ID: 1163826675

View in Genome Browser
Species Human (GRCh38)
Location 19:19528128-19528150
Sequence CCAGGTGGCCGGAGGGCACA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 321}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163826675_1163826687 3 Left 1163826675 19:19528128-19528150 CCCTGTGCCCTCCGGCCACCTGG 0: 1
1: 0
2: 1
3: 32
4: 321
Right 1163826687 19:19528154-19528176 CCTGCCCCTCCCCACTGGGACGG 0: 1
1: 0
2: 7
3: 69
4: 493
1163826675_1163826694 25 Left 1163826675 19:19528128-19528150 CCCTGTGCCCTCCGGCCACCTGG 0: 1
1: 0
2: 1
3: 32
4: 321
Right 1163826694 19:19528176-19528198 GAATAAATGCTCTGCAGACCTGG 0: 1
1: 0
2: 0
3: 10
4: 134
1163826675_1163826683 -2 Left 1163826675 19:19528128-19528150 CCCTGTGCCCTCCGGCCACCTGG 0: 1
1: 0
2: 1
3: 32
4: 321
Right 1163826683 19:19528149-19528171 GGATCCCTGCCCCTCCCCACTGG 0: 1
1: 0
2: 5
3: 56
4: 385
1163826675_1163826684 -1 Left 1163826675 19:19528128-19528150 CCCTGTGCCCTCCGGCCACCTGG 0: 1
1: 0
2: 1
3: 32
4: 321
Right 1163826684 19:19528150-19528172 GATCCCTGCCCCTCCCCACTGGG 0: 1
1: 0
2: 8
3: 35
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163826675 Original CRISPR CCAGGTGGCCGGAGGGCACA GGG (reversed) Exonic
900086614 1:901320-901342 CCAGGTGGGCTGAATGCACATGG - Intergenic
900124833 1:1064736-1064758 CCATGTGCCAGGAGGACACACGG - Intergenic
900215098 1:1477371-1477393 CGAGGAGGCCGGGGCGCACATGG + Intronic
900254659 1:1691790-1691812 CCTGGTCGGGGGAGGGCACAGGG - Intronic
900263411 1:1745065-1745087 CCTGGTCGGGGGAGGGCACAGGG - Intronic
900370765 1:2331165-2331187 CCAGGTGGACATGGGGCACATGG + Intronic
900605753 1:3522862-3522884 CCAGGGGGCCTGAGGGGACCAGG + Intronic
900620791 1:3586772-3586794 CCAGGTGGGCAGAGGCCACAGGG + Intronic
900900910 1:5515247-5515269 CCAGGTGTGCAGAGGCCACAAGG + Intergenic
900990657 1:6096805-6096827 CCAGCTGGCCGTAGGTAACAGGG + Intronic
901012984 1:6211446-6211468 CTAGGTGGCCTGAGGTCATAGGG + Intronic
901650346 1:10739523-10739545 CCCGGGGGGCGGAGGGCTCAGGG - Intronic
902228050 1:15009106-15009128 CCAGGGGGCCCAAGGGCACCAGG + Intronic
902229951 1:15021571-15021593 CCAGGAGGGCGGAGGGCCCCGGG - Intronic
902362714 1:15950867-15950889 CCAGGAAGCCCCAGGGCACATGG - Intronic
904881975 1:33707169-33707191 CCAGGTTGCTGGAGGTCATATGG - Intronic
905250362 1:36644320-36644342 CCAGGTCGTGGGAGGCCACAGGG - Intergenic
905648380 1:39640027-39640049 CCAGGAGGCAGGAGCGCGCAGGG - Intergenic
905873244 1:41416728-41416750 CCAGGGGGGCGGGGGGCAGAGGG - Intergenic
905947639 1:41917354-41917376 CCAGGTAGCCAGTGGGCACCTGG + Intronic
906290789 1:44618039-44618061 CCAGGTTGATGGAGGGCACCTGG - Intronic
906607762 1:47183488-47183510 CCAGCTGCCCTGTGGGCACAGGG + Intergenic
906641486 1:47443552-47443574 CCGGGAGGCCCGAGGCCACAAGG + Intergenic
906698197 1:47838986-47839008 TCATGTGGCGGGAGGGCACTGGG + Intronic
907302712 1:53498615-53498637 CCAGGTGTCCGGAGTGCAACAGG - Intergenic
908595812 1:65687844-65687866 GCAGGTGGCAGCAGAGCACAAGG - Intergenic
909426710 1:75534032-75534054 CCAGTTGGCAGGAGGACTCAGGG - Intronic
910435544 1:87201988-87202010 CCAGGTGGCGGGTGGGCCCTGGG - Intergenic
912679892 1:111722328-111722350 CAGGGTGGCCGGAGGGCAGGAGG + Exonic
915012249 1:152698406-152698428 CCTGGGAGCCAGAGGGCACAGGG + Intronic
