ID: 1163826099

View in Genome Browser
Species Human (GRCh38)
Location 19:19525796-19525818
Sequence TGCACACAGCTGCCAGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 1, 2: 6, 3: 31, 4: 314}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163826099_1163826104 -1 Left 1163826099 19:19525796-19525818 CCTGTCCCTGGCAGCTGTGTGCA 0: 1
1: 1
2: 6
3: 31
4: 314
Right 1163826104 19:19525818-19525840 AGCCCCCGCAGGGCAGCACGCGG 0: 1
1: 0
2: 3
3: 22
4: 190
1163826099_1163826111 16 Left 1163826099 19:19525796-19525818 CCTGTCCCTGGCAGCTGTGTGCA 0: 1
1: 1
2: 6
3: 31
4: 314
Right 1163826111 19:19525835-19525857 ACGCGGAACTGTGGCCCAGGTGG 0: 1
1: 1
2: 0
3: 6
4: 79
1163826099_1163826113 21 Left 1163826099 19:19525796-19525818 CCTGTCCCTGGCAGCTGTGTGCA 0: 1
1: 1
2: 6
3: 31
4: 314
Right 1163826113 19:19525840-19525862 GAACTGTGGCCCAGGTGGCCGGG 0: 1
1: 0
2: 2
3: 28
4: 313
1163826099_1163826112 20 Left 1163826099 19:19525796-19525818 CCTGTCCCTGGCAGCTGTGTGCA 0: 1
1: 1
2: 6
3: 31
4: 314
Right 1163826112 19:19525839-19525861 GGAACTGTGGCCCAGGTGGCCGG 0: 1
1: 0
2: 2
3: 29
4: 339
1163826099_1163826109 7 Left 1163826099 19:19525796-19525818 CCTGTCCCTGGCAGCTGTGTGCA 0: 1
1: 1
2: 6
3: 31
4: 314
Right 1163826109 19:19525826-19525848 CAGGGCAGCACGCGGAACTGTGG 0: 1
1: 0
2: 0
3: 13
4: 129
1163826099_1163826110 13 Left 1163826099 19:19525796-19525818 CCTGTCCCTGGCAGCTGTGTGCA 0: 1
1: 1
2: 6
3: 31
4: 314
Right 1163826110 19:19525832-19525854 AGCACGCGGAACTGTGGCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163826099 Original CRISPR TGCACACAGCTGCCAGGGAC AGG (reversed) Intronic
900098478 1:950776-950798 TGCACACAACTGTCAGGGCAGGG + Intronic
900369984 1:2327970-2327992 TGCACACAGAAGCCTGTGACGGG - Intronic
900615326 1:3563113-3563135 TGCACACAGGGGGCAGGGGCAGG - Intronic
902174316 1:14637970-14637992 TGCTGGCAGCTGCCAGAGACGGG - Intronic
902688850 1:18096996-18097018 TGCAGGCAGCTCCCAGGGAGTGG - Intergenic
903769558 1:25755175-25755197 AGCTCACACCTGCCAGGGAACGG - Intronic
904274450 1:29371133-29371155 TGAACACATCTGCCAAGGACTGG - Intergenic
904292963 1:29499429-29499451 TGAACAGAGCTGCCAGTGTCGGG + Intergenic
904337212 1:29805698-29805720 ACCACACTGCTGCTAGGGACTGG - Intergenic
904423569 1:30409439-30409461 TGAATACTTCTGCCAGGGACCGG + Intergenic
904921640 1:34012872-34012894 TCAACATAGCTGCCAGGGCCTGG + Intronic
905365542 1:37449201-37449223 TGCACACAGCTGCCAGGGAGTGG + Intergenic
905782853 1:40727914-40727936 AGGACACAGCTGCCATAGACAGG - Intronic
905864573 1:41369716-41369738 TGCAGTCAGCACCCAGGGACTGG + Intronic
908601537 1:65744938-65744960 TGCACAGAGCAGCCAGGTCCTGG - Intergenic
908756335 1:67472246-67472268 TGCAGTCTGCTGCCAGGAACTGG - Intergenic
908923856 1:69229648-69229670 TCCACACTGCTGCCAGAGTCAGG + Intergenic
911302604 1:96193162-96193184 TGCACACTGGTGCAAGGGATGGG - Intergenic
911845486 1:102746777-102746799 TGAGGACAGCTGTCAGGGACAGG + Intergenic
912096399 1:106149908-106149930 TGCACAAAGCAGCCAGGCCCTGG - Intergenic
916203547 1:162294333-162294355 TCCCCACATCTCCCAGGGACGGG + Intronic
916529810 1:165646155-165646177 AGCAGATAGCTTCCAGGGACAGG - Intronic
916556945 1:165901421-165901443 TGCACAGAGAGGCCAGGGAACGG - Intronic
919513538 1:198494610-198494632 TGCACAGAGATGCCTGGGTCTGG + Intergenic
