ID: 1163829658

View in Genome Browser
Species Human (GRCh38)
Location 19:19541557-19541579
Sequence ATGCCAGGGGGCTCTTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 142}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163829646_1163829658 26 Left 1163829646 19:19541508-19541530 CCTCCTGGGCCCAAGGAGCACTG 0: 1
1: 0
2: 1
3: 25
4: 383
Right 1163829658 19:19541557-19541579 ATGCCAGGGGGCTCTTGTGCAGG 0: 1
1: 0
2: 0
3: 16
4: 142
1163829649_1163829658 17 Left 1163829649 19:19541517-19541539 CCCAAGGAGCACTGGTAACTATG 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1163829658 19:19541557-19541579 ATGCCAGGGGGCTCTTGTGCAGG 0: 1
1: 0
2: 0
3: 16
4: 142
1163829645_1163829658 27 Left 1163829645 19:19541507-19541529 CCCTCCTGGGCCCAAGGAGCACT 0: 1
1: 0
2: 1
3: 31
4: 251
Right 1163829658 19:19541557-19541579 ATGCCAGGGGGCTCTTGTGCAGG 0: 1
1: 0
2: 0
3: 16
4: 142
1163829650_1163829658 16 Left 1163829650 19:19541518-19541540 CCAAGGAGCACTGGTAACTATGC 0: 1
1: 0
2: 1
3: 2
4: 98
Right 1163829658 19:19541557-19541579 ATGCCAGGGGGCTCTTGTGCAGG 0: 1
1: 0
2: 0
3: 16
4: 142
1163829648_1163829658 23 Left 1163829648 19:19541511-19541533 CCTGGGCCCAAGGAGCACTGGTA 0: 1
1: 0
2: 1
3: 18
4: 134
Right 1163829658 19:19541557-19541579 ATGCCAGGGGGCTCTTGTGCAGG 0: 1
1: 0
2: 0
3: 16
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163829658 Original CRISPR ATGCCAGGGGGCTCTTGTGC AGG Intronic
900586682 1:3435960-3435982 ACGCCAGCTGGCTCTTCTGCAGG - Exonic
900760585 1:4467559-4467581 ATCCCAGGGGCCTCCTGGGCTGG - Intergenic
906670545 1:47651129-47651151 ACGCCAGGGAGCTCGAGTGCTGG + Intergenic
912386264 1:109272659-109272681 AGGCCAGGGGGCCCTTGGCCAGG - Exonic
914977303 1:152378300-152378322 CTGCCAGTGTGCTCTTCTGCTGG + Intergenic
919817243 1:201449184-201449206 AGGACAAGGGGCCCTTGTGCAGG - Intergenic
920415023 1:205793400-205793422 ATGCCAGGGGTCTGTGGTGGAGG - Intronic
923199890 1:231701165-231701187 AGGCAAGAGGGCGCTTGTGCAGG + Intronic
923679708 1:236109768-236109790 ATGCCAGGTGTGTCTGGTGCCGG + Intergenic
1065511793 10:26486543-26486565 ATGCCTGGGGGATGTTGAGCTGG + Intronic
1066016119 10:31245814-31245836 GTGCCATGGGGTTCTTGAGCAGG - Intergenic
1067567257 10:47348438-47348460 AGTCCAGGGAGCTTTTGTGCAGG + Exonic
1068732309 10:60373252-60373274 AGGCCAGGGGCCTCTTGTGTGGG + Intronic
1069033508 10:63623718-63623740 ATGTGAGGGGGATCTTATGCAGG - Exonic
1071415241 10:85435311-85435333 ATGAAAGGGGTCTCCTGTGCAGG + Intergenic
1074311562 10:112327322-112327344 AGCCCAGGGGGCTCCTGTGGAGG + Intergenic
