ID: 1163826795

View in Genome Browser
Species Human (GRCh38)
Location 19:19528593-19528615
Sequence GCCAATTGTAGGCATGGCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 48}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163826788_1163826795 -4 Left 1163826788 19:19528574-19528596 CCATACCTTGTGCAGCCCTGCCA 0: 1
1: 0
2: 1
3: 16
4: 231
Right 1163826795 19:19528593-19528615 GCCAATTGTAGGCATGGCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 48
1163826787_1163826795 -1 Left 1163826787 19:19528571-19528593 CCACCATACCTTGTGCAGCCCTG 0: 1
1: 0
2: 1
3: 16
4: 212
Right 1163826795 19:19528593-19528615 GCCAATTGTAGGCATGGCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 48
1163826789_1163826795 -9 Left 1163826789 19:19528579-19528601 CCTTGTGCAGCCCTGCCAATTGT 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1163826795 19:19528593-19528615 GCCAATTGTAGGCATGGCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163826795 Original CRISPR GCCAATTGTAGGCATGGCGA GGG Intronic
902548076 1:17202737-17202759 GCCAGTTGTGGGCAGGGCCAGGG - Intergenic
905305681 1:37016196-37016218 GCCAATTGTGGGCATTGCTAGGG + Intronic
905799857 1:40836336-40836358 GCCATTTGTTGACATGGAGAAGG + Intronic
912098481 1:106175040-106175062 TCCTATTGTGGGCATGGGGAGGG + Intergenic
917325165 1:173824589-173824611 GCCCGTAGTAGGCATGGCGGCGG + Exonic
924308107 1:242712705-242712727 GCCAATGGTAGTCGTGGTGATGG - Intergenic
1076824522 10:132960388-132960410 GCCAGTTTGGGGCATGGCGAGGG - Intergenic
1079371439 11:19856527-19856549 GCTAGTTGTAGGCATGGCTAAGG - Intronic
1084380027 11:68805865-68805887 GCCCATTGTAGTCATGGCCCTGG - Intronic
1088305513 11:108403201-108403223 GCCAATTGTTGGCAAGGATATGG - Intronic
1097275827 12:57813044-57813066 GCCAAGTGTTGGCAAGGCTATGG - Intronic
1104542558 12:129680862-129680884 GAAAATTGGAGGCATGGCAAGGG + Intronic
1104663078 12:130626422-130626444 GCCAGTGGTAGTCATGGTGATGG - Intronic
1104663089 12:130626497-130626519 GCCAGTGGTAGTCATGGTGATGG - Intronic
1110405884 13:75150071-75150093 GTCAATTGTAGGTCTGGCTAGGG - Intergenic
1110601375 13:77378156-77378178 GCCAATAGGAGGCATGGGAAAGG + Intergenic
1118627950 14:67675625-67675647 GTCAAGCGTAGGCATTGCGAGGG + Intronic
1124462244 15:29903129-29903151 GCCAAGTGTATGTATGGGGAGGG - Intronic
1126727838 15:51651031-51651053 GCCTGTTCTAGGCATGGCAAAGG - Intergenic
1131455773 15:92581274-92581296 TCCAATTGTGGACATGGTGATGG + Intergenic
1131639292 15:94272869-94272891 GACAATTGGAGGCATGGTAATGG - Intronic
1132252718 15:100346301-100346323 AGCAATGGTGGGCATGGCGATGG - Intergenic
1137273877 16:46920576-46920598 GCCAGGTGTCGGCATGGGGAGGG + Intronic
1143306595 17:5952408-5952430 TCAAAGTGTAGGCATGGAGATGG + Intronic
1144134185 17:12277540-12277562 GCCAATTCTAGGAATGGGGCAGG + Intergenic
1149464229 17:56862129-56862151 TCCAATTTTAGGCATGACGATGG + Exonic
1160966935 19:1750787-1750809 GCAAATTGTGGGCAGGGGGAGGG - Intergenic
1161889267 19:7022751-7022773 GCCAAGTGCAGACATGGCTATGG + Intergenic
1161892185 19:7047996-7048018 GCCAAGTGCAGACATGGCTATGG - Intergenic
1163826795 19:19528593-19528615 GCCAATTGTAGGCATGGCGAGGG + Intronic
939250263 2:139673453-139673475 GCAATTTGAAGGCATGGCAAAGG - Intergenic
945828336 2:214751745-214751767 GCCATTTGTTGCCATGGAGAAGG - Intronic
1170641675 20:18159671-18159693 TCCAATTGTAAGAATGGGGAAGG - Intronic
1183246781 22:36700015-36700037 TCCACTTGTAGCCATGGCCAGGG - Intronic
1184055304 22:42043579-42043601 GCCAGTTGTAGGCATGTGCATGG + Intronic
952766409 3:36957711-36957733 GCTAATTGTTGCCATGGAGATGG + Intergenic
954877511 3:53811754-53811776 CCCAACTGAAGGCATGGCGGCGG + Exonic
958903075 3:99911067-99911089 GCCAATTTTAGGCTAGGCAAAGG + Intronic
962674680 3:137746195-137746217 GCCATGTTTAGGCATGGAGAGGG + Intergenic
970978163 4:22065398-22065420 GCCAATTGTATGCCTTGGGAAGG + Intergenic
974014656 4:56637969-56637991 ACCAATTATAGGCATGGAGTGGG + Intergenic
980180471 4:129394372-129394394 GCCAAATGTGTGCATGGTGATGG - Intergenic
988944454 5:36181940-36181962 GCCAATAGTTGGCCTGGCAATGG - Exonic
989356764 5:40552160-40552182 TCCAATTGTAGGCATGCCAAAGG + Intergenic
997118153 5:131148089-131148111 GCCAATTGAAGGCAAGGCTTTGG - Intergenic
997633138 5:135385138-135385160 GACAATTGCAGGCATGGTGATGG - Intronic
1005729227 6:28680685-28680707 GCCCATTGTAGGTATTGCAAAGG - Intergenic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1035206096 7:157294869-157294891 GCCAGTTGTAAGCTTAGCGATGG + Intergenic
1035635700 8:1142740-1142762 GACAGTTCTAGGCATGGGGAGGG + Intergenic
1043345271 8:79290941-79290963 GCAAATTTTATGCATGGCTAAGG - Intergenic
1045478914 8:102577138-102577160 GCCTATGGGAGGCATGGCGTCGG + Intergenic
1186138762 X:6548678-6548700 GCCAATTGTAGTGGTGGAGAAGG + Intergenic
1187759536 X:22565358-22565380 GCCAACTGTAGCCAGGGAGATGG + Intergenic