919882666 1:201911140-201911162 TGCACTCAAGTGCCAAGGACTGG + Intronic
920734323 1:208517040-208517062 TGCACACAGCACCCTGGGCCTGG + Intergenic
921708682 1:218352032-218352054 TGCACACCTCTCCCAGGGCCAGG - Intronic
921880477 1:220249712-220249734 TGCACAAAGCTGCAAGGCCCTGG - Intronic
921972592 1:221166390-221166412 GGCACAGAGCTGGCAGGGAAAGG + Intergenic
923233042 1:232006886-232006908 TGCACAAAGCTGCAAGGCCCTGG - Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1065833203 10:29633287-29633309 AGCACACATCTGCCTGGCACTGG + Intronic
1067314850 10:45151631-45151653 GTCACACAGCTTCCAGGCACTGG + Intergenic
1067344203 10:45426254-45426276 TGCACCCAGCAGCCAAGGAGTGG + Intronic
1067450604 10:46379844-46379866 TGCTCAAAGCAGGCAGGGACAGG - Intronic
1067586639 10:47479907-47479929 TGCTCAAAGCAGGCAGGGACAGG + Intronic
1067781929 10:49214013-49214035 TGCACACAGCAGCCAGAGCTGGG + Intergenic
1068881378 10:62052873-62052895 TGCAGTCAGCTCCTAGGGACTGG + Intronic
1069595482 10:69667272-69667294 TGGACACAGCAGCCAGAGCCTGG - Intergenic
1069639264 10:69944293-69944315 TCCTCACAGCAGCCTGGGACAGG + Intronic
1074299355 10:112219293-112219315 TGCACACAGGTGACAGGGCCTGG + Intergenic
1074308186 10:112298316-112298338 AGCACACAGCTGCCCTGGCCTGG - Intronic
1075234424 10:120713680-120713702 GGCACACAGCTGCCTGGGAAGGG + Intergenic
1076031224 10:127160447-127160469 TGAACACATCTTCCAGGGAGGGG - Intronic
1076138054 10:128058469-128058491 CCCACGCAGCTGCCCGGGACTGG + Intronic
1076407233 10:130220717-130220739 TGCTCACAGCTGACAAGGGCTGG - Intergenic
1077058008 11:605339-605361 TGCCCACAGCCCCCAGGGAGAGG - Intronic
1077171344 11:1167590-1167612 TGCCAGCAGCTGCCAGGGGCTGG - Intronic
1077223132 11:1426141-1426163 GGCACCCAGCTGCATGGGACGGG + Intronic
1077391999 11:2304522-2304544 TGGAAACAGCTCCCAGGGTCAGG - Intronic
1077498222 11:2896963-2896985 TGGACACTGGTGTCAGGGACTGG + Intronic
1078164485 11:8870840-8870862 TGGACACCGCTGCCGGGGCCGGG + Intronic
1080216706 11:29851219-29851241 TGCACACAGCTGTGAGAGACAGG + Intergenic
1080663284 11:34314556-34314578 TGCACACAGCTGCAAGGGAGAGG + Intronic
1083705551 11:64511937-64511959 CGGAGACAGATGCCAGGGACTGG - Intergenic
1084299283 11:68235839-68235861 TGCACACAGCTTGCAGGAGCCGG - Intergenic
1084570508 11:69956920-69956942 GGCACACAGCTGACAGTGGCTGG + Intergenic
1084615199 11:70231255-70231277 TGCACAGAGGAGCCAGGGAGGGG + Intergenic
1084667104 11:70582365-70582387 TGCACACATCTGCAAGTGACGGG + Intronic
1085459855 11:76686994-76687016 TGCCCACAGGTGCCAGGAACAGG + Intergenic
1085509636 11:77081772-77081794 GGCACCCAGCTGTCAGGGAGGGG + Intronic
1085696020 11:78705358-78705380 TGCACAGAGGTGCCTGGGAAAGG + Intronic
1086567131 11:88240085-88240107 AACACACAGCTGCAAGGAACAGG - Intergenic
1089168111 11:116493329-116493351 TGGACAATGCTGCCATGGACAGG + Intergenic
1089533891 11:119149307-119149329 TGCTCAGCGCTGCCACGGACCGG - Exonic
1090216865 11:124975082-124975104 TTCACTAAGCTGCCAGGGAAAGG - Exonic
1090408230 11:126490311-126490333 TGGACACAGCCGCTAGGGAGAGG + Intronic
1093516306 12:19990679-19990701 TGCTCACAGGCTCCAGGGACGGG - Intergenic
1095812672 12:46387106-46387128 TGCACACAGCAGGGAGGGGCAGG - Intergenic
1098519744 12:71421460-71421482 TCCACAGAGCTGGCAGGGGCTGG - Intronic
1100498273 12:95146130-95146152 AGCACACAGCTGTCAGGAAATGG - Intronic
