ID: 1163827132

View in Genome Browser
Species Human (GRCh38)
Location 19:19530029-19530051
Sequence TGCCCACCAGACCACCACGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 109}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163827132_1163827141 18 Left 1163827132 19:19530029-19530051 CCCCCGTGGTGGTCTGGTGGGCA 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1163827141 19:19530070-19530092 AAGCAGGTAGGACTGAGAGCAGG 0: 1
1: 0
2: 4
3: 27
4: 275
1163827132_1163827143 28 Left 1163827132 19:19530029-19530051 CCCCCGTGGTGGTCTGGTGGGCA 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1163827143 19:19530080-19530102 GACTGAGAGCAGGGTGAGTGTGG 0: 1
1: 0
2: 3
3: 39
4: 451
1163827132_1163827138 -9 Left 1163827132 19:19530029-19530051 CCCCCGTGGTGGTCTGGTGGGCA 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1163827138 19:19530043-19530065 TGGTGGGCAGAGGTGTGAGGTGG 0: 1
1: 0
2: 3
3: 104
4: 906
1163827132_1163827139 2 Left 1163827132 19:19530029-19530051 CCCCCGTGGTGGTCTGGTGGGCA 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1163827139 19:19530054-19530076 GGTGTGAGGTGGAGAGAAGCAGG 0: 1
1: 0
2: 8
3: 86
4: 668
1163827132_1163827140 6 Left 1163827132 19:19530029-19530051 CCCCCGTGGTGGTCTGGTGGGCA 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1163827140 19:19530058-19530080 TGAGGTGGAGAGAAGCAGGTAGG 0: 1
1: 0
2: 8
3: 60
4: 590
1163827132_1163827142 19 Left 1163827132 19:19530029-19530051 CCCCCGTGGTGGTCTGGTGGGCA 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1163827142 19:19530071-19530093 AGCAGGTAGGACTGAGAGCAGGG 0: 1
1: 0
2: 3
3: 32
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163827132 Original CRISPR TGCCCACCAGACCACCACGG GGG (reversed) Intronic
901483189 1:9539885-9539907 TGCCCACCAGTCCCCGACGCCGG - Intronic
902392766 1:16115880-16115902 TGCCCCCCAGTCCCCCACGAGGG - Intergenic
902626113 1:17677378-17677400 TGCAAACCAGACCACCAGGGAGG - Intronic
904767956 1:32864683-32864705 AGCACACCAGAGCACCAGGGCGG - Exonic
907296799 1:53460766-53460788 GTCCCACCACACCACCACGGGGG - Intronic
908062544 1:60367682-60367704 TGCTCTCCAGCCCACCCCGGAGG - Intergenic
910924775 1:92387071-92387093 TCACCACCAGACCATCATGGCGG - Exonic
912454777 1:109790030-109790052 TGCCAACCAGAGCACCACACAGG - Intergenic
913982168 1:143530686-143530708 TGCACACCTGGCCACCACTGGGG + Intergenic
913996163 1:143653312-143653334 TAGCCACTAGACCAGCACGGGGG + Intergenic
914376655 1:147078628-147078650 TAGCCACCAGACCACCAGGGAGG - Intergenic
915316844 1:155033527-155033549 TGCCCACCAGGCAACCCCAGGGG + Exonic
916104610 1:161422144-161422166 TAGCCACTAGACCACCAGGGAGG + Intergenic
920203718 1:204276455-204276477 TGCCCCCCAGACCACCAGATGGG - Intronic
922169751 1:223144288-223144310 TGCCCACCCGAACCCCACTGTGG + Intergenic
1065384940 10:25125317-25125339 TGCCCACCAAACCATGAAGGAGG - Intergenic
1070212288 10:74337372-74337394 TGCCCACCACAGCACCAGGCAGG - Intronic
1073301180 10:102471798-102471820 TGCCCAGCAGACCTCCTGGGTGG - Intronic
1073323106 10:102627642-102627664 TGCCCACCAGAACTCCCCAGCGG - Intronic
1077422522 11:2459679-2459701 CTCCCCCCAGACCACCCCGGAGG + Intronic
1078474607 11:11620460-11620482 TGCGCTCCAGACCAGCGCGGGGG - Intronic
1080887067 11:36376934-36376956 TGCCCACCTCCCCACCATGGTGG - Intronic
1084332195 11:68436828-68436850 TGCCCCCCAGCCCACCATGCAGG - Intronic
