848-11937870 TCCTTGGTGCAGAACTTGGAGGG - Intergenic
1170122588 20:12926709-12926731 TTTGTTGTGCTTATCTGGGAAGG - Intergenic
1170204797 20:13786328-13786350 TTTTTTGTGTCTCACTTGTAAGG + Intronic
1170472866 20:16685690-16685712 CTTTTTGCGCATAATATGGATGG - Intergenic
1172021527 20:31917939-31917961 TTTATTGTGCTTATCTGGGAGGG + Intronic
1172172713 20:32950589-32950611 TTTGTTGTGCTTATCTGGGAGGG + Intronic
1172470696 20:35192470-35192492 TTTGTTGTGCTTATCTGGGAGGG + Intergenic
1172853894 20:37986401-37986423 TTTTATGTGGATATCTTGCAGGG - Intronic
1173450310 20:43157893-43157915 TTTTTGTTGGAAAACTTGGAAGG - Intronic
1174094004 20:48073503-48073525 TTTTTGGCACATAACCTGGAAGG - Intergenic
1174655178 20:52165911-52165933 TTTTTGGTGCGTGACTTGGCAGG + Exonic
1175239485 20:57536322-57536344 TTTGTTGTGCTTATCTGGGAGGG - Intergenic
1179180118 21:39037674-39037696 TTCTTTGTGCAGATCTTAGAGGG - Intergenic
1179231306 21:39506292-39506314 TGTTTTGAGCATATCCTGGAAGG + Intronic
1181714630 22:24715351-24715373 TTTTTGGTTCACAACTTGGGTGG - Intergenic
1182500059 22:30740157-30740179 GTTTTTAAGGATAACTTGGAGGG + Intronic
1182744904 22:32598047-32598069 TTATTAGTACATAACTAGGAGGG - Intronic
950875907 3:16272837-16272859 TTTTTTTTTCATAATTTGCAAGG - Intronic
951868303 3:27332373-27332395 ATTTTTGTGAATATATTGGAAGG + Intronic
953246156 3:41195549-41195571 TTTTTTCTGAATACTTTGGAAGG + Intronic
953303362 3:41802035-41802057 ATTTTTGTGCATAAATTTGTAGG - Intronic
954921844 3:54198135-54198157 TTACTTGTGCATAACAAGGACGG + Intronic
956378337 3:68639549-68639571 TTTTGTCTGCATACTTTGGAGGG - Intergenic
956613834 3:71151701-71151723 TTTTTTGGTCATACCTTGCACGG + Intronic
957142091 3:76373427-76373449 TTATATGTGCATAATTTGGATGG + Intronic
957902708 3:86516174-86516196 TATTTTGTCCATAACTTCAAAGG + Intergenic
957980883 3:87509374-87509396 TTTGTTGTGCTTATCTGGGAGGG + Intergenic
958906144 3:99944201-99944223 TATTTTGTGCCTAACTGAGATGG + Intronic
959100067 3:102000329-102000351 TTTCATGTGCATGATTTGGAAGG + Intergenic
959153834 3:102641839-102641861 TTTTTTCTACAAAACTTGGATGG + Intergenic
959295263 3:104527555-104527577 TTTTTTAAGGATAACTTGGTGGG - Intergenic
960192841 3:114727609-114727631 TTTCTCATGCATAACTTCGAGGG + Intronic
960620904 3:119635857-119635879 GTTGATGTGCATAACGTGGAAGG + Intergenic
961147026 3:124602676-124602698 TTTTCTTTGCCTAACTTAGATGG - Intronic
961335127 3:126171374-126171396 TTTGTTGTGCTTATCTGGGAGGG - Intronic
961758051 3:129142458-129142480 TTTTTTGTGAACCACTTGAAAGG - Intronic
963314252 3:143742274-143742296 TTTTTTAAGGATAACTTGGTGGG - Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
966083894 3:176042891-176042913 TTTTTATTTCATAACTTAGATGG - Intergenic
969939144 4:10712993-10713015 TTTTTTAAGCATAACTTGGTGGG - Intergenic
970388159 4:15577715-15577737 TTTTTTTTTTTTAACTTGGAAGG + Intronic
970410315 4:15800071-15800093 TTTGTTGTGCTTATTTTGGAGGG - Intronic
971026789 4:22596946-22596968 TTTTTCCTGCAAAACTTGGAAGG - Intergenic
971661841 4:29428203-29428225 TTTTTTGTGCATTGCTATGAAGG - Intergenic
971850887 4:31985369-31985391 ATTTTTGTGCATATCTTGAAGGG + Intergenic