1102304210 12:111792339-111792361 TGCAGAGAGCAGCCAGGGAGAGG - Intronic
1102635628 12:114321144-114321166 TGCTCATAGCTCCCAGAGACTGG - Intergenic
1102824503 12:115936717-115936739 TACAAAGAACTGCCAGGGACTGG + Intergenic
1103237368 12:119384667-119384689 TGCAGAGAGCTGCAAGGGGCTGG + Intronic
1103590702 12:121990238-121990260 TGCACACAGTGGCCAGGGATGGG - Intronic
1103599265 12:122043830-122043852 ATCCCACAGCTGCCAAGGACGGG - Intronic
1103838374 12:123842363-123842385 TGCACTCAGCTGCTAGGAGCAGG - Intronic
1104494093 12:129220372-129220394 TGCATCCAGTTGGCAGGGACTGG + Intronic
1104823853 12:131694540-131694562 TGCACACAGCTGCCTGTGCCTGG + Intergenic
1105028800 12:132868755-132868777 CACACGCAGCTGCCAGGGGCTGG + Intronic
1105720260 13:23106764-23106786 TTTGCACAGCTTCCAGGGACAGG - Intergenic
1106081130 13:26501025-26501047 TGCACACAACTGCCCGGCATGGG + Intergenic
1107808771 13:44179329-44179351 TGCCCACCTCTGCCAGGGGCTGG + Intergenic
1108788400 13:53935570-53935592 TGCATAGACCTGACAGGGACAGG - Intergenic
1112653047 13:101419014-101419036 TGCAAACACCTTCCAGGGCCAGG - Intergenic
1112700492 13:102002061-102002083 TGCACACAGCTGGCATCCACAGG - Intronic
1112861508 13:103833590-103833612 TGCACAAAGCAGCAAGGCACAGG - Intergenic
1114359857 14:21959453-21959475 TGCACAGGGCTGCCAAGCACTGG - Intergenic
1117512910 14:56471318-56471340 TGCACACACTGTCCAGGGACAGG - Intergenic
1119330553 14:73790113-73790135 TCCACACTGCTGCCAGGGCGAGG + Intronic
1119750786 14:77075945-77075967 GGCTGCCAGCTGCCAGGGACTGG - Intergenic
1119886967 14:78151544-78151566 TGCTCAGAGCTGCCAGGGCTTGG - Intergenic
1120947478 14:90012033-90012055 TGCACAAAGCGGCAAGGGCCTGG - Intronic
1121032599 14:90671996-90672018 TGCACAAGGGTGCCAAGGACAGG + Intronic
1122166293 14:99826800-99826822 TCCACACTGCTGCCAAGGAGTGG + Intronic
1122551140 14:102550657-102550679 TCCACACAGCTGCTGGGGCCTGG - Intergenic
1122688331 14:103520455-103520477 CTCACCCAGGTGCCAGGGACGGG - Exonic
1122773516 14:104107362-104107384 TGCACAGAGCTGCCTTGGACAGG + Intronic
1124645247 15:31433821-31433843 TGGCCTCGGCTGCCAGGGACTGG - Intronic
1125511048 15:40292479-40292501 TGCACAGTGCTGGCAGGAACGGG - Intronic
1125518193 15:40334594-40334616 GCCACACAGCTGGCAGGGTCTGG - Exonic
1125892092 15:43274455-43274477 TGCACGCAGCTGCTTGGGTCAGG - Intergenic
1126370307 15:47939029-47939051 TGTTCAGAGCTGCCAGGAACTGG - Intergenic
1126572442 15:50166583-50166605 TGCACACAGCTGACTGGACCAGG + Intronic
1126854302 15:52822997-52823019 TTCACATAGCTGCCAGGTAGAGG - Intergenic
1128073761 15:64813330-64813352 TGAGCACAGCTGCCAGGGGCAGG - Intergenic
1129931036 15:79411581-79411603 TGCACAGAGCTACCATGCACTGG + Intronic
1130044113 15:80430822-80430844 TGCCCACTGCTGCCCTGGACAGG - Intronic
1130642402 15:85690759-85690781 TGCACTATGCTGCCAGGGACTGG - Intronic
1131118078 15:89806511-89806533 TGCACACGGCTGCCACGCCCAGG + Exonic
1131880546 15:96857784-96857806 TGCACAGAGATGCGAGAGACAGG + Intergenic
1132383783 15:101385391-101385413 TGCCCACAGCAACCAGGAACGGG + Intronic
1132611985 16:821800-821822 AGCACCCAGCTGGCGGGGACAGG - Intergenic
1132691014 16:1182001-1182023 AGCACACAGCAGCCAGGGACAGG - Intronic
1133034437 16:3027109-3027131 GGCCCACAGCTGACAGGGCCCGG - Intronic
1133571225 16:7042326-7042348 TGTACACAGTTTCCAGGGTCAGG - Intronic
1137272080 16:46908419-46908441 TGCACACGCCTCCCAGGGCCTGG + Intronic