1074349039 10:112716945-112716967 ATGGCAAGGGGCTCTTGGGGTGG - Intronic
1075569120 10:123526491-123526513 ATGGCAGGGAGCTCTGGAGCTGG + Intergenic
1075903470 10:126061997-126062019 ATGCCAGGGAGCTCTTGGAATGG - Intronic
1077102937 11:830192-830214 GTGCCAGGGGGCTGTAGCGCTGG + Intronic
1082997069 11:59263089-59263111 CTGCCAGGGGGCTGCTGTGGTGG + Intergenic
1089248350 11:117138511-117138533 AGTCCAGGGCGCTCTTGTTCTGG - Intergenic
1089258356 11:117206050-117206072 AGTCCAGGGCGCTCTTGTTCTGG + Exonic
1089810279 11:121125894-121125916 ATGACAGGTCTCTCTTGTGCAGG + Intronic
1091547266 12:1509842-1509864 ATGCAAAGGGGCTCTGGTGAAGG - Intergenic
1093866124 12:24229250-24229272 ATGCCAGGGGGCTAATGTGGCGG + Intergenic
1096236572 12:49932188-49932210 AGGCCAGGGGGCTCCTGCTCTGG - Intergenic
1097162610 12:57059139-57059161 ATGCCTGTAGGCTCTTCTGCAGG - Exonic
1105350518 13:19611012-19611034 ATTCCAGGGGCCTTTTTTGCAGG - Intergenic
1108424649 13:50287283-50287305 ATGCCATGGGTCTCTTTAGCTGG + Intronic
1110941816 13:81360224-81360246 ATGGAAGGGGACTCTTGTCCTGG + Intergenic
1111842516 13:93467929-93467951 ATGCCAGGTGACACTTGTGGTGG + Intronic
1112675172 13:101693133-101693155 ATGCCAGTGAGCTCTTGTTTGGG - Intronic
1119793549 14:77376401-77376423 AGGCCAGGGGGCCTATGTGCAGG + Intronic
1119926799 14:78502229-78502251 ATGGCAGGGTGTTCCTGTGCTGG - Intronic
1120977126 14:90258616-90258638 AAGCCAGGGGGCTCTGGGGCAGG - Intronic
1126462378 15:48927540-48927562 ATGCCAGGGGTTTCATGTGGTGG - Intronic
1130106404 15:80931946-80931968 AGGCCAGGGCGCTGGTGTGCCGG - Exonic
1131154844 15:90068397-90068419 AGGCCAGGTGGCGCTTGAGCTGG - Exonic
1132316341 15:100893146-100893168 ATGCTTGGGGGCTCTTGAGATGG + Intronic
1136024576 16:27461436-27461458 AAGCCATGGGGCTCTCGTCCAGG + Exonic
1137481030 16:48852223-48852245 ATGCCTGGGGGCACTGGTGGGGG - Intergenic
1140803530 16:78511002-78511024 ATGCCAGGTGGCTTTGCTGCTGG - Intronic
1142024160 16:87803563-87803585 CAGCCAGGTGGTTCTTGTGCAGG - Intergenic
1142468709 17:150148-150170 ATGACAGGGAGGTCATGTGCAGG + Intronic
1147191925 17:38742920-38742942 ATGCCTGGGGTCTCTGTTGCTGG + Intronic
1148139166 17:45316550-45316572 ATGCCAGGGCGCACTCCTGCAGG + Intronic
1150122761 17:62617439-62617461 ATACAAGAGGGCTATTGTGCTGG + Intergenic
1152564098 17:81092494-81092516 CTGCCAGGGTGCCCTTGAGCGGG + Intronic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1160521780 18:79512064-79512086 ATGCCAGGGGTCGCTTGGGCCGG - Intronic
1162124783 19:8493603-8493625 AAGGCAGGGGGCTCCTCTGCAGG - Intronic