1088917186 11:114236510-114236532 AGCCCACCAGACAGACACGGGGG + Intronic
1089352504 11:117829438-117829460 TTCCCTCCAGACCACCCTGGAGG + Intronic
1089830481 11:121323180-121323202 TGCCCACCCCACCGCCAGGGTGG - Intergenic
1090033613 11:123229145-123229167 TGCCCACCAGACCATCTAGCTGG + Intergenic
1090333531 11:125948359-125948381 TGCACACGTGGCCACCACGGAGG - Intergenic
1090358789 11:126158505-126158527 TGCACACCCGACCACCAGGCAGG + Intergenic
1092887017 12:12933770-12933792 TGTCCAAAAGACCACCACGATGG + Intergenic
1103298676 12:119909947-119909969 TGCCCACCAGAGCAGCAGTGTGG - Intergenic
1105816890 13:24044166-24044188 GGCCCACCAGGCCATCACTGTGG - Intronic
1106002766 13:25739956-25739978 TGCACAACAGTCCACCACAGTGG + Intronic
1106671924 13:31915227-31915249 TACCAACTAGACCACCAGGGTGG - Intergenic
1109384003 13:61603786-61603808 TGCCCAAAAGACCACCAGGATGG + Intergenic
1109709613 13:66144550-66144572 AGCCCCCTAGACCATCACGGCGG - Intergenic
1113713647 13:112488567-112488589 TCCCCACAATCCCACCACGGGGG + Intronic
1113838115 13:113342915-113342937 TGTCCATCACACCAGCACGGCGG + Intronic
1113961213 13:114127303-114127325 TGCCCACCAGTCCAGCACCCTGG + Intronic
1117862811 14:60110438-60110460 TGCCCACCAGGCCACTGGGGTGG - Intronic
1118000145 14:61515315-61515337 TGCCATCCACACCACCACAGTGG - Intronic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1127553968 15:60069176-60069198 TGCCCACCAAACCAGCACCTTGG + Intergenic
1129159442 15:73739282-73739304 TGCCCAGCATCCCAGCACGGAGG + Exonic
1137586429 16:49666708-49666730 AGCTCACCAGACCCCCAGGGAGG + Intronic
1146671815 17:34742927-34742949 TGCCCAGCAGGCCAGCATGGTGG - Intergenic
1151855075 17:76715283-76715305 TGCCCACCACAGAACCAAGGGGG + Exonic
1152314535 17:79572503-79572525 TGCCCACCAGGCCTCCCTGGTGG + Intergenic
1157856173 18:51107569-51107591 TGCCCACCATACCACCAAAGAGG + Intergenic
1157936749 18:51882076-51882098 TGACCAACTGACCACCAAGGTGG + Intergenic
1163827132 19:19530029-19530051 TGCCCACCAGACCACCACGGGGG - Intronic
1164724151 19:30453962-30453984 TGCCCACCACACCACATGGGAGG + Intronic
1165830857 19:38729540-38729562 TGCCCACCCACCCACCCCGGAGG - Exonic
1166560427 19:43729194-43729216 AGGTCACCAGATCACCACGGTGG + Exonic
1166783179 19:45352804-45352826 TGCCCACCAGTGCACCACTACGG - Exonic
1167605584 19:50480027-50480049 TGCCCACCAGGCCTCCGCGAAGG - Intronic
1168102101 19:54146739-54146761 TGTCCACCAGCCCAGCACAGTGG - Intronic
1168721371 19:58556617-58556639 TGCCCACAAGACCATGAGGGAGG + Intronic
925035811 2:684800-684822 AGCTCACGAGACCACCATGGAGG - Intergenic
935418589 2:102843986-102844008 TGAACACCAGGTCACCACGGAGG - Intergenic
946241636 2:218359555-218359577 AGCCCACCAGGCCTCCAGGGAGG + Intronic
947501820 2:230676458-230676480 TGCCCAACAGGTCACCAAGGAGG + Intergenic
1179618246 21:42595558-42595580 TGCCCTCCAGACCACCTTGCAGG + Intergenic
1179655069 21:42839724-42839746 TGCCCACCAAAAAACCACCGTGG - Intergenic
1180239385 21:46490153-46490175 AGCTCACCAGACCACCACTGGGG - Intronic
1180934383 22:19615063-19615085 CGGCCACCAGAGCACCACAGGGG + Intergenic
1181041170 22:20193326-20193348 AGCCCACCAGCCCACCAAGGAGG - Intergenic
1181848096 22:25729620-25729642 TGCTCCCCAGCCCACTACGGGGG + Intergenic
1184199519 22:42957166-42957188 TGCCCACTAGAACACCAGGAGGG + Intronic
949815615 3:8054745-8054767 TGGCCACAAGACTACCATGGTGG + Intergenic
950498067 3:13346232-13346254 TGCCCACCAGGCCACTCTGGAGG + Intronic