972213176 4:36863092-36863114 TGTCTTTTGCACAACTTGGATGG + Intergenic
972682070 4:41315791-41315813 GTTTTTGTGGACAACTTGGTGGG + Intergenic
972986890 4:44775649-44775671 TTTTTTTTGCCTAGCTTAGAGGG + Intergenic
973041583 4:45475986-45476008 TTTGTTGTGCTTATCTGGGAGGG - Intergenic
973585466 4:52385885-52385907 ATTTTTGTTCATCACTTGTATGG + Intergenic
973901310 4:55475168-55475190 TTACTTGTGGATAACTTTGAGGG + Intronic
974351928 4:60759534-60759556 TTTGTTGTGCTTATCTGGGAGGG - Intergenic
975423290 4:74195337-74195359 TGTTTTGTGAATAAATTGTATGG + Intronic
975430067 4:74278854-74278876 TTTTTAATGAATAATTTGGAAGG - Intronic
976298546 4:83496177-83496199 TTTGTTGTGCTTATCTGGGAGGG + Intronic
978746298 4:112197890-112197912 GTTTTTGTGCATAACTGGGTTGG - Intergenic
981131048 4:141158853-141158875 TTATCTGTGAATAAATTGGAAGG - Intronic
981485516 4:145282068-145282090 TTTTTCTTGCATAAGTTGCATGG - Intergenic
981536941 4:145809835-145809857 TTTTTTATGGATAATTTGGTGGG - Intronic
982389411 4:154848289-154848311 TTTGTTGTGCTTATCTGGGAGGG + Intergenic
982793528 4:159619534-159619556 TCTTTTATGAATAACTTGAATGG + Intergenic
983164836 4:164462477-164462499 TGTTTTGTGCATAAATGGCATGG - Intergenic
983419459 4:167499643-167499665 TTTTTTTTGCAGGACATGGATGG - Intergenic
985348654 4:189034896-189034918 TTTTTTTTGTTTAAATTGGAAGG + Intergenic
985813925 5:2112096-2112118 TTCTTTGTGGCTAATTTGGAGGG - Intergenic
985842131 5:2315086-2315108 TTATTTGTGTATAAATTGTAAGG + Intergenic
986674748 5:10173872-10173894 TTTTTTCTGCTTGACCTGGAGGG - Intergenic
986748205 5:10761830-10761852 TTTTTGGTTCATAACGAGGAGGG - Intergenic
986819624 5:11450957-11450979 TTTTTTGTCCAAAACTGTGAAGG - Intronic
986953159 5:13115780-13115802 TTTTTTCTTCACAACTTAGATGG + Intergenic
988074212 5:26332227-26332249 GATTTTGTGCATGACCTGGATGG - Intergenic
988118537 5:26928368-26928390 TTTTATGTTCATAGTTTGGAAGG + Intronic
989196147 5:38718578-38718600 TTTTTTCTGGATAACTTTGCAGG + Intergenic
989458919 5:41673832-41673854 TTTTTTGTACATAAATTCCATGG + Intergenic
990798707 5:59574327-59574349 TTATATGTGCATAACTTATAGGG - Intronic
991269313 5:64760587-64760609 TTTGTTGTGCTTATCTGGGAGGG - Intronic
991468967 5:66947232-66947254 TTTTTTCTGCATGACTTTTATGG + Intronic
991654026 5:68884953-68884975 CTTTTTTTGCATAACTTGATGGG - Intergenic
992507935 5:77406497-77406519 TTTTTGGAGCAGAACTTGAAGGG + Intronic
992716645 5:79517282-79517304 TTTTTTCTACATAAATTGAATGG + Intergenic
994828844 5:104750909-104750931 TTTTGTGTGCATAATTTAGTGGG + Intergenic
994854810 5:105104572-105104594 TTTTTTGTAGATCACTTGAAGGG - Intergenic
995503947 5:112839287-112839309 TACTCTGTGCAGAACTTGGATGG - Exonic
995714392 5:115068028-115068050 TTTGTTGTGCTTATCTGGGAGGG + Intergenic
995752057 5:115462426-115462448 TTTTTTGTGTGTAATTTGAATGG + Intergenic
996369954 5:122742557-122742579 TTTTTTGCGCAATATTTGGAGGG - Intergenic
996932138 5:128902738-128902760 TTTTTGATGCATTTCTTGGAGGG - Intronic
998663842 5:144272927-144272949 TTTTTTGGGCATAACATCAAAGG + Intronic
998715719 5:144881935-144881957 ATTTTTGTCAATAACTAGGATGG + Intergenic