1163312357 19:16522035-16522057 AGGCCAGGGGGCTCCAGGGCCGG - Intronic
1163829658 19:19541557-19541579 ATGCCAGGGGGCTCTTGTGCAGG + Intronic
1165027633 19:32973149-32973171 AAGCCAGGCGGCACTTGAGCAGG - Intronic
1168168024 19:54567117-54567139 ATGCCAGGCAACTCTTGAGCGGG + Intergenic
1202648539 1_KI270706v1_random:161151-161173 ATTACAGGGGACTCTTCTGCTGG + Intergenic
925468032 2:4127866-4127888 CTGCCAGGAGTCTCTTATGCTGG - Intergenic
926617490 2:15011627-15011649 GGGCCATGGGGCTCTTTTGCTGG - Intergenic
928142862 2:28745648-28745670 GTTCTAGGGTGCTCTTGTGCAGG + Intergenic
935378549 2:102425083-102425105 CTGACAGGGGGCTCTTTTGGAGG - Intronic
936840813 2:116765945-116765967 ATCCCAGGGGCCTCTTTTCCTGG + Intergenic
938541303 2:132286183-132286205 ATTACAGGGGCCTCTTCTGCTGG + Intergenic
938558456 2:132448210-132448232 ATGCCAGGAGAGTCTTGTCCAGG - Intronic
938822462 2:134973295-134973317 ATACCTGGGTGCTCTGGTGCAGG + Intronic
940000603 2:148963308-148963330 GAGCCCGGGGGCTGTTGTGCAGG + Intronic
940446001 2:153778110-153778132 ATGCCAGTGTGCTCCTATGCCGG + Intergenic
941099734 2:161282458-161282480 ATTACAGGGGCCTCTTCTGCTGG - Intergenic
946321676 2:218958440-218958462 AAGCCTGAAGGCTCTTGTGCTGG + Intergenic
1171351706 20:24507579-24507601 AGGCAAGGGGACTCTTCTGCAGG - Intronic
1171393023 20:24813617-24813639 ATGGCTGAGGGCTCTTCTGCTGG - Intergenic
1171449135 20:25223996-25224018 GTGCCTTGGGGCTCTTGGGCTGG + Intronic
1171870210 20:30519205-30519227 ATTACAGGGGCCTCTTCTGCTGG + Intergenic
1172844256 20:37920373-37920395 ATGCCACGGGGCTGCTGGGCTGG + Intronic
1176603315 21:8811536-8811558 ATTACAGGGGCCTCTTCTGCTGG - Intergenic
1180100450 21:45581542-45581564 AGGACAGGTGGCTCTGGTGCAGG - Intergenic
1180345600 22:11703093-11703115 ATTACAGGGGCCTCTTCTGCTGG - Intergenic
1180352115 22:11814219-11814241 ATTACAGGGGCCTCTTCTGCTGG + Intergenic
1180386093 22:12177847-12177869 ATTACAGGGGCCTCTTCTGCTGG - Intergenic
1182076383 22:27498258-27498280 AAGCCAGGGAGCTCTTGGGAAGG - Intergenic
1183376719 22:37469668-37469690 AGGGCAGGGGGCACTTGAGCTGG - Exonic
1184126192 22:42489036-42489058 ATGCCACGGGCCTCCTGGGCAGG + Intergenic
1184134132 22:42536368-42536390 ATGCCATGGGCCTCCTGGGCAGG + Intergenic
1184796449 22:46736128-46736150 AAGCCAAGGTGCTTTTGTGCGGG - Intronic
950660154 3:14462106-14462128 CTGCCAGGGGCCTCTGGTGGTGG - Intronic
954089336 3:48272181-48272203 ATGCCTGGGGCCTGTGGTGCCGG + Intronic
955059896 3:55485377-55485399 AAGACAGGGGACTCTTGGGCCGG + Intronic
961038314 3:123658987-123659009 ATGCCAGAGGCCTCCTGTGATGG + Intronic
