ID: 1163830713

View in Genome Browser
Species Human (GRCh38)
Location 19:19545981-19546003
Sequence CTACCCCGGCGGGTGCGGAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 84}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163830713_1163830727 2 Left 1163830713 19:19545981-19546003 CCCCTCCGCACCCGCCGGGGTAG 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1163830727 19:19546006-19546028 TCCGGCAGTGACCTGGGCAGGGG 0: 1
1: 0
2: 1
3: 17
4: 234
1163830713_1163830726 1 Left 1163830713 19:19545981-19546003 CCCCTCCGCACCCGCCGGGGTAG 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1163830726 19:19546005-19546027 GTCCGGCAGTGACCTGGGCAGGG 0: 1
1: 0
2: 1
3: 15
4: 180
1163830713_1163830724 -4 Left 1163830713 19:19545981-19546003 CCCCTCCGCACCCGCCGGGGTAG 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1163830724 19:19546000-19546022 GTAGGGTCCGGCAGTGACCTGGG 0: 1
1: 0
2: 0
3: 8
4: 94
1163830713_1163830723 -5 Left 1163830713 19:19545981-19546003 CCCCTCCGCACCCGCCGGGGTAG 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1163830723 19:19545999-19546021 GGTAGGGTCCGGCAGTGACCTGG 0: 1
1: 0
2: 0
3: 7
4: 92
1163830713_1163830725 0 Left 1163830713 19:19545981-19546003 CCCCTCCGCACCCGCCGGGGTAG 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1163830725 19:19546004-19546026 GGTCCGGCAGTGACCTGGGCAGG 0: 1
1: 0
2: 2
3: 18
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163830713 Original CRISPR CTACCCCGGCGGGTGCGGAG GGG (reversed) Exonic
903258135 1:22116367-22116389 CTACTCAGGAGGGTGAGGAGTGG - Intergenic
907237465 1:53062117-53062139 CTCCCGGGGCGGGTGGGGAGTGG + Intronic
910754219 1:90669525-90669547 CTACCCCGGCTGGAGTGCAGCGG - Intergenic
914844580 1:151274979-151275001 CTACCCAGGCTGGAGCGCAGTGG - Intergenic
915462258 1:156077095-156077117 CTGCATCGGCGAGTGCGGAGTGG - Exonic
915834814 1:159168284-159168306 CTACCCAGGCTGTTGCTGAGTGG + Intergenic
920440600 1:205978284-205978306 CTACCCTGGAGGGAGCAGAGGGG + Exonic
1063420537 10:5909276-5909298 CTACCCCGGCAGCAGCGTAGAGG - Exonic
1069504551 10:68986327-68986349 CTACCCAGGCTGGTGTGCAGCGG + Intergenic
1070285805 10:75082900-75082922 CTACCCAGGCTGGAGCGCAGTGG - Intergenic
1076864751 10:133161073-133161095 CTACCCCGCAAGGTGCAGAGGGG + Intronic
1080677135 11:34438745-34438767 ATACCCAGGAGGGTGCGGAAAGG - Intergenic
1084665413 11:70573704-70573726 CTGCCCCTGAGGGTGAGGAGGGG + Intronic
1091718412 12:2795535-2795557 CCACCCCGGCGCGCGCGGGGCGG + Intronic
1093894672 12:24562720-24562742 CCGCCCCGGGGGGTGCGGCGGGG + Intergenic
1096495436 12:52037120-52037142 CTCCCCCGGCGGGCGGGGCGGGG - Intronic
1102508220 12:113397388-113397410 CTTCCCTGGAGGGTGGGGAGAGG + Exonic
1103856088 12:123972460-123972482 CAGCGCCGGCGGGGGCGGAGGGG - Intronic
1103992886 12:124810974-124810996 CTACCACGGGGAGTGGGGAGTGG + Intronic
1110318356 13:74134834-74134856 CCACCCGGGCGGGTGCGGCGAGG - Intergenic
1114567961 14:23646246-23646268 CGTCCCCGGCTGGTGTGGAGAGG - Intergenic
1117315465 14:54567327-54567349 CTCCCACATCGGGTGCGGAGGGG + Intronic
1120914836 14:89701790-89701812 CTTCCCCTGCGGGGCCGGAGTGG + Intergenic
1202921947 14_KI270723v1_random:35210-35232 CTACACCGGCGCGTGGGGAACGG + Intergenic
1127097723 15:55529677-55529699 CTACCTCAGCGGGGGTGGAGGGG - Intergenic
1129189250 15:73927799-73927821 CGCCCCCGCCGGGTGGGGAGCGG + Exonic
1129395785 15:75245294-75245316 TTACCCCGGCTGGAGTGGAGTGG - Intergenic
1130602745 15:85287948-85287970 CTACCCAGGCTGGAGCGCAGTGG - Intergenic
1134784231 16:16926271-16926293 CTGCCCCGGCGGGGGCAGGGGGG - Intergenic
1139593030 16:67943723-67943745 CTAACCCAGGGGGGGCGGAGTGG - Exonic
1139884374 16:70198110-70198132 TTACCCCGGCGGGAGTGCAGTGG + Intergenic
1140368145 16:74397382-74397404 TTACCCCGGCGGGAGTGCAGTGG - Intergenic
1140774857 16:78240231-78240253 CTACTCGGGAGGCTGCGGAGGGG + Intronic
