ID: 1163828855

View in Genome Browser
Species Human (GRCh38)
Location 19:19538342-19538364
Sequence CAGCAGCGACGCCATGGCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 123}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163828855_1163828863 19 Left 1163828855 19:19538342-19538364 CCCCGGCCATGGCGTCGCTGCTG 0: 1
1: 0
2: 0
3: 18
4: 123
Right 1163828863 19:19538384-19538406 TCGTCGCTGCGCACCTGGCGGGG 0: 1
1: 0
2: 0
3: 5
4: 61
1163828855_1163828865 27 Left 1163828855 19:19538342-19538364 CCCCGGCCATGGCGTCGCTGCTG 0: 1
1: 0
2: 0
3: 18
4: 123
Right 1163828865 19:19538392-19538414 GCGCACCTGGCGGGGGCCCGAGG 0: 1
1: 0
2: 2
3: 27
4: 208
1163828855_1163828864 20 Left 1163828855 19:19538342-19538364 CCCCGGCCATGGCGTCGCTGCTG 0: 1
1: 0
2: 0
3: 18
4: 123
Right 1163828864 19:19538385-19538407 CGTCGCTGCGCACCTGGCGGGGG 0: 1
1: 0
2: 1
3: 7
4: 76
1163828855_1163828862 18 Left 1163828855 19:19538342-19538364 CCCCGGCCATGGCGTCGCTGCTG 0: 1
1: 0
2: 0
3: 18
4: 123
Right 1163828862 19:19538383-19538405 GTCGTCGCTGCGCACCTGGCGGG 0: 1
1: 1
2: 0
3: 6
4: 64
1163828855_1163828860 14 Left 1163828855 19:19538342-19538364 CCCCGGCCATGGCGTCGCTGCTG 0: 1
1: 0
2: 0
3: 18
4: 123
Right 1163828860 19:19538379-19538401 CTGTGTCGTCGCTGCGCACCTGG 0: 1
1: 0
2: 0
3: 2
4: 55
1163828855_1163828861 17 Left 1163828855 19:19538342-19538364 CCCCGGCCATGGCGTCGCTGCTG 0: 1
1: 0
2: 0
3: 18
4: 123
Right 1163828861 19:19538382-19538404 TGTCGTCGCTGCGCACCTGGCGG 0: 1
1: 0
2: 0
3: 4
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163828855 Original CRISPR CAGCAGCGACGCCATGGCCG GGG (reversed) Exonic
900438644 1:2642844-2642866 CAGCAGCAAAGCCGGGGCCGTGG - Intronic
900483702 1:2911398-2911420 CAGCAGCGCCGCGGCGGCCGCGG - Intergenic
900663234 1:3796467-3796489 CAGCTGAGGCGCCATGGCGGCGG - Exonic
901628964 1:10638990-10639012 CGCCAGCGCCGCCAAGGCCGGGG + Exonic
901837672 1:11934772-11934794 CAGCAGGGGCCGCATGGCCGAGG - Exonic
902503274 1:16924337-16924359 CAGCAGCGATGCCATCTCTGTGG - Exonic
903205982 1:21782943-21782965 CAGCCGCGGGGCCATGGCCTTGG + Exonic
903274265 1:22210778-22210800 CAGGTGCGAGGCCATTGCCGTGG + Intergenic
905734203 1:40314986-40315008 CAGCAGCCAGGGCCTGGCCGGGG + Intronic
915251947 1:154596848-154596870 CAGCAGCAAAGCCATGGGAGCGG + Exonic
917438636 1:175045751-175045773 CAGCGGCGGCTCCATGGCCCGGG + Intergenic
1063109225 10:3020331-3020353 CCGCAGAGACGCCAAGGCAGTGG + Intergenic
1063839067 10:10049228-10049250 CAGCAGGGAGGCCATGGATGTGG + Intergenic
1065034569 10:21624819-21624841 CAGCAGAGAGGCCGTGGCCGTGG - Intronic
1071997722 10:91163507-91163529 CAGCAGCGGCGCCTCCGCCGAGG + Intronic
1072107761 10:92290796-92290818 CCGCCCCGACGCCACGGCCGGGG + Intronic
1076724206 10:132405769-132405791 CAGCAGCGACAGCCTGGACGAGG + Exonic
1078771846 11:14358861-14358883 CTGTAGCGTCCCCATGGCCGCGG - Exonic