1137274963 16:46927371-46927393 AGCACACAGCTGCCAGTGCCTGG + Intronic
1137993670 16:53185702-53185724 TGCACACAGCAGGGAGGCACTGG - Intronic
1140804617 16:78521482-78521504 TTCACACAGGTGGCAGGTACTGG - Intronic
1141553673 16:84822705-84822727 TGCTCAGACCTTCCAGGGACAGG + Intronic
1145259054 17:21343907-21343929 TGCACACAGCAGCCTGGGCCTGG - Intergenic
1145317564 17:21744096-21744118 TGCACACAGCAGCCTGGGCCTGG + Intergenic
1145862020 17:28218864-28218886 TGCACAGAGCTTCCCGGGACTGG + Intergenic
1146001668 17:29134068-29134090 TGCACACAGCTTCCAAGGGTAGG - Intronic
1147631916 17:41937789-41937811 ACCACACTGCTGCCAGTGACAGG + Intronic
1147763931 17:42820182-42820204 TACCCACAGCTGCCAGTCACTGG - Intronic
1148242998 17:46012502-46012524 TGCCCCCAGATGCCAGGGGCTGG - Intronic
1149060784 17:52419257-52419279 AACAAACAGCTTCCAGGGACTGG - Intergenic
1149524134 17:57340858-57340880 TGCAAACAGTGACCAGGGACTGG - Intronic
1150133051 17:62679708-62679730 CGGTCACAGCTGCAAGGGACAGG + Intronic
1150503425 17:65673514-65673536 TAGTCACAGATGCCAGGGACTGG + Intronic
1150823938 17:68457740-68457762 CGCCCACAGCTGCCACGGATTGG - Intergenic
1151576853 17:74956827-74956849 TGCACACAGCTGCTGGGGAGAGG - Intronic
1151957771 17:77389012-77389034 GGGACAGAGCTGCCAGGCACAGG - Intronic
1152229914 17:79109295-79109317 TGGGCACAGCTGGCAGGGCCAGG + Intronic
1153646688 18:7202291-7202313 TGGCCACAGCTACCAGAGACTGG + Intergenic
1154133899 18:11759765-11759787 TGCACACATCTCCCAAGGAGAGG - Intronic
1154930973 18:20995683-20995705 TGCGCTGAGCTGCCAGGGAGAGG - Intronic
1156763309 18:40620102-40620124 TCCTCACAGATGGCAGGGACAGG - Intergenic
1159946916 18:74450760-74450782 TGGCCACAGCTGCCAGGTTCCGG + Intronic
1160010106 18:75100874-75100896 GGCACACTGCTGCAAGGGGCAGG + Intergenic
1161680289 19:5676712-5676734 TGCACACAGGTGCCAGTGGATGG + Intronic
1161723305 19:5915303-5915325 TGCTCACAGCTGCCAGGCACTGG - Exonic
1163291871 19:16384226-16384248 TGGACGCAGGTGTCAGGGACGGG + Intronic
1163765835 19:19162768-19162790 TGCACAGAGAGGCCAGGGCCGGG + Intronic
1163826099 19:19525796-19525818 TGCACACAGCTGCCAGGGACAGG - Intronic
1164609778 19:29624175-29624197 TGCACACAGCACCCACGAACAGG + Intergenic
1165013889 19:32866959-32866981 TGCTCCCAACTGCCTGGGACTGG + Intronic
1165364860 19:35359199-35359221 TGCTCACAGCTGCCAGGAAGAGG - Exonic
1165366679 19:35371668-35371690 TGCTCACAGCTGCCAGGAAGAGG - Exonic
1166383885 19:42369849-42369871 TCCACACATCTCCCTGGGACAGG - Intronic
1167853450 19:52219632-52219654 TGCACACAGCAACCCAGGACAGG - Intronic
1168311812 19:55464492-55464514 GGCACACAGCTCCCGGGGGCCGG + Intergenic
925128869 2:1480628-1480650 TGCACACATCAGCAAGAGACAGG + Intronic
925157280 2:1657720-1657742 TGCCCCCACCTGACAGGGACGGG + Intronic
925635906 2:5941324-5941346 GGCCCTCAGCTGCCAGGGCCAGG + Intergenic
926766411 2:16326133-16326155 TGCACACAGCCTCGAGTGACCGG + Intergenic
929381896 2:41364246-41364268 TGCTCAGAGCTGCCATGCACTGG + Intergenic
929603349 2:43218681-43218703 TGGGCACACCTGCCAAGGACAGG - Intergenic
929820273 2:45267680-45267702 TACACACAGCTGACAGAGAGTGG - Intergenic
930024809 2:47023595-47023617 TGCACACAGCAAGCAGGGATAGG + Intronic
931331199 2:61286061-61286083 TTCTCACTTCTGCCAGGGACAGG - Intronic
934706274 2:96483947-96483969 TGCACTCAGATGCCTGGGAAAGG + Intergenic