961651021 3:128416657-128416679 ATGTCATGGGGTTCTTTTGCTGG + Intergenic
963834894 3:150048264-150048286 ATTCCAGGGGACTCTGGTTCTGG - Intronic
966912570 3:184567578-184567600 ATGTCAGGGTGCTCCTTTGCAGG + Intronic
968970988 4:3793773-3793795 ATGGGAGGGGCCCCTTGTGCTGG - Intergenic
972629338 4:40829707-40829729 CTGCAAGGGGGCTGTTATGCTGG + Intronic
973374764 4:49279115-49279137 ATGACAGGGGCCTCTTCTGCTGG + Intergenic
973375666 4:49285137-49285159 ATGACAGGGGCCTCTTCTGCTGG + Intergenic
973376565 4:49291156-49291178 ATGACAGGGGCCTCTTCTGCTGG + Intergenic
973377485 4:49297308-49297330 ATGACGGGGGCCTCTTCTGCTGG + Intergenic
973378403 4:49303444-49303466 ATGACGGGGGCCTCTTCTGCTGG + Intergenic
973379754 4:49311919-49311941 ATGACAGGGGCCTCTTCTGCTGG - Intergenic
973380657 4:49318059-49318081 ATGACGGGGGCCTCTTCTGCTGG - Intergenic
973381745 4:49325104-49325126 ATGACAGGGGCCTCTTCTGCTGG - Intergenic
973382647 4:49331126-49331148 ATGACAGGGGCCTCTTCTGCTGG - Intergenic
973386257 4:49516175-49516197 ATGACAGGGGCCTCTTCTGCTGG - Intergenic
974461303 4:62191637-62191659 ATGCCAGATGTTTCTTGTGCGGG + Intergenic
978349611 4:107807974-107807996 ATGGAAGGGGGCACTTGGGCAGG + Intergenic
979950907 4:126892405-126892427 ATACCAGGGGGTACATGTGCAGG + Intergenic
986488913 5:8269468-8269490 ATGTCAGGTGGCTCCTGTGGAGG + Intergenic
989013443 5:36900967-36900989 ATTCCAGGGGGTACATGTGCAGG + Intronic
990015462 5:51056311-51056333 ATTCCATGGAGCACTTGTGCTGG + Intergenic
1003131117 6:3396229-3396251 AGGCCAGGGTGGTCTTGGGCAGG - Intronic
1007767052 6:44166808-44166830 AAGCCTCGGGGCTCATGTGCGGG + Exonic
1008075985 6:47146773-47146795 CTGTCAGGGGCCTCTTTTGCTGG - Intergenic
1011447756 6:87460752-87460774 ATTCAAGGGGGCACATGTGCAGG - Intronic
1015470764 6:133603558-133603580 ATGCCAGTGGGCTCAAGAGCCGG + Intergenic
1017070082 6:150568311-150568333 ATGCCTGTGGACTCTTTTGCAGG + Intergenic
1017591451 6:155982269-155982291 ATACTAGGGTGCTCTGGTGCAGG - Intergenic
1019312014 7:367501-367523 AGGCCAGAGGGCACTTCTGCAGG + Intergenic
1020110807 7:5446810-5446832 ATACCAGGGGGCTATTCTGGGGG + Intronic
1023282462 7:38585160-38585182 ATGCCATGGGGTTCTTGTGAGGG - Intronic
1023629329 7:42148193-42148215 ATGCCAGTCGGCACTTGTTCAGG - Intronic
1029854532 7:103501860-103501882 ATGCAAGGTGGCGCTTGTTCTGG + Intronic
1030219082 7:107078442-107078464 AGGCCTGGGGGCTTTTGTCCAGG + Intronic
1031476167 7:122224526-122224548 ATTCCAGTGTGCTCTTGTGCTGG - Intergenic
1031989678 7:128189498-128189520 CTAGCAGGGGGCTCTTGAGCAGG - Intergenic
