ID: 1163827957

View in Genome Browser
Species Human (GRCh38)
Location 19:19534115-19534137
Sequence GCTGGGGCCACGCAGAATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163827949_1163827957 2 Left 1163827949 19:19534090-19534112 CCAAACTGAGTCTGGGAGAGAAG 0: 1
1: 1
2: 0
3: 17
4: 229
Right 1163827957 19:19534115-19534137 GCTGGGGCCACGCAGAATCAGGG 0: 1
1: 0
2: 1
3: 9
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163827957 Original CRISPR GCTGGGGCCACGCAGAATCA GGG Intronic
900609497 1:3538509-3538531 GCTGGGGCCAGGCAGAAACAGGG + Intronic
900759559 1:4461850-4461872 GCAGTGGCCAGGCAGAAGCAGGG - Intergenic
901440264 1:9273417-9273439 GATAGGGCCACGCAGAAGCAGGG + Intergenic
901879225 1:12184486-12184508 GCTGGAGCCACACAGAGCCAGGG + Intronic
903036209 1:20494273-20494295 GCTGTGGCCCCCCAGAGTCATGG + Intergenic
905885317 1:41488569-41488591 CCTGGGGCCACTCAGCCTCAGGG + Intergenic
907311314 1:53540657-53540679 GCCGGGGTCACGCAGAGCCAGGG - Intronic
913131564 1:115842435-115842457 GCTGGGGTTAGGCAGAAGCAAGG - Exonic
914918141 1:151830817-151830839 GGTGGGGCCAGGCAGGAGCAAGG - Intronic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
917017950 1:170555804-170555826 CCTGGGGCCACTCTGGATCAGGG + Intergenic
919901784 1:202049150-202049172 GCTGGAGACAGGCAGAGTCATGG - Intergenic
921196142 1:212759908-212759930 CCTGGGGCCACCCAGCAGCAAGG + Intronic
921496908 1:215853299-215853321 GCTGGAGCCACTGAGAAACAGGG + Intronic
1063187022 10:3660743-3660765 GAGGGGGCAAGGCAGAATCAAGG + Intergenic
1064592204 10:16905712-16905734 GCTGGGCACACACAGAATTATGG + Intronic
1067009223 10:42693888-42693910 GCTGGGCACACACAGAATTATGG + Intergenic
1068504118 10:57877683-57877705 ACTGTGGCCACGCAGATTGAGGG - Intergenic
1069351855 10:67536271-67536293 TCTGGAGCAACACAGAATCAAGG - Intronic
1071231801 10:83596568-83596590 GCTGGGGCCATGCAGATAGAGGG + Intergenic
1072866607 10:99068378-99068400 GCTGGGGAGACTCACAATCATGG + Intronic
1073249633 10:102114001-102114023 GCTGGGGACAGGCAGCAACAGGG - Intronic
1077490493 11:2858764-2858786 GCTGGAGCCTCGCTGACTCAGGG + Intergenic
1078248927 11:9601373-9601395 GCTGGGGCCACTCAGCATTCGGG - Intergenic
1078643147 11:13114493-13114515 GCTGGGGCCAGGCACAATAGAGG - Intergenic
1085283034 11:75343102-75343124 GCTGGGGACAAGCAGATCCAGGG + Intronic
1085298183 11:75442687-75442709 GCTGGGGTCAGGCAGATTGATGG + Intronic
1086573230 11:88308544-88308566 GCTGGGTCCAGGTAGAACCACGG - Intronic
1088357767 11:108961142-108961164 GCTGGGGCCAGGAAGTATAAGGG - Intergenic
1088657517 11:112014840-112014862 GCTGGGGCAAAGGAGAATTATGG + Intronic
1089393090 11:118115280-118115302 GGTGGGGCCTCCAAGAATCATGG + Exonic
1089715319 11:120353622-120353644 GCTGGAGCCATCCAGAAGCAAGG - Intronic
1089741560 11:120588180-120588202 CCTGGGGCCACCCGGAATCCAGG + Intronic