952076372 3:29701927-29701949 TGCCCACCAGTCCCACACCGAGG - Intronic
952432350 3:33235925-33235947 AGCCCACCAGAGCACCTGGGAGG + Intergenic
955340711 3:58123113-58123135 TGCCCACGAGACCACCTTCGAGG - Exonic
956715608 3:72077122-72077144 TGGCCTCCAGGCCAGCACGGTGG - Intergenic
960973777 3:123156850-123156872 TGCCCACTAGACCGCCGCTGAGG + Intronic
968380920 4:95107-95129 TGAACACCAGGCCACCACAGAGG - Intergenic
968493507 4:903141-903163 TGCCCACCACACCGCCACACAGG - Intronic
968521459 4:1036430-1036452 AGCCCTCCAGACCACCAGGCTGG - Intergenic
968764559 4:2461510-2461532 TGCCCACCAGCTCCCCAAGGTGG + Intronic
973778633 4:54267402-54267424 TGCCCGCCAGGCTACCAGGGAGG + Exonic
975800329 4:78054887-78054909 TGACCACCAGTCCACCACAGGGG - Intergenic
983154985 4:164336128-164336150 TTCTAACCAGACCACCAAGGGGG + Intronic
986249825 5:6045619-6045641 TGCCCACCGGGCCACCCCAGTGG + Intergenic
995724427 5:115169336-115169358 TGCCCACCTGAGCACCTCGGGGG - Intronic
997357427 5:133272363-133272385 TGCCCTCCTTACCACCACGCTGG - Intronic
999144139 5:149381552-149381574 TCTCCACCAGACCAGCAAGGAGG - Intronic
1006790560 6:36698471-36698493 TGCCTAACAGAATACCACGGTGG + Intronic
1007957280 6:45929396-45929418 AGCCCACCAGACCTCCGAGGTGG + Intronic
1012496208 6:99836223-99836245 TAGCCACTAGACCACCAGGGAGG + Intergenic
1015973813 6:138769228-138769250 TGCACTCCAGACCACTACGCTGG + Intronic
1017503860 6:155049314-155049336 CTCCCTCCTGACCACCACGGAGG - Intronic
1018736016 6:166687924-166687946 AGGCCCCCAGACCACCACTGGGG + Intronic
1019516280 7:1441595-1441617 TCGTCACCAGACCACCACCGGGG + Intronic
1022285731 7:28955534-28955556 GGCCCACCAGCCCACCTCAGGGG - Exonic
1023343903 7:39251794-39251816 TGCCCACCAGACCCCCAGCATGG + Intronic
1026745161 7:73005857-73005879 TACACGCCAGACCACGACGGAGG + Intergenic
1027031269 7:74890527-74890549 TACACGCCAGACCACGACGGAGG + Intergenic
1027098581 7:75359248-75359270 TACACGCCAGACCACGACGGAGG - Intergenic
1032062774 7:128738972-128738994 TTCCCACAAGACCACCAGGGCGG - Intergenic
1032496093 7:132363963-132363985 TGCTCAGCAGAGCACCAGGGTGG + Intronic
1042471133 8:69189281-69189303 TGACCACCAGTACACCACAGAGG - Intergenic
1052647347 9:31253885-31253907 TGCCCGCCAGGCCACCATGACGG + Intergenic
1057076055 9:92138674-92138696 TGCCCACGAGACCCACACGCTGG - Intergenic
1057422112 9:94920862-94920884 TCCCCAGCAGACCACCTCTGGGG - Intronic
1058638923 9:107064331-107064353 TGCCCACCACATCACCCAGGGGG + Intergenic
1060740146 9:126092470-126092492 TGACCCCCAGACCTCCACAGTGG - Intergenic
1060822731 9:126670996-126671018 TCCCCTCCAGACAACCACAGTGG - Intronic
1060934361 9:127506874-127506896 CGCCCTCCACACCACCACCGAGG - Exonic
1061288874 9:129639679-129639701 TGCCCACTAGAACACCCCGAGGG - Intronic
1061585892 9:131568134-131568156 TGGCCACCATAACACCACTGGGG + Intergenic
1061734127 9:132640766-132640788 TGCCTACCAGCCCACCACTTTGG - Intronic
1062010466 9:134264187-134264209 TGCCCTCCTGTCCCCCACGGTGG + Intergenic
1186213271 X:7272766-7272788 CTCCCACCAGACCACCAGGCAGG - Intronic
1189992629 X:46609211-46609233 AGCCCACCACAGCACCACAGAGG + Intronic
1192630914 X:72777325-72777347 TGCCCAAGAAACCCCCACGGGGG + Intronic
1192650795 X:72943476-72943498 TGCCCAAGAAACCCCCACGGGGG - Intronic
1192788176 X:74354591-74354613 AGCCCACCACACCACCAGGCTGG + Intergenic
1193699954 X:84748088-84748110 TGAACACCAGACCACCACACAGG - Intergenic