ID: 1163832712

View in Genome Browser
Species Human (GRCh38)
Location 19:19554657-19554679
Sequence GGGTGTCCCCAAAGGCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163832697_1163832712 23 Left 1163832697 19:19554611-19554633 CCAGCTCTCCCAGCCTGGCAGAT No data
Right 1163832712 19:19554657-19554679 GGGTGTCCCCAAAGGCAAGAAGG No data
1163832706_1163832712 -8 Left 1163832706 19:19554642-19554664 CCCTTCTCCCAGCCTGGGTGTCC No data
Right 1163832712 19:19554657-19554679 GGGTGTCCCCAAAGGCAAGAAGG No data
1163832695_1163832712 27 Left 1163832695 19:19554607-19554629 CCCTCCAGCTCTCCCAGCCTGGC No data
Right 1163832712 19:19554657-19554679 GGGTGTCCCCAAAGGCAAGAAGG No data
1163832696_1163832712 26 Left 1163832696 19:19554608-19554630 CCTCCAGCTCTCCCAGCCTGGCA No data
Right 1163832712 19:19554657-19554679 GGGTGTCCCCAAAGGCAAGAAGG No data
1163832705_1163832712 -7 Left 1163832705 19:19554641-19554663 CCCCTTCTCCCAGCCTGGGTGTC No data
Right 1163832712 19:19554657-19554679 GGGTGTCCCCAAAGGCAAGAAGG No data
1163832701_1163832712 10 Left 1163832701 19:19554624-19554646 CCTGGCAGATGAGTGGCCCCCTT No data
Right 1163832712 19:19554657-19554679 GGGTGTCCCCAAAGGCAAGAAGG No data
1163832704_1163832712 -6 Left 1163832704 19:19554640-19554662 CCCCCTTCTCCCAGCCTGGGTGT No data
Right 1163832712 19:19554657-19554679 GGGTGTCCCCAAAGGCAAGAAGG No data
1163832699_1163832712 15 Left 1163832699 19:19554619-19554641 CCCAGCCTGGCAGATGAGTGGCC No data
Right 1163832712 19:19554657-19554679 GGGTGTCCCCAAAGGCAAGAAGG No data
1163832700_1163832712 14 Left 1163832700 19:19554620-19554642 CCAGCCTGGCAGATGAGTGGCCC No data
Right 1163832712 19:19554657-19554679 GGGTGTCCCCAAAGGCAAGAAGG No data
1163832707_1163832712 -9 Left 1163832707 19:19554643-19554665 CCTTCTCCCAGCCTGGGTGTCCC No data
Right 1163832712 19:19554657-19554679 GGGTGTCCCCAAAGGCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163832712 Original CRISPR GGGTGTCCCCAAAGGCAAGA AGG Intergenic
No off target data available for this crispr