934970690 2:98761716-98761738 TGTGCACAGCTGCCCGGGAAAGG - Intergenic
936499580 2:113055344-113055366 TACACAAAGCTGCCAGGCCCTGG + Intergenic
936734707 2:115427111-115427133 GGCACACAGCTGCAAGGGGTGGG + Intronic
937173654 2:119903616-119903638 TGCCCACAGGTGCCAGTGGCAGG - Intronic
937252539 2:120533798-120533820 TTCCCACAGCTGCCGGGGACCGG + Intergenic
937587046 2:123565317-123565339 TGTGCTCAGCTGCCAGCGACTGG - Intergenic
937782332 2:125853440-125853462 TGCACACGGATGCTATGGACAGG + Intergenic
937975418 2:127579444-127579466 TGCACACTTCGGCCAGGGAAAGG + Intronic
938088332 2:128416475-128416497 TTCACACTGCTGCCCGGGGCAGG + Intergenic
938091288 2:128436412-128436434 TGCACGGAGCTGCCCGGGGCTGG + Intergenic
938391449 2:130909768-130909790 TGGACACTGCTCCCAGGGTCTGG - Intronic
938663055 2:133506781-133506803 TGCACACTCATGCCAGGTACTGG - Intronic
940970910 2:159895632-159895654 GGCACTCAGCTGCAAGTGACAGG + Intronic
941704298 2:168641460-168641482 TGCATCCAGCTGCCTGGGACAGG - Intronic
941892037 2:170592603-170592625 TTCAAACAGCACCCAGGGACAGG - Intronic
942277795 2:174335674-174335696 CCGAAACAGCTGCCAGGGACGGG - Intronic
944458202 2:199917190-199917212 TGCACAAAGCAGCGAGGGCCTGG + Intronic
946157458 2:217816480-217816502 AGCACACGGCTGCCAGGAAAGGG - Intronic
946317180 2:218924017-218924039 TGCACAGAGCTGCTGGGGCCTGG + Intergenic
946422482 2:219572419-219572441 TGGGCACAGCTGCCAGGGGCTGG + Exonic
948401198 2:237686834-237686856 TGCAGACAGCAGGCAGGGTCTGG + Intronic
948600164 2:239103338-239103360 GGGCCACAGCTGCCAGGGTCTGG + Intronic
948670338 2:239564422-239564444 CTCACACAGGTGCCAGGGTCAGG + Intergenic
948787018 2:240358149-240358171 TGCACACAGCTGGCAGAGAGGGG - Intergenic
1169416807 20:5424160-5424182 TACTCACAGGTTCCAGGGACTGG + Intergenic
1169641346 20:7755999-7756021 GACACACAGCTGCCAGGAAATGG + Intergenic
1170246229 20:14224418-14224440 TGCAGACTGCTGCCTGGGCCTGG + Intronic
1170548005 20:17451422-17451444 TGCTGACAGCTGCCAGACACAGG - Intronic
1171044056 20:21793982-21794004 TGCACATGGCTGCCAGAGGCAGG + Intergenic
1171353277 20:24522044-24522066 TGAACACAGCTGTCAGGGTATGG - Intronic
1171372528 20:24670714-24670736 TGCACAGAGCTCCCAGGGTGGGG + Intergenic
1171751924 20:29060063-29060085 TGGTCACAGATTCCAGGGACTGG - Intergenic
1173764021 20:45589669-45589691 TGCAGAGAGGTGCCAGGGGCTGG - Intergenic
1174086986 20:48016434-48016456 GGCAGGCAGCTGCCAGGGGCTGG + Intergenic
1174922897 20:54723691-54723713 TACACACAGGTTCAAGGGACTGG + Intergenic
1175208001 20:57326785-57326807 TGCACACAGCTGCTGGGGGAGGG + Intergenic
1175257845 20:57657710-57657732 TGTCCAGACCTGCCAGGGACAGG + Intronic
1175371740 20:58497032-58497054 TGCAGACACCGGCCAGTGACAGG + Intronic
1176032214 20:63018042-63018064 TCCACACAGCGGCCCCGGACTGG + Intergenic
1177610174 21:23435895-23435917 TGCACACCTCTTTCAGGGACAGG + Intergenic
1178765872 21:35450572-35450594 GGCACACTGGTGCAAGGGACGGG + Intronic
1178902661 21:36609778-36609800 TCCACACAGATTCAAGGGACAGG - Intergenic
1180088003 21:45516688-45516710 TTCTCGCAGCTGCCAGGGGCAGG + Intronic
1183106049 22:35615831-35615853 TGCAGCCAGATGACAGGGACAGG + Intronic
1184759102 22:46534950-46534972 TGCACTCAGCAGCCAGAGAGGGG - Exonic
1185026563 22:48417498-48417520 TGCACACAGCAGCCAGCAAAGGG + Intergenic
1185246497 22:49775889-49775911 TTCACACAGCTGGAAGGGGCAGG - Intronic