998903997 5:146884207-146884229 TTTATTGTACAGAAATTGGAGGG - Intronic
1002253091 5:177941598-177941620 TTTGTTGTGCTTATCTGGGAGGG - Intergenic
1002649276 5:180679884-180679906 TTTGTTGTGCTTACCTGGGAGGG - Intergenic
1003662387 6:8074842-8074864 TTTATTGTGCACAACATTGATGG - Intronic
1003923949 6:10859472-10859494 ATTATTCTCCATAACTTGGATGG + Intronic
1004223016 6:13762714-13762736 TCTTTTGAGCATAAAATGGAGGG + Intergenic
1004546053 6:16599222-16599244 TTCTTGGTTCATACCTTGGAAGG - Intronic
1005731721 6:28703858-28703880 TTTTTGTTGCATTACTTGAAAGG - Intergenic
1006244164 6:32715711-32715733 TTTGTTGTGCTTATCTAGGAGGG + Intergenic
1008751686 6:54741475-54741497 TTTTTTTTGCAGATCTTGGTTGG + Intergenic
1011703599 6:89979379-89979401 TTCTTTGTGCAAGAATTGGAGGG - Intronic
1012545636 6:100416044-100416066 TTTGTTGTGCTTATCTGGGAGGG - Intronic
1012781940 6:103571623-103571645 TTTTTTGTACAGAATTTGTAAGG + Intergenic
1012953824 6:105547249-105547271 TTTCTTGTTCATAACTAGAAGGG - Intergenic
1013885009 6:114952753-114952775 TTTGTTGTGCTTAACTGGGAGGG - Intergenic
1014073696 6:117213081-117213103 TTTTTTGTGTATCTCTTGTATGG + Intergenic
1014302346 6:119697931-119697953 TTTTTGGCACATAACTTGGAAGG - Intergenic
1014957832 6:127642971-127642993 TTTGTTGTGCTTATCTGGGAGGG + Intergenic
1015294365 6:131573902-131573924 CTTTATGTGCCTCACTTGGAAGG + Intronic
1015861825 6:137689467-137689489 TTATATGTGCAAAATTTGGAAGG + Intergenic
1018622506 6:165744570-165744592 TTTTTTTTTCATAAATTTGAAGG + Intronic
1018999825 6:168740779-168740801 TCTTTTGGTCCTAACTTGGACGG - Intergenic
1020595009 7:10195571-10195593 TTTTATGTACATCACTTTGATGG + Intergenic
1022281310 7:28912913-28912935 TATCTTCTGCACAACTTGGATGG + Intergenic
1023494187 7:40777261-40777283 TTTTTTCTACTTAACTTGAATGG + Intronic
1024338850 7:48237027-48237049 TTTTTTTTGGATAATTTGGTGGG + Intronic
1024421479 7:49172057-49172079 TATTTTGAGAATAACTAGGAAGG - Intergenic
1024428523 7:49259091-49259113 TTATTTGTGCATATATTTGAGGG - Intergenic
1024496788 7:50057325-50057347 TTTGTTGTGCTTATCTGGGAGGG - Intronic
1029825531 7:103188998-103189020 TTTTTTGTACATCAATTGTATGG - Intergenic
1029886324 7:103876156-103876178 TTTTTTAGGAATAACTTGTACGG + Intronic
1031510687 7:122644888-122644910 TTTTTAATGCATAATTTAGAAGG - Intronic
1031949882 7:127881303-127881325 TTTAATGTGCATAGCATGGAGGG - Intronic
1033322390 7:140351714-140351736 TTTTTTGTGCATCATTTTTATGG + Intronic
1033840519 7:145368048-145368070 AGTTTTGTGCCTATCTTGGAAGG + Intergenic
1034182453 7:149148643-149148665 TTTTTTGTGTATAGGTGGGATGG + Intronic
1036197230 8:6730214-6730236 TTTTTTTTGCATTTCTTGAAAGG - Intronic
1036223488 8:6939980-6940002 ATTTTTTGGCATAACTTGTAGGG + Intergenic
1036225463 8:6954131-6954153 TATTTTTTGCCTAACTTGTAGGG + Intergenic
1036236356 8:7042723-7042745 TAGTTTTTGCATAACTTGTAAGG + Intergenic
1037227779 8:16615050-16615072 TATTTTGTGCATATTCTGGATGG - Intergenic
1039419975 8:37429404-37429426 TTGTTTGTGAACAACTTTGAAGG - Intergenic
1039768328 8:40655327-40655349 TTTTGTGTTCATAAATTGGAAGG + Intronic
1039773784 8:40715883-40715905 GTTTTTCTCCATGACTTGGAGGG - Intronic