915724375 1:158007337-158007359 CCAGGTGGAAGGAGGACACCAGG + Intronic
915907801 1:159891701-159891723 CCAGGTGGCAGCAGCACACAGGG - Intronic
916108641 1:161447903-161447925 CCAGGTGCCCGGCGGGGACACGG + Intergenic
916110229 1:161455284-161455306 CCAGGTGCCCGGCGGGGACACGG + Intergenic
916111814 1:161462694-161462716 CCAGGTGCCCGGCGGGGACACGG + Intergenic
916113401 1:161470075-161470097 CCAGGTGCCCGGCGGGGACACGG + Intergenic
916618587 1:166471609-166471631 CGAGGTGGGGGGAGGTCACAAGG - Intergenic
916880930 1:169018861-169018883 CCAGGGGGCAGGACGGCACCTGG - Intergenic
920517832 1:206599682-206599704 CCAGCTGGCCCCAGGGCACCTGG - Intronic
922175079 1:223190394-223190416 CCAGGTGGGTGGCGGGCAGAAGG - Intergenic
923786351 1:237072174-237072196 CCATGGAGCCGGAGGGCACGAGG - Intronic
1063121790 10:3109778-3109800 CCAGGTGGCCCCAGTGCACCAGG + Intronic
1063172962 10:3526243-3526265 CAAGGTGACCGGATAGCACAGGG + Intergenic
1064152304 10:12875057-12875079 CCAGGTGCAAGGTGGGCACAGGG + Intergenic
1067699333 10:48557548-48557570 CCTTGTGGGCGGTGGGCACAGGG - Intronic
1069659907 10:70116793-70116815 CCAGGAGGCTGGTGGGGACAGGG + Intronic
1069740304 10:70683073-70683095 CCAGGGCGCAGGAGGGCAAATGG - Intronic
1069914242 10:71777628-71777650 TCAGGTGGCCAGAGGGACCAAGG - Intronic
1070833453 10:79433905-79433927 CAAGCTGGCCCCAGGGCACAGGG + Intronic
1070834857 10:79441868-79441890 CCTGGAGGCTGGAGGGTACAGGG + Intronic
1072189147 10:93066369-93066391 CCAGGTGGGAGGAGGGCGGAGGG + Intronic
1072781079 10:98252389-98252411 CAAGGTGGCTGAGGGGCACAAGG - Exonic
1075071955 10:119325619-119325641 CCATGTGGCCAGAGGGCTCCTGG - Intronic
1075520830 10:123142722-123142744 CCAGGTGCCCCGCGGGCGCAAGG - Intergenic
1075934390 10:126327038-126327060 CCAGGCTGCCTGAGGTCACAGGG + Intronic
1076742999 10:132497320-132497342 CAAGGGTGCCGGCGGGCACAAGG + Intergenic
1076743013 10:132497389-132497411 CAAGGGTGCCGGCGGGCACAAGG + Intergenic
1076752657 10:132551399-132551421 CCAGGTGGTCGGGGGACACCGGG + Intronic
1076816404 10:132917118-132917140 TCAGGGAGCCGGAGGCCACATGG - Intronic
1076821005 10:132939545-132939567 CCAGGTGGGAGGAGGACACCAGG + Intronic
1076988997 11:259551-259573 CCAGGTGGCTGGAGGCCCCGAGG - Intergenic
1077277181 11:1717966-1717988 CCAGGGGGGCGGCGGGCACAAGG + Intergenic
1077319397 11:1934495-1934517 CCTGGTCTCAGGAGGGCACAGGG - Intronic
1077537094 11:3129610-3129632 CCAGGTGGCCGCTGAGCACCAGG + Intronic
1078364313 11:10693768-10693790 CCAGCTGGCCTCAGGGCTCAGGG + Intronic
1078771758 11:14358621-14358643 CCAGGGGGCGGGAGGGCGCGGGG - Intronic
1080589290 11:33707579-33707601 CCAGATGAGTGGAGGGCACAGGG + Intronic
1083401241 11:62424877-62424899 CCTAGTGGCCGCGGGGCACAAGG - Intergenic
1083483581 11:62966598-62966620 CCAGGTGGCAAGAGTTCACAGGG + Intronic
1084095786 11:66910337-66910359 CCAGCTGCCCTGATGGCACAAGG - Intronic
1084288443 11:68146671-68146693 CCATGTGGCTGGAGGGCTCAGGG + Intergenic
1085397229 11:76212800-76212822 GCAGGTGGCAGGAGGGGGCAGGG - Intergenic
1085449095 11:76621369-76621391 CCAGGTGACAGGAGCTCACAGGG + Intergenic
1085544232 11:77302092-77302114 CGTGGTGGCTGGGGGGCACAGGG - Intergenic
1087659973 11:100975948-100975970 TCAGGTGGCCGCAGAACACATGG + Intronic
1089278563 11:117356277-117356299 CCAGGTGGCCGGAGGGCCTGGGG + Intronic