949464436 3:4329564-4329586 TGCACACAGCAGCAAGGCCCTGG + Intronic
950461357 3:13124160-13124182 TGCAGACAGCTTCCAGGGGCTGG + Intergenic
950822459 3:15775710-15775732 GGCACACAGCTTCCACGGAAGGG + Intronic
950897080 3:16462600-16462622 TGCAGACAGCTGCCAGATGCTGG + Intronic
951232087 3:20191140-20191162 TGCCGACAGCTGCCAGAAACTGG + Intergenic
953407457 3:42666499-42666521 TCCAAAGAGCTGCCAGGCACTGG - Intergenic
953722441 3:45368412-45368434 AGGTCACAGCTGCCAGGGATGGG - Intergenic
954205761 3:49057702-49057724 TGCTTGCAGCTGCGAGGGACTGG + Exonic
954797399 3:53168562-53168584 TGCACACTTGAGCCAGGGACTGG + Intronic
955313273 3:57911623-57911645 TGCTCACAGCTGTCAGGTATTGG - Intronic
955878423 3:63518607-63518629 TGCCCACAGCTGGCAGGTATAGG - Intronic
958584591 3:96069592-96069614 TCCACAGAGCTGGCAGGGTCAGG - Intergenic
960376054 3:116902944-116902966 TGCTCACAGCCCCCAGGGTCTGG - Intronic
961325854 3:126108926-126108948 TTCACACAGCTGCCAGGGTCTGG - Intronic
962533148 3:136302167-136302189 TGCACACAGCTTGCAGGAGCCGG - Intronic
962908107 3:139823634-139823656 AGCACACAGCTGTCAGGGCAGGG - Intergenic
963763744 3:149311328-149311350 GTCACACAGCTCCCATGGACTGG + Intergenic
964718737 3:159750683-159750705 TGTATACAGCAGCCAGGAACAGG + Intronic
967414856 3:189204857-189204879 AGCATGTAGCTGCCAGGGACAGG + Intronic
968408088 4:359584-359606 TGCCTCTAGCTGCCAGGGACTGG + Intronic
968427773 4:534756-534778 TGCACAAAGCTGCCAGGAGATGG - Intronic
968621531 4:1605436-1605458 TGCACCCAGCTTCCAGGGGCTGG + Intergenic
969478537 4:7434748-7434770 TGCAGACAGCTGCCAGGTGCGGG - Exonic
969487316 4:7479534-7479556 TGCACACCGCTGCCAGGGAGAGG + Intronic
970205815 4:13654573-13654595 TGCACTTAGCTGGCAGGGTCAGG + Intergenic
970750466 4:19353284-19353306 TGCACAAAGCTGCAAGGCCCTGG + Intergenic
971969849 4:33606592-33606614 GGGACACAGCTCCCAGGGAGAGG + Intergenic
974031324 4:56779311-56779333 TTCACACATCTCCCAGGGAATGG - Intergenic
974071405 4:57127550-57127572 TGCACAAAGCAGCAAGGCACTGG - Intergenic
976680797 4:87753701-87753723 TGCACAAAGCAGCCAGGCCCTGG + Intergenic
977666509 4:99651229-99651251 TGCAGACAGCTGCCTGGGTTTGG + Exonic
980563078 4:134502177-134502199 TGCAGACATCTGCATGGGACTGG + Intergenic
986152289 5:5139556-5139578 TGCACCCAGCAGCCAGTCACCGG + Intergenic
986691783 5:10319357-10319379 TGAACACAGGTCCCAGGGAGAGG - Intergenic
986730484 5:10631717-10631739 TGAACACAGGTCCCAGGGAGAGG - Intronic
986987333 5:13514486-13514508 TGCACAAAGCAGCCAGGCCCTGG - Intergenic
987584984 5:19843243-19843265 TGCACAAAGCAGCAAGGCACTGG - Intronic
988362669 5:30255704-30255726 TGCACAAAGCAGCAAGGCACTGG + Intergenic
989273180 5:39555964-39555986 AGGAGGCAGCTGCCAGGGACAGG - Intergenic
989295952 5:39826809-39826831 TGCACAGAGAGGCCAGGGAGAGG + Intergenic
989308211 5:39981650-39981672 GGCACACTAGTGCCAGGGACGGG - Intergenic
989696890 5:44212322-44212344 TGCACAGAGCAGCAAGGGCCTGG - Intergenic
989731613 5:44656219-44656241 TGCACAAAGCAGCAAGGCACTGG - Intergenic
990177066 5:53119655-53119677 TCCAGTCAGCTGCCAGGGACAGG + Intergenic
991095253 5:62732882-62732904 GCCACACAGCAGCCATGGACAGG - Intergenic
992476166 5:77103648-77103670 TGCACACAGTTGGCAGTGGCAGG - Intergenic
993564607 5:89457746-89457768 GGTACACAGCTGCCAAAGACAGG + Intergenic
996516972 5:124381557-124381579 TGCACACAGCTGCCTGCCACAGG - Intergenic