1090404144 11:126467174-126467196 CCTGGGGCCCCGCAGAGTCACGG - Intronic
1091959853 12:4684423-4684445 GCTGGGGCCCCACAGAGTCCTGG - Intronic
1097176521 12:57146622-57146644 GCTGAGGCCACGGAGAGTGAGGG - Intronic
1102768481 12:115452827-115452849 GCAGGGGACACGCAGAGTTATGG - Intergenic
1103985856 12:124767112-124767134 GCTGGGGCCTCCCTGAATCTGGG + Intergenic
1109061648 13:57629591-57629613 GATGGGTCCACGCGGAGTCAGGG + Intergenic
1110616554 13:77548268-77548290 GCTGGGGACACACACAATCTGGG + Intronic
1112183669 13:97108684-97108706 GCTGAGTCAGCGCAGAATCAGGG - Intergenic
1112431484 13:99354434-99354456 GCTGGGGAAACCCAGACTCAGGG + Intronic
1115177742 14:30584015-30584037 GCTGGGGACACGGAAAATGAGGG - Intronic
1122300490 14:100728489-100728511 GTAGGGGCCACGCAGAAGCCTGG + Intronic
1130988335 15:88859236-88859258 GCTGGGTCCACTCAGACTCTGGG - Exonic
1132668039 16:1090807-1090829 GCTGGGGCCCCACAGCAACAGGG + Intronic
1134034644 16:11020466-11020488 GCTCTGGCCACCCAGAAGCATGG + Intronic
1134189722 16:12111789-12111811 GCTGGGGTAAAGCAAAATCATGG + Intronic
1137915992 16:52430767-52430789 TCTGGGGCCAAGCAGTTTCATGG + Intergenic
1140760262 16:78103064-78103086 GCAGGGGGCACGCAGGAGCAAGG - Intronic
1140937766 16:79690882-79690904 GCTGGGGCCAGGCAAGATAAAGG + Intergenic
1142629735 17:1217019-1217041 GGTGGGGCCACAGAGCATCATGG + Intronic
1142881537 17:2885779-2885801 GCTGGAGCCACTGAGAATTAAGG - Intronic
1143565794 17:7719819-7719841 GCTGTGGCCACACAGGAGCAGGG + Exonic
1143729735 17:8874319-8874341 GCTGGGTCCACACAGCATCTCGG + Intergenic
1144824265 17:18097112-18097134 ACAGGGGCCAGACAGAATCAGGG + Intronic
1145921637 17:28614224-28614246 GCTCGTGTCACGCAGCATCAGGG - Intergenic
1146913842 17:36665458-36665480 GCGGGGGTCACGCAGAGCCATGG - Intergenic
1149607624 17:57936053-57936075 CCTGGAGCCAAGCAGCATCAGGG + Intronic
1152523458 17:80873834-80873856 CCTGAGGCCACGCTGAGTCATGG - Intronic
1156561473 18:38130351-38130373 GCAGGGCCCAGGCAGAGTCAGGG - Intergenic
1157738816 18:50074110-50074132 GCTGGGGAGGCTCAGAATCATGG + Intronic
1159002624 18:62987557-62987579 GCGGAGGCCACTCAGACTCACGG - Intergenic
1159576014 18:70178397-70178419 GCTGGGGATAGGCAGAATGAGGG + Intronic
1160066057 18:75575365-75575387 GCTGGGGCCAAGGAGAGTGAAGG - Intergenic
1160151665 18:76399850-76399872 GCTGGTTCCAAGCAGAAACATGG - Intronic
1160873023 19:1285694-1285716 GCGGGGGGCGCGCAGAATCGGGG + Intergenic
1161146029 19:2678705-2678727 GCTGGGGCTTGGCAGAATCAGGG - Intronic
1161475601 19:4483185-4483207 GCTTGGGCCACGAAGACACAAGG + Intronic
1161562460 19:4981186-4981208 GCTGGGGCCACGCTGCCCCATGG - Intronic
1162388248 19:10373761-10373783 GGTGGGGGTACTCAGAATCAAGG - Intronic
1162470601 19:10870598-10870620 GATGGGGCCACCCAAAATGAAGG + Intergenic