1089349661 11:117815196-117815218 CCAAGGGGCGGGAGGGAACAAGG + Intronic
1090398305 11:126433404-126433426 CCCTCTGGCCGGAGGGCAAATGG - Intronic
1090872727 11:130762511-130762533 CCAGGTGGTCCCAGGGCAAAGGG - Intergenic
1091807268 12:3365724-3365746 CCATGTCCCGGGAGGGCACACGG + Intergenic
1092743806 12:11654549-11654571 CCAGCTGGTCTGAGGGCACGGGG + Intronic
1093114690 12:15194898-15194920 CCAGGCTGCCAGATGGCACATGG + Intronic
1093884395 12:24442837-24442859 GAAGGTGGCAGGAGGCCACAGGG + Intergenic
1093986028 12:25534519-25534541 CAAGGTGGCTGGAGGTCACAAGG + Intronic
1096082282 12:48841722-48841744 CGAGGTGCCGGGATGGCACACGG + Intronic
1096193355 12:49633973-49633995 CCAGGAGGCCTGTGGGCACTGGG - Exonic
1097280356 12:57841698-57841720 ACAGGTGGCCGGGGGTCAGAGGG - Intronic
1097838126 12:64293870-64293892 ACTGGTGGCCAAAGGGCACAAGG + Intronic
1100985608 12:100199621-100199643 CCAGGTGGCCGAGGGGCAGCGGG + Intronic
1103449921 12:121021448-121021470 CCAGGTGGCTGGAGAGCACCTGG + Intronic
1103527565 12:121578534-121578556 CCAGGGGGCCGGCGGACAGAGGG - Intronic
1104461757 12:128962130-128962152 CCAGGAGGCCGAGGGGGACAGGG - Intronic
1104725870 12:131075365-131075387 CCTGGTGGCTGCAGGACACAGGG + Intronic
1105284416 13:18992967-18992989 CCAGATGGCCAGAAGGCACAAGG + Intergenic
1105284514 13:18993454-18993476 CCAGGAGGCCAGAAGGCAGAAGG + Intergenic
1105285069 13:18996722-18996744 CCAGATGGCGGTAGGCCACATGG + Intergenic
1105813563 13:24014093-24014115 CCTGGAGGCTGGAGGCCACAGGG + Intronic
1106329226 13:28723867-28723889 CCAAGTGGCCGGCGGCCAGACGG + Intergenic
1108643664 13:52406216-52406238 CCGGGAGGGCGGGGGGCACACGG + Intronic
1111951209 13:94711123-94711145 CCCGGTCGCGGGAGGGCGCACGG + Exonic
1113944190 13:114034417-114034439 CCAGGGGCCGGGAGAGCACACGG - Intronic
1113944203 13:114034458-114034480 CCAGGAGCCGGGAGAGCACACGG - Intronic
1114244756 14:20902351-20902373 CCAGGTGGCTGGACTGCAGAAGG - Intergenic
1115820806 14:37210730-37210752 TCATGTGGCCAGAGGTCACAAGG - Intronic
1117036438 14:51734432-51734454 CAAGGTGGCCAGAGTTCACAGGG + Intergenic
1117180057 14:53182370-53182392 TCATGTGGCCAGAGGTCACAAGG + Intergenic
1119595440 14:75928694-75928716 CCTGGTGATCGCAGGGCACAAGG + Intronic
1119730597 14:76948588-76948610 GCAGGTGACTGGAGGGCAGAAGG + Intergenic
1122302337 14:100738367-100738389 CCAGGAGGCCGCAGGGCTAAGGG + Intergenic
1122329271 14:100901939-100901961 CGAGGTGGCCAGAGGGGACCAGG - Intergenic
1122858948 14:104573689-104573711 CCAGTGGGCCGGAGGGCTCCAGG + Intronic
1122972592 14:105158463-105158485 CCAGGTGGCCCGGGGGCAGAGGG - Intronic
1123011379 14:105351089-105351111 CCAGGTGGCTGGAGGGCGGGCGG - Intronic
1123119436 14:105909961-105909983 CCAGGAGGCCCCAGAGCACAGGG - Intergenic
1124892235 15:33744020-33744042 GGAGGTGGCTGGAGGGCAGAGGG - Intronic
1125557068 15:40594625-40594647 CCGGGTGGCCGGAGGGGCCGAGG - Intronic
1126212974 15:46120593-46120615 CCAGGTGGCCACAGGGCTTATGG + Intergenic
1126223233 15:46239708-46239730 ACAGGAGGCAGGAGGGCACATGG + Intergenic
1127042029 15:54987835-54987857 TCATGTGGCCAGAGGTCACAAGG - Intergenic
1128735665 15:70052527-70052549 GCAGGTGGTGGGAGGGCAGATGG + Intronic
1128843658 15:70871480-70871502 CCAGGTGGCGGCCGGGCAGAGGG + Intronic
1128940349 15:71782951-71782973 GCAGGTGGCTGGCGGGGACAGGG + Exonic