1041925229 8:63229345-63229367 TTTTTGTTGCATAATGTGGATGG - Intergenic
1042198381 8:66254214-66254236 TTTTTTGAGGATAATTTGGTGGG - Intergenic
1042630301 8:70808648-70808670 TATCCTGTGCATGACTTGGAGGG + Intergenic
1044119053 8:88371480-88371502 TTTTTTTTTCATTACTTTGAAGG + Intergenic
1044886617 8:96785157-96785179 GTTTTGGTACATAATTTGGATGG - Exonic
1046221335 8:111219282-111219304 TTTATTGTGCTTATCTGGGAGGG - Intergenic
1046786749 8:118275028-118275050 TGTTTTGTTCATAATTTTGAAGG + Intronic
1046980785 8:120334255-120334277 TTGTATGTGCATAACCTGTATGG - Intronic
1050046893 9:1556087-1556109 TTATTTGTGCTAAACTTTGAGGG - Intergenic
1053048645 9:34940267-34940289 TTTGTTGTGCTTATCTGGGAGGG - Intergenic
1055086833 9:72323077-72323099 TTTGTTGTGCTTATCTGGGAGGG + Intergenic
1056745200 9:89295694-89295716 TTTGTTGTGCTTATCTGGGAGGG - Intergenic
1056746094 9:89304343-89304365 TTTGTTGTGCTTATCTGGGAGGG - Intergenic
1057666754 9:97051875-97051897 TTTGTTGTGCTTATCTGGGAGGG + Intergenic
1058294449 9:103287817-103287839 TTTTTTGTGCAGAAGTTTGTTGG - Intergenic
1058453939 9:105121841-105121863 TTTGTTGTGCTTATCTGGGAGGG + Intergenic
1059821644 9:117980243-117980265 TTTTTTGCGGATAATTTGTAAGG - Intergenic
1185871508 X:3668656-3668678 TTTCTTCTACAGAACTTGGAAGG - Intronic
1186833215 X:13411808-13411830 TTTTTTGAGGATAATTTGGTGGG - Intergenic
1186913607 X:14195942-14195964 TTCCTTGTGCATATCTGGGATGG - Intergenic
1188575964 X:31650359-31650381 ATTTTTGTACATAGCTTTGAAGG + Intronic
1189661541 X:43305320-43305342 TTTTTGGTATATAACTTGGAAGG - Intergenic
1189772437 X:44439788-44439810 GTATTTGTGCTTAACTTGTATGG + Intergenic
1190071773 X:47285537-47285559 TTTGTTGTGCTTATCTGGGAGGG + Intergenic
1190072952 X:47293755-47293777 TTTGTTGTGCTTATCTGGGAGGG + Intergenic
1190496984 X:51036064-51036086 TTTTTTATGCATTACATGGCAGG - Intergenic
1191972738 X:66834970-66834992 TTTTTTGTGTATTGCTTGTATGG - Intergenic
1194007288 X:88511089-88511111 TTTTTTGTGCATACATTTGCTGG + Intergenic
1194499456 X:94661964-94661986 TTATCTGTGCATAACTTGTCAGG + Intergenic
1195174152 X:102298449-102298471 TTTTTTTTGCATAACTCACAAGG - Intergenic
1195184713 X:102388644-102388666 TTTTTTTTGCATAACTCACAAGG + Intronic
1195204699 X:102586036-102586058 ATTATTGTGCATAATTTGCAAGG + Intergenic
1195257152 X:103101919-103101941 TTTGTTGTGCTTATCTGGGAGGG - Intergenic
1196102221 X:111858576-111858598 TTTGTTGTGCTTATCTGGGAGGG + Intronic
1196616478 X:117771688-117771710 TTTCATATGCATTACTTGGAAGG + Intergenic
1197327417 X:125110629-125110651 TTTTTTCTGCAGAAATTGGATGG - Intergenic
1198931596 X:141867424-141867446 TTTGTTGTGCTTATCTGGGAGGG - Intronic
1198932203 X:141873211-141873233 TTTGTTGTGCTTATCTGGGAGGG + Intronic
1199279477 X:145983207-145983229 TTTTTTTAGAATAAATTGGAAGG + Intergenic
1200878141 Y:8181051-8181073 TTTGTTGTGCTTATCTGGGAGGG + Intergenic
1201971449 Y:19801944-19801966 TATTCTGTGCCTGACTTGGAGGG + Intergenic
1202104492 Y:21348561-21348583 TTTGTTGTGCTTATCTGGGAGGG + Intergenic
1202190038 Y:22232163-22232185 TTTGTTGTGCTTATCTGGGAGGG + Intergenic