1082881293 11:58040914-58040936 CAGCAAAGACACCATGGCCATGG - Intronic
1083592405 11:63903418-63903440 CAGCTGCCATGCCCTGGCCGTGG - Intronic
1085393565 11:76194779-76194801 CATCAGCCACGCCATCGCCCGGG - Exonic
1092007125 12:5079005-5079027 CAGCACCGAGCCCATGGCCGAGG - Intergenic
1092899374 12:13044396-13044418 CAGCACGGTCGCCATGGCTGAGG - Exonic
1093464976 12:19439851-19439873 CAGCAGCGCCGCCACCGCCTCGG - Exonic
1101839694 12:108319138-108319160 CAGCAGAGACGTCATGGCCAGGG - Intronic
1104429153 12:128702820-128702842 CAGCACCCACTCCATGGACGGGG - Intronic
1112580706 13:100674608-100674630 CAGCAGCGCCGCTCTGGCCCGGG + Intronic
1113653764 13:112055977-112055999 CAGCGGGGACACCGTGGCCGTGG - Intergenic
1114192970 14:20454669-20454691 CAGCACCGCCGGCATGGCGGAGG + Exonic
1118753635 14:68823180-68823202 CAGCAGCCATGTCCTGGCCGTGG - Intergenic
1122743603 14:103885618-103885640 CAGCAGAGGCGGCATGGCCATGG - Intergenic
1122771866 14:104101227-104101249 CAGCAGCCACGCCCTGGGCAAGG - Intronic
1124500736 15:30225065-30225087 CTGCAGCGTGGCGATGGCCGAGG - Intergenic
1124742833 15:32313602-32313624 CTGCAGCGTGGCGATGGCCGAGG + Intergenic
1126738050 15:51751614-51751636 CAGGGGCGGCGCCGTGGCCGGGG - Exonic
1126849740 15:52789708-52789730 CAGCAGGGACGCCATGCCCATGG + Exonic
1128322618 15:66703678-66703700 CGCCAGCGACCCCCTGGCCGGGG + Exonic
1128482767 15:68054386-68054408 CAGCAGCGGCGCCGTCTCCGCGG - Intronic
1129389723 15:75214509-75214531 CAGCAGCAAGGCCATGTCCACGG - Intergenic
1129839400 15:78734514-78734536 TAGCAGTGAGGCCATGGCCATGG + Intergenic
1135115259 16:19718299-19718321 CCGCGGTGCCGCCATGGCCGCGG - Exonic
1135339015 16:21630439-21630461 CAGAGCCGACGCCGTGGCCGAGG + Intronic
1137714811 16:50592208-50592230 CAGCAGCAACGCGCTGGCCTTGG - Intronic
1138837983 16:60461091-60461113 CATCAGCTAAGCCATGGCCAAGG - Intergenic
1141715356 16:85723901-85723923 CAGCCGCGATGCCCTGGCCCAGG + Intronic
1141972425 16:87492694-87492716 CGGCGGCGACGGCATGGCCGGGG - Intergenic
1143053076 17:4142772-4142794 GAGCCGCGACGCCCGGGCCGGGG + Exonic
1146451974 17:32981766-32981788 CAGCAGGGAGGCCCTGGCCCTGG + Intronic
1147805273 17:43126713-43126735 CAGAATGGACGCCAAGGCCGAGG - Intergenic
1148820234 17:50355751-50355773 CAGCAGAGAGGCCATGGCTGGGG - Intronic
1150549092 17:66192292-66192314 CAGGAGCGTCGCCATGGCAACGG - Intergenic
1151620787 17:75243639-75243661 GAGCAGCCACGCCATTGCTGTGG - Intronic
1152068778 17:78125121-78125143 CAGCAGCGGCGGCATGGTCAGGG + Intronic
1152725222 17:81941775-81941797 CAGCAGGGACCCCAGGGCCTTGG - Exonic
1152748432 17:82051698-82051720 CAGCAGCGCGGCCAGGGCCGCGG + Exonic
1152925901 17:83087636-83087658 CAGCAGTGACGCCATCCCCTGGG + Intronic
1160455040 18:78993797-78993819 CTGCACCAACGCCAGGGCCGGGG + Exonic
1160725386 19:615975-615997 CTGCAGCGTGGCGATGGCCGAGG - Exonic
1163828855 19:19538342-19538364 CAGCAGCGACGCCATGGCCGGGG - Exonic