1129153284 15:73702583-73702605 GCAGGTGGCCGGTGAGCACCAGG + Exonic
1129153598 15:73703987-73704009 GCAGGTGGCCGGTGAGCACCAGG + Exonic
1129245532 15:74276669-74276691 CCAGGAGGCTGGAGGGCACAGGG - Intronic
1129365469 15:75051407-75051429 CCAGCTGGCCTGAGTCCACAGGG - Intronic
1131252039 15:90837311-90837333 CCGGGAGGCAGGAAGGCACACGG + Intergenic
1131506296 15:93022700-93022722 CAAGGTGGCCAGAGTTCACAGGG - Intronic
1132592711 16:733256-733278 CCAGGAGGCTTGAGGGCTCAGGG + Intronic
1132673527 16:1112349-1112371 CCGGGTGGGCGGTGGGCACCTGG - Intergenic
1132772529 16:1572164-1572186 CCAGGTGGGCAGAGGCCACAGGG + Intronic
1132991260 16:2796142-2796164 CCTGGTGGCTGGAAGCCACATGG - Intergenic
1134063182 16:11211169-11211191 CCAGGTGCCCTGAGGGCTCCTGG + Intergenic
1134474869 16:14564429-14564451 CCATGTGGCCGGAGATCAAAAGG + Intronic
1135051426 16:19196070-19196092 CCAGGTGCCAGAAGGTCACAGGG + Intronic
1136136376 16:28259089-28259111 CGAGGTGGCTGGTGGGCAGACGG - Intergenic
1136671461 16:31862321-31862343 AAAGGTGGCTGGAAGGCACAGGG - Intergenic
1137621014 16:49876645-49876667 CCAGGGGGCGGGAGGGGGCAGGG + Intergenic
1137624686 16:49900192-49900214 CCAGGGGCCCAGAGGGCACCTGG - Intergenic
1137693655 16:50447027-50447049 CCAGTTGGCAGGTGGGCAGAGGG - Intergenic
1139236333 16:65343426-65343448 CCAGGTGGCCAGAGACCACCTGG + Intergenic
1140259472 16:73364996-73365018 CCAGATGCCCCAAGGGCACATGG - Intergenic
1141362158 16:83405958-83405980 CCAGGTGGGCTGAGGGCATGTGG - Intronic
1142220117 16:88850141-88850163 GCAGGTGGGCCGGGGGCACAAGG + Intronic
1142596151 17:1031059-1031081 CCTGGTGCCCGGCGGGCACTGGG + Intronic
1142638274 17:1270944-1270966 CCAGGTGTCCGCAGGGCCCGCGG - Exonic
1142806087 17:2372016-2372038 CCAGGTGGCAGGCAGGGACAGGG + Intronic
1142900380 17:3007929-3007951 CCAGGTGTCTGGAGCTCACAAGG + Intronic
1144827725 17:18115772-18115794 CCAGGTGGCTGGAGGGCAGTGGG - Intronic
1146281996 17:31550457-31550479 CCAGGTGGCCCGCGGGGACTCGG + Intergenic
1147326116 17:39670405-39670427 CCAGGTGGGTGGGGGCCACAGGG - Exonic
1148229118 17:45920229-45920251 CCAGGTGACAGGAGGACAGAGGG - Intronic
1150211603 17:63445132-63445154 CCAGGAGGCTGGAGTGCAGAGGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150713400 17:67550536-67550558 CCAGGAGGCTGGAAGGGACATGG - Intronic
1151384174 17:73745130-73745152 TCAGGTGGACGGGAGGCACAGGG + Intergenic
1151764011 17:76122756-76122778 GCTGGGGGCGGGAGGGCACAGGG + Intergenic
1152206502 17:78977252-78977274 CCAGATGGCCCGAGGCCCCAGGG + Intronic
1152503116 17:80726268-80726290 CCAGGAGGCAGCACGGCACAGGG - Intronic
1152626627 17:81390645-81390667 CCTGGTGCCTGGAGGGAACAGGG - Intergenic
1152807289 17:82362149-82362171 CATGCTGACCGGAGGGCACATGG - Exonic
1154066303 18:11110475-11110497 ACAGGTGGACTGAGGTCACATGG - Intronic
1157097730 18:44701490-44701512 CCCGGTGGGCGGAGAGCGCATGG + Exonic
1157620731 18:49016311-49016333 AGAGATGGCAGGAGGGCACACGG + Intergenic
1158892319 18:61884254-61884276 CCACGTGACCTGAGTGCACAAGG - Intronic
1159352827 18:67298175-67298197 CCAGATGACTGGAGGCCACATGG + Intergenic
1160150223 18:76392625-76392647 CCAGGTGGAGGGAGGGCAGGCGG + Intronic
1160156921 18:76441575-76441597 CGAGGTGGCCGGCGGGCGCGGGG + Exonic
1160762377 19:791987-792009 CCTGTTGGCCTGAGGGCCCAGGG + Intergenic