1141538632 16:84700442-84700464 CTCCCCCGGCCGGCGCGGCGGGG - Intronic
1152204596 17:78967780-78967802 CTACCCCGGGGTGTGGGGACAGG + Intergenic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1152554409 17:81045862-81045884 CTTCCCCGGGGGGTCAGGAGGGG - Intronic
1152741380 17:82019948-82019970 CCACCCTGGGGGGTGCGGGGGGG - Intronic
1153872605 18:9334686-9334708 GGACCCCAGCGGGGGCGGAGGGG + Intergenic
1156858117 18:41806466-41806488 CTTGCCCGGCTGGTGAGGAGGGG - Intergenic
1157103993 18:44756104-44756126 CTACTCCGGAGGGTGAGGAGGGG + Intronic
1160679033 19:404684-404706 CTGCCCCGAGGGGTGTGGAGGGG + Intergenic
1161520273 19:4719976-4719998 CAACCCCAGCAGGTGGGGAGTGG + Intronic
1162778954 19:12996639-12996661 CGACCCGGGCTGCTGCGGAGTGG + Intronic
1163830713 19:19545981-19546003 CTACCCCGGCGGGTGCGGAGGGG - Exonic
1164594740 19:29525782-29525804 CAACCCAAGCGGGTGCGGGGCGG + Intergenic
1165312127 19:35034725-35034747 CTACCCCAGAGGGTGGGGAGAGG - Intronic
1165476802 19:36035340-36035362 CTACCCAGGCGTGGGCGGTGGGG + Exonic
1167484001 19:49749657-49749679 TTACCCTGGCTGGTGTGGAGCGG + Intronic
926251308 2:11156764-11156786 CTACCCTGCGGGGTGGGGAGGGG + Intronic
926819257 2:16834827-16834849 TTACCCAGGCGGGTGTGCAGTGG + Intergenic
927181099 2:20447287-20447309 CTGCCGCGGCGGGGGCGGTGGGG - Exonic
934966697 2:98730619-98730641 CTGATCCGGGGGGTGCGGAGGGG - Intronic
935755047 2:106270312-106270334 GGACCCCAGCTGGTGCGGAGGGG - Intergenic
947177750 2:227384557-227384579 CTAACCCGGGGTGTGCAGAGTGG - Intergenic
1176054475 20:63136503-63136525 CAACCCCGGGAGGTGGGGAGTGG + Intergenic
1179522546 21:41954233-41954255 CAACCCCGGCGGCTGCTGTGCGG + Intergenic
1179726526 21:43344224-43344246 CTTCCCCAGCGGGTGGGGTGGGG - Intergenic
1179895226 21:44358112-44358134 TTACCCGGGCGGGTGTCGAGGGG - Intronic
1180844079 22:18972060-18972082 CAGCCCTGGTGGGTGCGGAGTGG - Intergenic
1181563017 22:23716739-23716761 CTGCCCAGGTGGGAGCGGAGTGG - Intergenic
1184655565 22:45940360-45940382 CTGTCCCGGTGGGTGTGGAGTGG - Intronic
1185043188 22:48516026-48516048 CAAGGCCGGCGGGTGCTGAGCGG - Intronic
954615704 3:51967781-51967803 CTGGCCTGGCGGGAGCGGAGGGG - Intronic
959807988 3:110581178-110581200 CTACCCAGGCTGGAGTGGAGTGG + Intergenic
959849661 3:111071757-111071779 CGACGCGGGCGGGTGCCGAGGGG + Exonic
960517561 3:118618820-118618842 CTACCCCCGTAGGTGCGGGGTGG - Intergenic
961532669 3:127548715-127548737 CTGCCCCGGCTGGAGCGCAGTGG - Intergenic
967849551 3:194071415-194071437 CACGCCCGGCGGGGGCGGAGGGG + Intergenic
977176745 4:93828443-93828465 CCACCCCGGCGGCTGGGGTGCGG - Intergenic
985467701 5:12986-13008 CGTCCCCGGCGGGGGCGGGGTGG + Intergenic
985549149 5:524448-524470 CCACCCCGGCGGGCGGGGATCGG - Intergenic
986690207 5:10307785-10307807 CAAGCCCGGAGGGGGCGGAGAGG + Exonic
991120529 5:63008330-63008352 CCACCCCTGCGGGTGAGCAGAGG - Intergenic
1003869407 6:10390305-10390327 TTTCCCCGGCGGGGGCGGGGAGG - Intergenic
1016949449 6:149566259-149566281 CTCCCCGGGCGGCCGCGGAGAGG - Intergenic
1020248175 7:6446968-6446990 CTACCCAGGCGGGAGTGCAGTGG - Intronic
1021163007 7:17298962-17298984 CTACACCGGCGGAGGCGGCGCGG - Exonic
1035906284 8:3513373-3513395 TTACCCAGGCTGGTGTGGAGTGG + Intronic
1037810020 8:22081515-22081537 TTTCCCCGGCGGGTTGGGAGGGG + Exonic
1047415268 8:124659762-124659784 TTACCCAGGTGGGAGCGGAGCGG - Intronic
1048467753 8:134681305-134681327 CTACACCAGCTGGTGGGGAGAGG + Intronic
1051774509 9:20620541-20620563 CTACGCCGGCGAGCGCGGCGCGG + Intronic
1057772862 9:97983502-97983524 TTTCCGCGGCGGGGGCGGAGGGG - Exonic
1187040365 X:15588629-15588651 CTATCCTGGTGGGTGTGGAGTGG + Intronic
1187390826 X:18885712-18885734 GTACCCCAGCCGGTGGGGAGAGG - Intergenic
1189385819 X:40536135-40536157 TCACCCCGGCGGGGGCGCAGTGG - Intergenic
1190761402 X:53440939-53440961 CGACCTTGGCGGGCGCGGAGCGG - Intergenic