997036868 5:130203023-130203045 TGCACACAGCAGGCAGGCCCTGG + Intergenic
999068475 5:148716903-148716925 GGCACACAGATGCAAGGGATGGG - Intergenic
999315734 5:150582698-150582720 GGCACACAGCTGCCTAGGAAAGG + Intergenic
1001032580 5:168273428-168273450 AGCACAAATCTGCCAGGGAGAGG + Intergenic
1001722687 5:173869493-173869515 TGAACTCAGCTGCCAGTCACAGG - Intergenic
1001902368 5:175443067-175443089 TGAACACCTCTGCCATGGACGGG - Exonic
1002443340 5:179275433-179275455 CCCTCACAGCTGCCAGGGATGGG - Intronic
1002575800 5:180172986-180173008 TGTGCTCAGCTGCCAGGGTCAGG - Intronic
1003370949 6:5525449-5525471 TGCACACAGCTGAGAGGCTCAGG + Intronic
1004425983 6:15507436-15507458 TGGACACAGCTGCCACAGGCAGG - Intronic
1006627368 6:35406851-35406873 TGCACACAGCTGTCAGGGCCTGG + Intronic
1006815246 6:36845528-36845550 TGCAGACAGATGCCAGGGCCAGG - Intergenic
1011522852 6:88228752-88228774 TCCATACTGCTGCCTGGGACTGG - Intergenic
1011838153 6:91459129-91459151 TGTACATAGCTGCTAGGGCCTGG - Intergenic
1011938380 6:92811509-92811531 TGCCCACAGCTGCCAAGTTCAGG + Intergenic
1013779081 6:113710558-113710580 TGCAAAGAGCTGCCAATGACTGG + Intergenic
1014725651 6:124968587-124968609 TCCAGACAGCTGGAAGGGACAGG - Intronic
1016306454 6:142689689-142689711 TGGACAGTGGTGCCAGGGACTGG + Intergenic
1017459679 6:154637289-154637311 GACACACTGCTTCCAGGGACAGG + Intergenic
1017489529 6:154932828-154932850 TGCAAATGACTGCCAGGGACAGG + Intronic
1018922734 6:168186643-168186665 TGCACAAAGCAGCAAGGGCCCGG + Intergenic
1018967791 6:168501928-168501950 TGCACAGAGCTGCCAGAGTGAGG - Intronic
1019041695 6:169111171-169111193 TGCAGTCAGCTGGCAGGGAGAGG - Intergenic
1019542645 7:1558505-1558527 TGCGCAGAGCTGGAAGGGACCGG + Intronic
1019796618 7:3054622-3054644 TGCACAGAGCAGACAGGGAGGGG - Intergenic
1025798357 7:64760692-64760714 TGAAGACAGCTGTCCGGGACAGG + Intergenic
1026819445 7:73537109-73537131 TAGACACAGGTGCCAGGGTCAGG + Exonic
1028585053 7:92444513-92444535 AGGATACAGCAGCCAGGGACTGG + Intergenic
1029727863 7:102419576-102419598 AGTAAACAGCTGCCAGGGGCTGG - Intronic
1031493929 7:122423335-122423357 GGCAGACAGATGGCAGGGACAGG - Intronic
1031771375 7:125848421-125848443 GGCACACTGCTGCAAGGGGCAGG - Intergenic
1032388895 7:131542979-131543001 TGGACGCAGGGGCCAGGGACAGG + Intronic
1034642462 7:152615174-152615196 GACACTCAGCTGCCAGGCACAGG - Intergenic
1035470674 7:159106844-159106866 GGCACACAGAGGCCAGGGAGGGG + Intronic
1035749122 8:1983380-1983402 AGCACCCAGCTGCCTGGGACAGG - Intronic
1037730973 8:21523892-21523914 TCCACACATCTCCCAGGGGCTGG - Intergenic
1037912132 8:22749745-22749767 TCCACACTGCTGCCCGTGACTGG - Intronic
1037998553 8:23370720-23370742 TGCAGGCAGCCTCCAGGGACTGG + Intronic
1039820543 8:41130282-41130304 GGAACAGAGCTCCCAGGGACAGG + Intergenic
1039947099 8:42139795-42139817 TTCACCCAGCCCCCAGGGACGGG + Intergenic
1040589695 8:48779305-48779327 TGAATGCAGCTGGCAGGGACTGG + Intergenic
1040721477 8:50329615-50329637 TACACACAGCAGCCAGGTCCTGG + Intronic
1040956810 8:52988136-52988158 TGGACACAGGTGGCAGGGAAAGG - Intergenic
1042704403 8:71650974-71650996 TGCACACATGGGCCAGGGCCCGG - Intergenic
1045529224 8:102968802-102968824 AGCTCACAGATGCCAGGGCCTGG + Intronic
1046732033 8:117736239-117736261 TGCACACAGGGGACAGGGCCAGG + Intergenic