1161664557 19:5567646-5567668 CCAGGTGGCCGCGGGGCTCGGGG - Intergenic
1161698028 19:5781109-5781131 GCAGATGCCAGGAGGGCACATGG + Intergenic
1162818204 19:13208584-13208606 CCCGGCGGCCGGAGCGGACACGG - Intronic
1163250316 19:16122874-16122896 GCAGGCGGCCTGAGGGCACTGGG + Intronic
1163667763 19:18611096-18611118 CCAGGTCGCCTGAGGGGAGAAGG - Intronic
1163826675 19:19528128-19528150 CCAGGTGGCCGGAGGGCACAGGG - Exonic
1163832822 19:19555153-19555175 CCCAGTGGCCCGTGGGCACATGG - Intergenic
1164452694 19:28380654-28380676 CCAGGTGGCGGTGGGGGACAGGG + Intergenic
1165823607 19:38692976-38692998 CCAGGTACCCGGAGGCCAGACGG - Intronic
1166002478 19:39886018-39886040 CCAGGCGGCTGGAGGCCACGTGG - Exonic
1166005263 19:39902270-39902292 CCAGGTGGCTGGAGGCCACGTGG - Exonic
1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG + Intronic
1166932299 19:46308591-46308613 CCAGGGTGCCGGAGGGCACTGGG + Intronic
1166948474 19:46411675-46411697 CCAGCTGACCAGAGGTCACAGGG - Exonic
1166981384 19:46634279-46634301 CAAGGTGGGAGGAGGGGACAGGG - Intronic
1167661716 19:50799357-50799379 CCTGGAGGCAGGAGGGCACAGGG + Exonic
1168010037 19:53522598-53522620 CCAGCTGGCCGGAGGGGAAAAGG - Exonic
1168058055 19:53874459-53874481 CCAGGTGGGCAGAGTGCACCAGG - Exonic
1168197870 19:54788896-54788918 CCAGAAGGCCTGAGGCCACAGGG - Intronic
925542282 2:4978890-4978912 CCAAGGGGCAGGAGAGCACACGG + Intergenic
925817609 2:7768843-7768865 CCAGGGGACCTGAGGGCACAGGG - Intergenic
927779389 2:25927282-25927304 CCAGGTGGCCTGAGCGCAGGGGG - Exonic
928181683 2:29072575-29072597 CCTGGTGCCCACAGGGCACAGGG + Exonic
929564979 2:42978600-42978622 CCAGCTGGATGGAGGGCACATGG + Intergenic
929564993 2:42978640-42978662 CCCAGTGGATGGAGGGCACATGG + Intergenic
930254707 2:49076978-49077000 CCATGTGGCTGGAAGACACATGG - Intronic
931796037 2:65711107-65711129 CCAGCTGGCAGTAGAGCACAGGG - Intergenic
931881767 2:66576620-66576642 CCTGGGGGCTGGAGGGCACATGG + Intergenic
932470436 2:71951539-71951561 CCAGGTGTCAGGAGAGGACAGGG - Intergenic
934475635 2:94591617-94591639 CCAGGTGGCAGAAGGCCTCATGG - Intronic
935868179 2:107415270-107415292 CCAGGTGGCCAGTGGTCACTAGG + Intergenic
937060627 2:118977967-118977989 CCAGGAGGCCTGAGGGAACTAGG + Intronic
937204037 2:120224310-120224332 CCAGATGGCCAGAGGGCGAAAGG - Intergenic
938496401 2:131800303-131800325 CCAGGTGCCAGGAGGACACCAGG + Intronic
941595509 2:167471909-167471931 CCAGGTGGTAGGAGAGCAGAGGG + Intergenic
947818466 2:233054128-233054150 CCTGGTGGCCGGGAGTCACAAGG + Intergenic
947886062 2:233572714-233572736 CCTGGTGGTGGGAGGGGACATGG + Intergenic
948545725 2:238727335-238727357 ATAGGTGTCAGGAGGGCACAGGG + Intergenic
948631118 2:239303209-239303231 CCTGGGGACAGGAGGGCACAGGG + Intronic
948696861 2:239737190-239737212 CCAGGTCGCAGCAGGGCACGGGG + Intergenic
948893065 2:240916408-240916430 GCAGGTGGGCGGGGGGCACCGGG - Intergenic
948936364 2:241167536-241167558 CCAGGGTGCAGGAGGGCACCAGG - Intronic
1168855009 20:1002194-1002216 CCAGGCGGCCCGACGGCCCAAGG + Exonic
1171968639 20:31549540-31549562 GCAGGTGGTCGGAAGGCACCGGG - Intronic
1172024613 20:31939277-31939299 CCAGGTGGGGAGTGGGCACAAGG + Intronic
1172183388 20:33016979-33017001 CCCTGGGGCTGGAGGGCACAAGG - Intronic
1172692641 20:36800859-36800881 GCAGCTGGCAGGAGGGTACATGG + Intronic