1163222141 19:15929367-15929389 GCAGGGGCCACACAGAAGCTTGG + Intronic
1163700002 19:18782185-18782207 GCTGCGGCCGCCCACAATCATGG - Exonic
1163827957 19:19534115-19534137 GCTGGGGCCACGCAGAATCAGGG + Intronic
1163842218 19:19618470-19618492 GCAGGGGCCACGCAGGGTCGTGG - Intronic
925767015 2:7245949-7245971 TCTGGGGGCACTCAGCATCATGG + Intergenic
927252642 2:21011699-21011721 GCTGTCGACACCCAGAATCATGG + Exonic
927847060 2:26477104-26477126 TCTGGGGCCCCTCAGGATCAGGG - Intronic
934716670 2:96548813-96548835 GCTGGGGCCACACAGAGGCTCGG + Intronic
935103517 2:100019055-100019077 GCTGTGGCCACTCAGGCTCATGG + Intronic
943332182 2:186572908-186572930 GATGGTGCCACCCAGTATCAGGG + Intergenic
946136012 2:217647539-217647561 TCTGAGACCACACAGAATCATGG - Intronic
948655829 2:239476222-239476244 GCTAGGGCCACACAGACACATGG - Intergenic
1168956249 20:1836472-1836494 GCTAGGGCCACGCAGAGTGAAGG - Intergenic
1171420072 20:25012071-25012093 GCTGGGGGAATGCAGAATGAGGG - Intronic
1172163662 20:32885719-32885741 CCTGGAGCCAGGCAGATTCATGG + Intronic
1173725393 20:45293673-45293695 GCCGGGGCCAGGCAGAACCTGGG - Exonic
1175387312 20:58605506-58605528 GGTGGGGCCGCTCAGAAACATGG + Intergenic
1175913593 20:62415736-62415758 GCTGGGCCCCCGCAGGACCAGGG - Intronic
1176866957 21:14059098-14059120 GCTGGGTCAGCGCAGATTCAGGG + Intergenic
1179955547 21:44736291-44736313 GGGGTGGCCATGCAGAATCATGG + Intergenic
1181160441 22:20957036-20957058 GCTGGAGCCGCACAGAATGAAGG - Intergenic
1183586847 22:38757651-38757673 GCTGGGAGCAGGCAGAATAATGG + Intronic
1184444997 22:44541862-44541884 GCTCGGGACACCCAGAATCTTGG - Intergenic
1184940568 22:47761867-47761889 GCTGTGGCCAGTCAGAAGCAAGG + Intergenic
1185320959 22:50200133-50200155 GCTGGGGTCACGCAGAGTCTCGG + Intergenic
950689461 3:14644039-14644061 GTTGGGGCCACACAGAAACTTGG + Intergenic
950800618 3:15549309-15549331 GCTGGGGAGGCTCAGAATCATGG - Intergenic
953080105 3:39608793-39608815 GCTGGGTTCATGCAGAAGCAGGG + Intergenic
953888757 3:46735050-46735072 GCTGGGGCCAGTGAGAGTCAAGG - Intronic
954753950 3:52828967-52828989 CCTGGGGCCACACAGGAACAGGG - Intronic
962354838 3:134684937-134684959 GCTGGGGCTAGGGAGAATCCAGG + Intronic
963340876 3:144031582-144031604 GCTGGGACCACCTTGAATCAGGG - Intronic
966881446 3:184353397-184353419 GATGGAGCCCAGCAGAATCATGG + Exonic
969591716 4:8126037-8126059 GGTGAGGTCAGGCAGAATCAGGG + Intronic
978567855 4:110103112-110103134 GCTGGGGAACCTCAGAATCATGG - Intronic
986677208 5:10196509-10196531 GCTGGGGCCATGGAGAATTATGG - Intergenic
995183191 5:109247863-109247885 GCTGTGGCCAAACAGCATCATGG + Intergenic
995533636 5:113114745-113114767 GCTGGGGACAGCCAGAATCCAGG + Intronic
1000125758 5:158242255-158242277 GCTGGTCCCAATCAGAATCATGG - Intergenic
1001662971 5:173410367-173410389 GCTGGGGTCACCAACAATCAAGG - Intergenic