1032879492 7:136074112-136074134 ATGGCAGGGGCCTCTAGCGCTGG + Intergenic
1034447431 7:151120801-151120823 ACACCTGGGGGCTGTTGTGCTGG + Intronic
1035399692 7:158556886-158556908 AGGTCAGGGGGCTCCCGTGCAGG + Intronic
1035399737 7:158557076-158557098 AGGTCAGGCGGCTCCTGTGCAGG + Intronic
1035399788 7:158557271-158557293 AGGTCAGGCGGCTCCTGTGCAGG + Intronic
1035858470 8:3002406-3002428 ATGGCTGGGATCTCTTGTGCTGG - Intronic
1039779094 8:40766152-40766174 ATGCCAAGGGGCTCTGGTCAGGG - Intronic
1039806554 8:41004941-41004963 ATGCCAGGGTGCTCCTGAGAAGG + Intergenic
1047542585 8:125784912-125784934 ATGCCAGTGTGCTCCTATGCTGG - Intergenic
1048196481 8:132335926-132335948 ACACCAGGAGGCCCTTGTGCTGG + Intronic
1048294896 8:133206843-133206865 CTGCCAGGGGGTTCTTGGACAGG + Intronic
1056386853 9:86103945-86103967 ATGAGAGGGGGCTCTTATCCTGG + Intergenic
1056830409 9:89912449-89912471 AGGGCAGGGGGCTCGTGTGGAGG + Intergenic
1057349978 9:94288118-94288140 ATTCCAGGGTGCTCTGGTGCTGG - Intronic
1060587398 9:124795154-124795176 AGGCCAGGCTGCTCTGGTGCTGG + Intronic
1203698469 Un_GL000214v1:117220-117242 ATTACAGGGGCCTCTTCTGCTGG + Intergenic
1203699387 Un_GL000214v1:123371-123393 ATTACAGGGGCCTCTTCTGCTGG + Intergenic
1203700331 Un_GL000214v1:129654-129676 ATTACAGGGGCCTCTTCTGCTGG + Intergenic
1203701253 Un_GL000214v1:135674-135696 ATTACAGGGGCCTCTTCTGCTGG + Intergenic
1203480080 Un_GL000224v1:4257-4279 ATTACAGGGGCCTCTTCTGCTGG + Intergenic
1203482013 Un_GL000224v1:16894-16916 ATTACAGGGGCCTCTTCTGCTGG + Intergenic
1203416735 Un_KI270330v1:350-372 ATTACAGGGGCCTCTTCTGCTGG - Intergenic
1203548579 Un_KI270743v1:150614-150636 ATGACAGGGGCCTCTTCTGCTGG + Intergenic
1203550779 Un_KI270743v1:163956-163978 ATGACAGGGGCCTCTTTTGCTGG - Intergenic
1203568040 Un_KI270744v1:108365-108387 ATTACAGGGGCCTCTTCTGCTGG + Intergenic
1203569678 Un_KI270744v1:119608-119630 ATTACAGGGGCCTCTTCTGCTGG + Intergenic
1186507946 X:10109198-10109220 ATGGCCAGGGGCTCTGGTGCAGG + Intronic
1189553653 X:42119189-42119211 ATCCCTGGGGGCTTTTCTGCTGG - Intergenic
1191141209 X:57118540-57118562 ATGCCATGGGGCAGTTGGGCTGG - Intronic
1191142813 X:57134264-57134286 ATGCCATGGGGCAGTTGGGCTGG - Intergenic
1194058126 X:89163414-89163436 ATGCCAGTAGGCTCCTGTGTAGG + Intergenic
1196071665 X:111530417-111530439 CTTCCAGGAGTCTCTTGTGCAGG + Intergenic
1196862432 X:120040796-120040818 ATGGCAGGAGCCTCTTGTTCAGG - Intergenic
1196880670 X:120195548-120195570 ATGGCAGGAGCCTCTTGTTCAGG + Intergenic
1197702857 X:129612557-129612579 CTGCCCTGGGGCTTTTGTGCTGG + Intergenic