1173514179 20:43653282-43653304 CCTGGTGGCTTGAGGCCACATGG + Intergenic
1173849760 20:46210389-46210411 CCAGGAGGCCGGAGGGCGGCCGG + Exonic
1174580244 20:51566249-51566271 CCAGGTGGCCGTAGGGGGAATGG + Intergenic
1174665695 20:52255793-52255815 CCAGGTGGCAGGAGGCAGCAGGG + Intergenic
1175260117 20:57668916-57668938 CCTGGAGGCTGGAGGGCAGAGGG - Intronic
1175270473 20:57730400-57730422 CCCGTTGGCAGGAGCGCACAGGG - Intergenic
1175418394 20:58816370-58816392 GCAGGAGGCCGCTGGGCACATGG - Intergenic
1175460674 20:59149832-59149854 CCAGCTGGCCGGTGTGCACAGGG + Intergenic
1175557464 20:59878193-59878215 CCTGGTGGCCTGAGGCCACATGG - Intronic
1175863240 20:62161262-62161284 CCAGGTGACCGCAGAGCACCAGG - Intronic
1175890886 20:62315449-62315471 CCAGGTGGTGGGAGGTGACATGG - Intronic
1175999554 20:62825831-62825853 CCGGGAGGCCGGCGGGCCCAGGG - Exonic
1176243021 20:64083789-64083811 CGAGGGGGTCGGAGGGCAGAGGG - Intronic
1179663432 21:42893074-42893096 CCAGGCGCCCGCAGGGCACAGGG + Intronic
1179720624 21:43314209-43314231 CCTGGTGGCCTCAGGGCACGGGG + Intergenic
1179738681 21:43404293-43404315 CCAGCTGTCCAGAGGGCATAGGG - Intergenic
1179786914 21:43735392-43735414 CCAGGTTGCGGGAGGGCCCCGGG + Intronic
1179909675 21:44441211-44441233 TCAGGTGGCCAGAGCTCACAGGG + Intronic
1180109831 21:45642746-45642768 CCGGGCGGGCGGAGGGGACAGGG + Intergenic
1181044703 22:20209084-20209106 CCAGTTGGCCGCAGAGCAGAAGG - Intergenic
1181066245 22:20307425-20307447 CCGGGTGCCCAGAGGACACAGGG + Intergenic
1181307978 22:21927655-21927677 CCAAAGGGCAGGAGGGCACAGGG + Intronic
1181533567 22:23530532-23530554 TCAGGTGGGCTGAGGGCAGAGGG + Intergenic
1183309829 22:37103375-37103397 CCAGGTGGCTGGCGGGCAGGGGG - Exonic
1184109259 22:42385412-42385434 CCATGTGGCTGGAGGGCAATGGG - Intronic
1184653823 22:45931415-45931437 CCAGGTGGGCTCAGGGGACAGGG + Intronic
1184769558 22:46589417-46589439 TCACGTGGCCCGAGGGCAGATGG + Intronic
1184814798 22:46861460-46861482 TCAGGTGGCCGGAGACCCCAGGG + Intronic
1184920904 22:47605204-47605226 CCAGCTGGGGGGAGTGCACAGGG + Intergenic
1185109758 22:48894364-48894386 CGAGGCGGCCAGAGGCCACATGG - Intergenic
1185131047 22:49039063-49039085 CCAGGTGGCTGCAGGGCTCAGGG - Intergenic
1185338764 22:50282486-50282508 GCAAGTGGGCGGGGGGCACACGG + Intronic
1185370279 22:50457701-50457723 CGACGTGGCCTGAAGGCACAGGG + Intronic
950831357 3:15878924-15878946 CCAGGTGACTGGGGGGAACATGG + Intergenic
950853775 3:16086849-16086871 CCAGGAGGCAGGAGGGGGCAGGG + Intergenic
954391489 3:50270236-50270258 CCAGGTTGAGGGAGGCCACATGG - Exonic
957620015 3:82584129-82584151 CCAGGTGCCCGGATTGCAGACGG + Intergenic
961081737 3:124033652-124033674 CCCGGTGGGCGGAGGGCGCGGGG - Intergenic
961393026 3:126567913-126567935 CCAGGTGTCCAAAGAGCACATGG - Intergenic
961443180 3:126965012-126965034 CCAGGTGGCGGGAGGTCCTATGG - Intergenic
963923684 3:150929306-150929328 CCAGATGGGTGGATGGCACAGGG + Intronic
964985390 3:162732215-162732237 CAAGGTGGGGGGAGGTCACAAGG - Intergenic
968505701 4:970406-970428 CCAGGTCACTGCAGGGCACAGGG - Intronic
968540250 4:1164683-1164705 ACAGGTGGACGGGGGGCACCTGG - Intergenic
969605166 4:8198758-8198780 CCAGTGGCCCGGAGGGCACCCGG + Intronic
974837288 4:67266235-67266257 TCAGGTGGCAGAAGGGCAGAAGG + Intergenic