1165040615 19:33065190-33065212 CCGCAGCGAAGCCCTGGCTGTGG + Intergenic
1168307205 19:55442266-55442288 CATCAGCTTCGCCCTGGCCGTGG - Exonic
1168350124 19:55670855-55670877 CAGCAGGGAAGCCAGGGCCAGGG - Intronic
925302455 2:2826842-2826864 CATCAGGCACGCCATGGCCCTGG + Intergenic
925536628 2:4925239-4925261 CAGCAGCCACGCCATGACTTTGG - Intergenic
926113530 2:10197083-10197105 CTGGAGAGACGCCATGGCAGGGG - Intronic
929555803 2:42924948-42924970 TAGCAGAGCCGCCAGGGCCGTGG - Intergenic
932562767 2:72887503-72887525 CAGCAGCGAGGCCAGGAGCGGGG - Exonic
933992524 2:87643789-87643811 CATCAGCCACCCCATGGCTGAGG + Intergenic
935245480 2:101215583-101215605 CTGCAGGGAAGCCATGGCAGAGG + Intronic
936301329 2:111307052-111307074 CATCAGCCACCCCATGGCTGAGG - Intergenic
942558708 2:177198463-177198485 CAGCAGCTCCACCAGGGCCGTGG + Intergenic
943064376 2:183071108-183071130 CATCAGCTACACCAGGGCCGTGG - Intergenic
947701831 2:232240814-232240836 CAGCAGCTAGTGCATGGCCGTGG - Intronic
947866170 2:233399450-233399472 CAGCAGCCACGGCAGGGCTGGGG + Intronic
1168837242 20:885392-885414 CTGCAGGGACTCCAGGGCCGGGG - Intronic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1176288683 21:5033123-5033145 CAGCAGTGGCATCATGGCCGTGG - Intronic
1177344768 21:19854464-19854486 CAGCAGGGAAGGCGTGGCCGGGG - Intergenic
1179868501 21:44230352-44230374 CAGCAGTGGCATCATGGCCGTGG + Intronic
1180880355 22:19199091-19199113 CAGCAGTGTCACCATGGCCATGG - Intronic
1181202331 22:21225419-21225441 CACCAGGGCTGCCATGGCCGCGG - Exonic
1181361757 22:22343211-22343233 CAGCAGCTCCACCATGGCCTGGG + Intergenic
1182485620 22:30636890-30636912 CAGCAGCGCCGACAGGGCCAGGG - Exonic
1183769487 22:39911808-39911830 CAGCAGCAACGGCACCGCCGGGG + Intronic
1184187331 22:42873533-42873555 CAGCAGGGAAGCCAGGGCCTGGG - Intronic
950182920 3:10927686-10927708 CAGCTGCGAGGCCATAGCCTGGG + Intronic
953928415 3:46994010-46994032 CAGCAGCCTCACCTTGGCCGAGG - Exonic
954395954 3:50293406-50293428 CACCAGCGGTGCCATGGCCACGG - Exonic
955712013 3:61789999-61790021 CATCAGGGTCGGCATGGCCGTGG + Intronic
956862451 3:73338569-73338591 CAGCAGCGAGGCTAGGGGCGGGG - Intergenic
957704996 3:83769884-83769906 CAGCAGCGAGGCCGTGGCTGGGG + Intergenic
967966746 3:194966637-194966659 CAGCAGTGTCGGCATGGCCGTGG + Intergenic
969398606 4:6938949-6938971 CAGCAGCGGCGCCATCCCCCAGG + Intronic
973888552 4:55346713-55346735 CAGCAGCCGGGGCATGGCCGGGG - Intronic
978072626 4:104491565-104491587 CAGCAGCGCCGCCGCCGCCGCGG - Exonic
980130362 4:128811616-128811638 CAGCTGCGCCGCCCGGGCCGGGG + Intronic
983558224 4:169077110-169077132 CAGCAGCGCCGCCAGGACCCCGG - Intergenic
986169424 5:5303633-5303655 CAGCAGCTGCGCTCTGGCCGAGG - Exonic
986194545 5:5526218-5526240 CAGCAGTGAAGCCCTGGCTGAGG + Intergenic
987320453 5:16764366-16764388 CAGCAGGGACTCCCTGGCCATGG - Exonic
992168508 5:74078297-74078319 CAGCAGTGAGGCCATGGCCATGG - Intergenic