1048138124 8:131766059-131766081 TGGCCACAGCTGCCAAGGACTGG - Intergenic
1049034231 8:140062004-140062026 TGCGCACACCTGCGAGGGAATGG - Intronic
1049245343 8:141559482-141559504 GGCACACAGAGGCCAGGGCCTGG - Intergenic
1049299572 8:141862439-141862461 TGCACTTCTCTGCCAGGGACAGG + Intergenic
1049624145 8:143612596-143612618 AGCACAGAGCTGCCAAGGCCAGG + Exonic
1049819902 8:144627164-144627186 TGTCTGCAGCTGCCAGGGACAGG + Intergenic
1050185143 9:2965442-2965464 TCCAGAAAGCAGCCAGGGACTGG + Intergenic
1052877750 9:33580160-33580182 TGCACACAGCAGCCAGGCCATGG - Intergenic
1053159657 9:35805281-35805303 GGCACCCAGCCACCAGGGACAGG - Intronic
1053498235 9:38564045-38564067 TGCACACAGCAGCCAGGCCATGG + Intronic
1053754162 9:41286217-41286239 TAAACACAGCAGTCAGGGACTGG + Intergenic
1054259680 9:62850571-62850593 TAAACACAGCAGTCAGGGACAGG + Intergenic
1054332090 9:63769455-63769477 TAAACACAGCAGTCAGGGACAGG - Intergenic
1055277925 9:74640755-74640777 TGCACATACCTGCCAGTGAGGGG + Intronic
1056957348 9:91092713-91092735 TCCACAGAGCTGCCAATGACTGG - Intergenic
1057218574 9:93243381-93243403 TTCAGCCAACTGCCAGGGACGGG - Intronic
1057218827 9:93244752-93244774 TGCGCCCAGGTGCCAGTGACAGG + Intronic
1057274428 9:93668770-93668792 TGCACACTGCTCCGAGGCACGGG - Intronic
1057677700 9:97148529-97148551 TGCACACAGCAGCCAGGCCATGG + Intergenic
1057772888 9:97983594-97983616 TGCTTACAGCTGCCGGGGTCCGG - Exonic
1058245962 9:102625645-102625667 TGCACAAAGCAGCAAGGGCCTGG + Intergenic
1059045439 9:110861583-110861605 TGCACACAGCTGGGAGGCCCTGG - Intergenic
1059285462 9:113168343-113168365 TGCACACAGAGTCCAGGGAGTGG + Intronic
1059334723 9:113561814-113561836 TGCAGCCAGGTGCCAGAGACAGG - Intronic
1060187386 9:121572016-121572038 TTCACACAGCTCCAAGGGGCTGG - Intronic
1060219447 9:121756654-121756676 TGCAGACAGCTGCCTGGGTCAGG + Intronic
1060777485 9:126386247-126386269 TGCACACAGGTCCCAGGACCAGG - Intronic
1060790226 9:126480993-126481015 GTGACACAGCTGGCAGGGACAGG - Intronic
1060993963 9:127865344-127865366 TGCACTCAGCTGCCCAGAACTGG + Intergenic
1061952924 9:133946217-133946239 TCAAGGCAGCTGCCAGGGACTGG + Intronic
1062090930 9:134678504-134678526 TGCAGACAGCTTCCCGGGGCTGG - Intronic
1062382190 9:136291819-136291841 TGCACACAGTAGCCAAGCACAGG + Intronic
1062468047 9:136690148-136690170 TGCCCTCAGCTACCAGGGGCAGG + Intergenic
1062589294 9:137266285-137266307 AGGACACAGCTGCCTGGGAGAGG + Intronic
1186337506 X:8606620-8606642 TGCACAGAGCTTCCAGGTGCTGG + Intronic
1190737166 X:53263287-53263309 TGCACAGAGCTGGGATGGACTGG + Intronic
1192448568 X:71228393-71228415 TGCACAGAGATGCCAGGAGCTGG + Intergenic
1192693485 X:73390561-73390583 TGCACAGAGATGCCAAGCACTGG + Intergenic
1192811943 X:74554833-74554855 TGAACACAAGTGCCAGGGAGAGG - Intergenic
1195145111 X:102006285-102006307 TCCACACTGCTGCAAAGGACAGG - Intergenic
1195256852 X:103099336-103099358 TGGTCACAGGTGCCAGGGAGAGG - Intergenic
1196811666 X:119633864-119633886 TGCACAATGCTGCCAGGCCCTGG + Intronic
1199715841 X:150506846-150506868 AGCACACAACCCCCAGGGACAGG + Intronic
1199794158 X:151178924-151178946 TGCACAGAGCTCCCAGCGCCGGG - Intronic
1201425444 Y:13845486-13845508 TGCACAAAGCTTCCAGGAGCTGG - Intergenic
1202368698 Y:24183249-24183271 GGAACACAGGTACCAGGGACTGG - Intergenic
1202502087 Y:25486868-25486890 GGAACACAGGTACCAGGGACTGG + Intergenic