975659001 4:76669886-76669908 CCAGTTGGCAGGTAGGCACATGG - Intronic
976783652 4:88790965-88790987 GTAGGTGGCAGGAAGGCACATGG - Intronic
980088883 4:128420883-128420905 CCAGGAGGCCACAGGGTACAGGG + Intergenic
980854172 4:138419400-138419422 CCAGGAGGCTGGAGGTCAGAAGG - Intergenic
980987557 4:139710535-139710557 CGGGGTGGAGGGAGGGCACAGGG - Intronic
983690983 4:170468943-170468965 TCAGCTGGGTGGAGGGCACATGG - Intergenic
984709097 4:182869976-182869998 CCAGGAAGCCAGAGGGCACGGGG + Intergenic
986238640 5:5936491-5936513 CCAGGTGCCCTGAAGTCACACGG + Intergenic
992527768 5:77629057-77629079 GCAGGTGGCCGAGGGGCACGAGG + Exonic
992626316 5:78638619-78638641 GCAGGCGGCCGGAGGGCAGAGGG - Intronic
992688945 5:79224530-79224552 TCATGTGGCCAGAGGTCACAAGG - Intronic
993899069 5:93572277-93572299 TCAAGTGGCCGGCGGGAACAGGG - Intergenic
994152198 5:96460375-96460397 TCAGGTGGTTGGAGGGCAAAAGG + Intergenic
997710000 5:135996264-135996286 TCAGGGGGACGGAGGGCACTTGG + Intergenic
1001090597 5:168737394-168737416 CCAGGAGGTAGGAGGGCACAGGG - Intronic
1001596732 5:172903296-172903318 CCAGGTGCCTGCAGGGTACAGGG - Intronic
1003066417 6:2907084-2907106 CCAGGTGGCTTGAGAGAACAGGG + Intergenic
1005854783 6:29852696-29852718 CATGGTGGCTGGTGGGCACAGGG - Intergenic
1006211163 6:32396201-32396223 CCATGTGGCTGGAGAGCAGATGG - Exonic
1007704279 6:43781452-43781474 GCTGGTGGCCAGAGGGCCCAGGG - Intronic
1008564057 6:52749995-52750017 CAAGGTGGCCTGAGAGCAGAGGG + Intergenic
1013667994 6:112367245-112367267 CCAGGTGGCCGGAGCGTGCTGGG + Intergenic
1013860121 6:114625647-114625669 CCAGATGGCTGGAGGACTCAGGG - Intergenic
1015798005 6:137032312-137032334 TCAGGCGGGTGGAGGGCACAAGG + Intronic
1016992675 6:149940896-149940918 CCAGGTCCACGGATGGCACAGGG - Intergenic
1017494920 6:154975142-154975164 CAAGGTGGCTGGAGGGGTCAGGG + Intronic
1018395786 6:163377162-163377184 GGAGGTGGCCCAAGGGCACAGGG - Intergenic
1018452210 6:163919526-163919548 AGCGGAGGCCGGAGGGCACAGGG + Intergenic
1018972243 6:168537776-168537798 TCAGGTGGCTGGAGCCCACAGGG + Intronic
1019358065 7:591268-591290 CGAGCTGGCCGGTGGGCACTGGG + Intronic
1019447435 7:1078737-1078759 CCAGTGGGCAGGTGGGCACATGG - Intronic
1019523158 7:1469498-1469520 CCAGGTGGCGCGAGGCCTCAAGG - Intergenic
1019567141 7:1689928-1689950 CCAGGTGTCCAGAGGGCTCAAGG - Intronic
1020009618 7:4800860-4800882 CCAGGTGGCCCCAAGCCACAGGG + Intronic
1022018685 7:26377169-26377191 CCAGGCCGCCGGAGGACAGAAGG + Intergenic
1023149848 7:37191963-37191985 CCAGGTGTACTGAGGACACATGG + Intronic
1023368668 7:39490428-39490450 CCAGGTGGCTGCAGGCCAGAAGG + Intronic
1024375795 7:48636728-48636750 CCAGGTGGACGGACAGCCCAGGG - Intronic
1025901855 7:65751174-65751196 CAAGGTGGCCGGAGCGCAGGCGG + Intergenic
1028556803 7:92134193-92134215 CCAGGTGGCCGGCGGCCAGACGG + Exonic
1029278249 7:99420258-99420280 CCAGGTGGCTGCAGAGGACAGGG + Intronic
1031879946 7:127186426-127186448 CCAAGTGGCAGGAGAGCAGAAGG + Intronic
1032087528 7:128891672-128891694 CCAGGCAGCGGGTGGGCACAGGG + Exonic
1032522991 7:132560593-132560615 CCAGGAGGCCGGCGGATACAAGG - Intronic
1034060616 7:148084225-148084247 CCAGGTGGCAGCAGGAAACAAGG - Intronic
1035254765 7:157619156-157619178 CCAGAAGGCTGCAGGGCACACGG + Intronic
1035731992 8:1860060-1860082 CCAAGTACCCGCAGGGCACATGG - Exonic