1003510230 6:6773340-6773362 GCTGGGGCCAGCCACAAACAAGG - Intergenic
1006291085 6:33137379-33137401 GCTAGGGCCACTCAGAAAGAGGG - Intergenic
1008276781 6:49551409-49551431 GCTGGGGCCCTGCTGAATCCCGG + Exonic
1009972450 6:70639242-70639264 ACTGGGGCCTCACAGATTCATGG + Intergenic
1017560513 6:155623551-155623573 GCTGGGGGCTCCCAGGATCATGG - Intergenic
1018584028 6:165335821-165335843 GCTGGGGCCAGACACAGTCAGGG - Intronic
1018837471 6:167496192-167496214 GCTGGGGAAAATCAGAATCAGGG - Intergenic
1018854054 6:167662930-167662952 GCTGGTGCCACCCAGAACCCAGG - Intergenic
1018997725 6:168723013-168723035 GCTGGGGAGCCTCAGAATCATGG - Intergenic
1019148090 6:169987293-169987315 GCTGGGGAGACGCAGAGCCAGGG + Intergenic
1021598279 7:22340140-22340162 GCTGGGGCCAGGCAAACTGATGG + Intronic
1025984377 7:66435115-66435137 GCTGGTGCCACACAGTATCCCGG - Intergenic
1029627477 7:101729353-101729375 GCTGGGGCCAAGCAGAAAAATGG + Intergenic
1030920318 7:115376478-115376500 GCAGGGGTTACGCAGAATAAGGG - Intergenic
1035113761 7:156505940-156505962 TCTGGGGGCACGAAGAATCAGGG + Intergenic
1035610626 8:961193-961215 GCTGGGGCCATACAATATCAAGG + Intergenic
1035862905 8:3049416-3049438 GCTAGAGCCATGCAAAATCATGG + Intronic
1036383949 8:8261567-8261589 GCTGGGGGTCCCCAGAATCATGG + Intergenic
1037201688 8:16261326-16261348 GCTGGGGCCAAACAGTAGCAGGG + Intronic
1038930100 8:32184393-32184415 GCTGAGGCCAAACAAAATCAAGG + Intronic
1041255913 8:55979722-55979744 CCTGGGGTGACGCTGAATCAGGG - Intronic
1042336061 8:67631008-67631030 GCTTGGGCCACGCAGGAGTAGGG - Intronic
1046864123 8:119127125-119127147 GCTGTGGCCAAGGAGAATAAAGG - Intergenic
1048635038 8:136286351-136286373 GTTGGGGCCACCCAGAGCCATGG + Intergenic
1049579817 8:143406240-143406262 GCCGGGGCCACGCAGGGCCAGGG - Intergenic
1052562018 9:30096350-30096372 GCTATGGCCCCGCAGAATCTAGG - Intergenic
1055561553 9:77526538-77526560 GCTGTGGACACGCAGACACAGGG + Intronic
1057031386 9:91778165-91778187 GCTGGTGACTCGCAGGATCAGGG + Intronic
1061956143 9:133962201-133962223 GATGAGGCCACCCAGGATCAGGG + Intronic
1062590631 9:137272952-137272974 GCTGGGGCCATGCCGAGTCGCGG + Exonic
1062630449 9:137460903-137460925 GCTGGAGCCAGACAGAACCAGGG - Intronic
1187608488 X:20913946-20913968 AGTGGGGCCACTCAGAACCATGG + Intergenic
1189550709 X:42089639-42089661 GCTGGGGGTAGGCAGAAACAGGG - Intergenic
1190561585 X:51691211-51691233 GCTGGGGGCCCGCAGTCTCAGGG - Intergenic
1190562706 X:51702104-51702126 GCTGGGGGCCCGCAGTCTCAGGG + Intergenic
1191011248 X:55761781-55761803 GCTGGGGGCAGGCAGAGTAATGG + Intergenic
1191039962 X:56068475-56068497 GCTGAGTTCACACAGAATCAGGG - Intergenic
1191110354 X:56799291-56799313 GCTGGGGCCACGCAGGGACAGGG - Intergenic
1202054392 Y:20814635-20814657 GCTGGGCTCACACAGAAGCAGGG - Intergenic