995192837 5:109337644-109337666 CAGCAGTGATGCAATGGCAGAGG + Intronic
995596931 5:113757422-113757444 CAGCTGCCACGCCAGGGCCAGGG + Intergenic
996432853 5:123400984-123401006 CACCAGCTACTCCAGGGCCGTGG - Intronic
998385614 5:141755512-141755534 CAGCAGGGATGACATGGCCAGGG - Intergenic
998387455 5:141765962-141765984 CAGCAGGGCTGCCATGGCCATGG - Intergenic
999790818 5:154938058-154938080 CTGCAGCGATGCCGTGCCCGGGG - Exonic
1001773860 5:174314408-174314430 CAGCAGGGGCGCCATGGCTGGGG + Intergenic
1002541234 5:179907724-179907746 CTGCAGCGACGCCGGGGCCACGG - Exonic
1003343130 6:5240833-5240855 CAGCAGCGCCTCAATGGCGGGGG + Intronic
1006103730 6:31703267-31703289 CAGCAGCTTCGCCATGGCCCCGG + Exonic
1006985124 6:38170841-38170863 CTGCAGCGATGCCGTGGCAGAGG - Exonic
1011404349 6:87002286-87002308 CAGGAGCGAAGCCATGGACTTGG + Intronic
1018992077 6:168681880-168681902 CAGCAGCTCAGCCATGGCCGAGG - Intergenic
1021175004 7:17440195-17440217 CAGCAGGGAGGCCATGGGCCTGG + Intergenic
1024983091 7:55173811-55173833 CAGCAGCCACGGCATGGGCTTGG - Intronic
1026817136 7:73521919-73521941 CAGGAGCGGCGCCATCGCGGCGG + Exonic
1031992609 7:128207841-128207863 CAGCAGCCATCCCATGGCAGGGG - Intergenic
1032086667 7:128887274-128887296 CAGTAGTGACGCCATGGTAGCGG + Exonic
1034422884 7:150998558-150998580 CCGCAGCGCTGCCCTGGCCGAGG + Exonic
1039064969 8:33599725-33599747 CAGCAGGAGCGTCATGGCCGTGG - Exonic
1039364900 8:36919268-36919290 CAGCAGTGACACCAGGGCTGGGG + Intronic
1040725736 8:50379367-50379389 CAGCTGTGAAGCCATGGCTGTGG - Intronic
1049271593 8:141698967-141698989 CACCTGCGAGGTCATGGCCGGGG + Intergenic
1049427027 8:142542280-142542302 CCGCAGCGTGGCCGTGGCCGTGG - Exonic
1050343323 9:4662507-4662529 CAGCAGCCGCGCCACGGCCGTGG + Exonic
1050388260 9:5112119-5112141 CTGCAGCCACGCCATGGGCACGG + Intronic
1053056154 9:34994101-34994123 TAGCAGCTACATCATGGCCGTGG - Intronic
1060017510 9:120099355-120099377 CAGCAGCCAGGCCATGGCAGTGG - Intergenic
1060770329 9:126327271-126327293 CAGCAGCGCCCCCAAGGCCCGGG + Intronic
1061072923 9:128322851-128322873 CAGCAGAGTCGCCATGGCAGCGG - Exonic
1061149044 9:128818677-128818699 CCGCAGCGCCCGCATGGCCGGGG - Exonic
1061630050 9:131866605-131866627 TAGCAGTGACGCCTTGGGCGAGG + Intronic
1061828297 9:133275180-133275202 CAGACGCGGAGCCATGGCCGAGG - Exonic
1062246052 9:135566704-135566726 GAGCAGCCTCCCCATGGCCGTGG - Exonic
1062270798 9:135707476-135707498 CAGCAGCCACAGCGTGGCCGGGG + Intronic
1062347528 9:136122248-136122270 CAGCAGAGGCGCCATGGTCGGGG + Intergenic
1062408667 9:136410436-136410458 CAGCGGCGGCTCCATGGCCCCGG + Exonic
1062564245 9:137156909-137156931 CATCAGCGACGCCGTGGGCGTGG + Exonic
1192768007 X:74162325-74162347 CAGCTGCGCCGCCACTGCCGTGG + Intergenic
1197446387 X:126555248-126555270 CAGCAGCGACTCAAGGGCCCCGG - Intergenic
1200224888 X:154411903-154411925 CAGCAGCGTCGTCATGGGCTTGG + Exonic