1036602858 8:10278532-10278554 TCAGATGGACGGAGAGCACATGG + Intronic
1036686721 8:10916592-10916614 CCAGGTGGAGGGAGGGCCGAGGG - Intronic
1037174021 8:15926123-15926145 CAAGGTGGGGGGAGGTCACAAGG - Intergenic
1037599474 8:20381781-20381803 ACAGCTGGCCAGAGGGGACAGGG - Intergenic
1037772170 8:21808730-21808752 CCACGTGGCCCTAGGGCCCAAGG - Intronic
1037829228 8:22178166-22178188 CCAGGTGCCCTGGGTGCACACGG - Intronic
1038494357 8:27991033-27991055 GCAGATGGCCCCAGGGCACAGGG - Intronic
1039421849 8:37450143-37450165 CCAGGTGGGTGGAGCTCACACGG - Intergenic
1040834677 8:51719121-51719143 CCGGGTGGCGGCAGGGCAGAGGG - Intronic
1041362358 8:57066833-57066855 GCAGGTGGCAGGAGGGGACACGG - Intergenic
1046294677 8:112202054-112202076 CCAGGTGGGGGGAGGCCACAAGG - Intergenic
1047532671 8:125691481-125691503 GCAGATGGCAGGAGGCCACACGG - Intergenic
1049262242 8:141646001-141646023 GGAGGTGGCCGGAGGACTCAGGG - Intergenic
1049514222 8:143044904-143044926 CCAGGTGGCAGGTTGGGACAAGG - Intronic
1049533874 8:143169132-143169154 TCAGGTGTGTGGAGGGCACAGGG + Intergenic
1049587084 8:143437190-143437212 CCAGGCAGGCAGAGGGCACAAGG + Intergenic
1049672244 8:143875109-143875131 CCAGGAGGCAGCTGGGCACATGG - Intronic
1051795573 9:20865569-20865591 CCATGTGGCCATACGGCACATGG - Intronic
1052854427 9:33398300-33398322 CCAGGTGGCAGAAGGCCTCATGG + Intronic
1053682432 9:40494461-40494483 CCAGGTGGCAGAAGGCCTCATGG + Intergenic
1053932415 9:43122787-43122809 CCAGGTGGCAGAAGGCCTCATGG + Intergenic
1054281282 9:63130468-63130490 CCAGGTGGCAGAAGGCCTCATGG - Intergenic
1054295531 9:63329961-63329983 CCAGGTGGCAGAAGGCCTCATGG + Intergenic
1054393551 9:64634465-64634487 CCAGGTGGCAGAAGGCCTCATGG + Intergenic
1054428200 9:65139679-65139701 CCAGGTGGCAGAAGGCCTCATGG + Intergenic
1054502180 9:65881865-65881887 CCAGGTGGCAGAAGGCCTCATGG - Intronic
1057052281 9:91935110-91935132 CCAGGTGGCCGCCGGGGACTTGG - Intronic
1058671213 9:107361997-107362019 CCAGGTGGCCTGAGGGGGCGTGG - Intergenic
1058689790 9:107510065-107510087 CTAGGAGCCCAGAGGGCACAGGG + Intergenic
1058991001 9:110255700-110255722 CCAGGAGGCCCGAGGGCCCCAGG - Intronic
1059277149 9:113106794-113106816 TCATGTGGCCGAAGGGGACAAGG - Intergenic
1059279102 9:113117757-113117779 TCATGTGGCCGAAGGGGACAAGG + Intergenic
1059441458 9:114309354-114309376 CCGTGTGGCAGGAGGGCACTGGG + Exonic
1060826935 9:126693063-126693085 GCAGGTTGCCGAAGGGGACAAGG + Intronic
1062045970 9:134424710-134424732 CCAGGTGGCTGGAGAGGACCTGG + Intronic
1062596628 9:137302576-137302598 CCGGGTGGCCGGAGGGAGAAGGG - Intergenic
1185663293 X:1744081-1744103 TCAGGTGGCGAGAGGGGACATGG + Intergenic
1185830213 X:3294382-3294404 CCAGGTGGCTGGAGGACAAGGGG - Intergenic
1188662204 X:32774578-32774600 CTAGGTGGCAGGAGGGGGCAGGG + Intronic
1188881442 X:35496924-35496946 CAAGGTGGGGGGAGGTCACAAGG - Intergenic
1192142941 X:68660649-68660671 CCAGGTTGTCGCAGGACACAGGG - Intronic
1192557371 X:72101339-72101361 GCAGGTGGCTGGAGAGCACTGGG + Intergenic
1197764312 X:130050013-130050035 ACAGCTGGCTGGAGGGAACAGGG - Intronic
1200691429 Y:6308513-6308535 CCAGGTGGCAGCAGGCCTCAAGG - Intergenic
1201043843 Y:9866203-9866225 CCAGGTGGCAGCAGGCCTCAAGG + Intergenic
1201247730 Y:12022832-12022854 CCAGGTGGCTGGAGGACAAGTGG + Intergenic